A method for detecting the length of mRNA Poly(A) tail

Abstract

The present invention provides a method for detecting the length of mRNA Poly(A) tail, which belongs to the field of biotechnology. The mRNA to be tested is digested with an RNA hydrolase having a non-adenine nucleotide (U, C, G) digestion site to obtain a Poly(A) tail sequence fragment of the mRNA and a hydrolysis product of other digestion small fragments. The Poly(A) tail sequence in the hydrolysis product is treated with Oligo(dT) n Magnetic bead capture. The length of the mRNA Poly (A) tail is detected by a capillary electrophoresis device. By setting a reverse electrophoresis program, as well as a specific gel casting and gel preservation program, the automated batch detection of the length of the mRNA Poly (A) tail can be achieved. The present invention can accurately and batch detect the length of the Poly (A) tail sequence of mRNA, and has high sensitivity, good repeatability, easy results to judge, low operating cost, simple operation, and is widely used in basic biological research, drug development and production quality inspection of mRNA.

Description

Technical Field

[0001] The present invention relates to a method for accurately and batch-wise detecting the length of mRNA Poly(A) tails by using capillary electrophoresis technology, which belongs to the field of biotechnology and is suitable for basic research and quality control detection involving the need for detecting the length of mRNA Poly(A) tails. Background Art

[0002] mRNA vaccines are a true testimony to the rapid development of mRNA technology in the past 30 years. The two most successful COVID-19 mRNA vaccines developed by Pfizer / BioNTech and Moderna are based on in vitro transcription (IVT) mRNA. Usually, IVT mRNA consists of a single-stranded open reading frame (ORF) as the core, flanked by two untranslated regions (UTR), namely 5'UTR and 3'UTR, and contains post-transcriptional modifications at the 5' / 3' end that play an important role in mRNA stability and translation efficiency: 5' cap and 3' Poly (A) tail.

[0003] The 3'Poly(A) tail is a very important transcriptional modification. In eukaryotes, the Poly(A) tail is co-transcriptionally added to the nucleus to assist in the export of mature mRNA to the cytoplasm. The Poly(A) tail protects mRNA from nuclease degradation by poly(A) binding protein (PABP). In addition, it can work synergistically with the mRNA 5' end cap to promote mRNA translation. Transcripts with short Poly(A) tails are not only translationally inhibited, but are also substrates for decapping enzymes. Therefore, shortening of the Poly(A) tail (deadenylation) will eventually trigger translation inhibition and subsequent mRNA degradation. The traditional view is that a longer tail means more protection, greater stability, and better translation efficiency. Transcripts are regulated by different Poly(A) tail lengths, resulting in huge differences in the translation efficiency and stability of mRNA.

[0004] The most challenging problem in studying the length of poly(A) tails is that they are difficult to sequence and measure accurately. Poly(A) tail sequencing is difficult to accurately determine using standard RNA-seq protocols, mainly because it is difficult to read homopolymer sequences. Currently, there are some methods for measuring the length of poly(A) tails of mRNA, such as Northern blotting, ATP consumption detection, LC-MS, high-throughput sequencing analysis, etc. Each method has its own advantages and disadvantages. For example, the Northern blotting method is complex and time-consuming. It can obtain an approximate range of the length of the Poly (A) tail based on the area of ​​the blot, but it cannot accurately give the length of the Poly (A) tail of the mRNA. The ATP consumption detection method requires the preparation of a standard curve according to different types of samples or samples with different technical process flows. There is instability between batches and it can only be used for enzymatic tailing. It is not applicable to the detection of co-transcription type tailing samples. The LC-MS method can accurately evaluate the length of the Poly (A) tail, but it has high equipment requirements and a high single machine cost. The high-throughput sequencing analysis method is controversial in terms of its accuracy due to the limitation that the standard sequencing method is difficult to read homopolymer sequences and usually requires secondary processing of reverse transcription. This method adds complexity to the quality inspection of the Poly (A) tail length of mRNA drugs in drug development and production.

[0005] Chinese patent CN105734053B discloses "a method for constructing a high-throughput sequencing analysis Poly (A) tail length library". The patent provides a library construction method for determining the length of the Poly (A) tail, that is, using a kit to add a 3' linker to the sample to be tested, and then transcribe it into cDNA, and then use the library construction kit to enrich the 3' end information of the sample sequence to be tested, and then use the high-throughput sequencer IlluminaNextSeq500 SR300 to determine the Poly (A) tail length of the mRNA. However, this method cannot directly measure the Poly (A) tail length of mRNA, but must go through the process of reverse transcription from mRNA to cDNA, and is restricted by factors such as the efficiency of the transcription kit, the proficiency of the operator, and the quality of the mRNA sample after multi-step processing, which will affect the accuracy of the final test results. In addition, due to the limitation that standard sequencing is difficult to read homopolymer sequences, the accuracy of the test results may also be controversial.

[0006] Chinese patent CN110452951B discloses a "method and application for monitoring the length of mRNA Poly (A) tail". The patent provides a method for monitoring the length of mRNA Poly (A) tail. The method measures the ATP consumption and / or PPi generation at different reaction time points in the standard tailing reaction, draws a standard curve of the standard mRNA tailing length and the reaction time, and then determines the mRNA Poly (A) tailing length by the ATP consumption in the mRNA reaction solution to be tested. However, this method is only applicable to mRNA synthesis or production processes that require a separate tailing reaction, and is not applicable to the co-transcription mRNA tailing commonly used in current industrial production. In addition, during the use of this method, once the various materials in the system change, it will affect the test results.

[0007] CE technology is a method for separating and analyzing biomolecules (nucleic acids, proteins, peptides, sugars, etc.) based on differences in charge and molecular weight. By using an electric field to move charged biomolecules in a charged capillary, molecules of different sizes, charges, and shapes can be separated. mRNA is a single-stranded biomacromolecule composed of nucleotides with negative charges. Therefore, under the action of an electric field, it can move in the capillary and be differentially separated based on the size, morphology, and charge density of mRNA. The specific process of mRNA separation involves many factors, including the pH value of the buffer, the ion concentration and type, the type and size of the capillary material, and so on. In practical applications, it is necessary to adjust and optimize according to different samples and experimental purposes. By optimizing the experimental conditions in a targeted manner, efficient and high-resolution separation and quantification of nucleic acid samples can be achieved. In short, CE technology is widely used in biomedicine, molecular biology, food science and other fields.

[0008] In summary, the current methods for determining the length of mRNA Poly(A) tail mainly include: Northern blotting, ATP consumption detection, LC-MS, high-throughput sequencing analysis, etc. Each method has its own advantages and limitations. At the same time, the samples to be tested used in the current detection methods are all processed by manual operation, and there is no increase in the automated processing of mRNA samples and the method of batch processing of mRNA samples. There may be large differences between samples in manual operation batches, and it is difficult to achieve the standard requirements for the controllability of batch sample quality.

[0009] Therefore, developing a complete set of simple, economical, efficient, batch and automated methods for detecting the length of mRNA Poly(A) tail is one of the urgent issues to be solved in mRNA drug research and drug production quality inspection. Summary of the invention

[0010] In view of the shortcomings of the prior art in detecting the length of mRNA Poly (A) tails, and to meet the actual needs of mRNA drug development and production, the present invention provides a method for detecting the length of mRNA Poly (A) tails quickly, accurately, in batches, and at low cost. This method is suitable for quality control during the production of mRNA drugs and the characterization of active pharmaceutical ingredients in mRNA drug products.

[0011] The present invention is based on Oligo(dT) n Oligo(dT) is a dT-binding protein that forms a stable hybrid with the Poly(A) tail sequence fragment of mRNA under high salt conditions, but cannot enrich the Poly(A) tail sequence fragment lacking mRNA. n The magnetic beads capture the Poly(A) tail sequence fragments of mRNA. After the automated purification process, the small mRNA fragment impurities cut off in the reaction system, as well as the small molecules and enzymes in the enzyme cutting system are removed, so that the Poly(A) tail sequence of the retained mRNA - Oligo(dT) n The magnetic beads are denatured by heating and then dissociated to obtain the oligo(dT) n The Poly(A) tail sequence fragments of the mRNA in the complementary region, and then according to the differences in molecular weight and charge of the Poly(A) tail fragments of the mRNA, by adding nucleic acid internal standards, the length abundance and distribution of the Poly(A) tail of the mRNA can be obtained.

[0012] The present invention is accomplished by the following technical scheme: A method for detecting the length of mRNA Poly (A) tail, characterized by comprising the following steps:

[0013] (1) using an RNA hydrolase having a non-adenine nucleotide (U, C, G) cleavage site to enzymatically digest the mRNA to obtain a poly (A) tail sequence fragment of the mRNA and hydrolysis products of other small cleavage fragments;

[0014] The RNA hydrolase is an RNA hydrolase that has at least one of the following characteristics: cleaving guanine (G) at the 5' / 3' end, cytosine (C) at the 5' / 3' end, or uracil (U) at the 5' / 3' end of an RNA molecule;

[0015] The guanine (G), cytosine (C), and uracil (U) are selected according to the types of unmodified / modified nucleotides actually composed in the mRNA sequence to be tested, and a suitable RNA hydrolase is selected;

[0016] Preferably, the mRNA to be tested is digested with RNase T1 that only digests guanine (G) at the 3' end of RNA molecules to obtain a Poly (A) tail sequence fragment of the mRNA, 3'-GMP, and an oligonucleotide sequence fragment containing a 3'-GMP end; the concentration of RNase T1 hydrolyzing RNA is ≥25U / μg, and the digestion reaction time is 10-15 minutes;

[0017] (2) heating the hydrolyzate in step (1) to 65° C. and incubating for 2 minutes to destroy the secondary structure, and then placing the hydrolyzate on ice for 2-10 minutes;

[0018] (3) equilibrating the hydrolysate of step (2) to room temperature, and capturing the Poly(A) tail sequence in the hydrolysate of step (2) using Oligo(dT)n magnetic beads;

[0019] In the Oligo(dT)n, n≥15nt;

[0020] Preferably, commercially available Oligo(dT)25 magnetic beads are used, and the magnetic beads are captured or fixed by magnetic attraction, including but not limited to using a magnetic stand or a magnetic head of an automated nucleic acid extraction instrument;

[0021] (4) heating and denaturing the Poly(A) tail sequence-magnetic bead complex captured in step (3);

[0022] The heating denaturation is denaturation at 65-100° C. for 2-8 minutes;

[0023] Preferably, denaturation at 80° C. for 2 minutes is used to dissociate the Poly(A) tail sequence from the magnetic beads, and the dissociated Poly(A) tail fragments are collected;

[0024] (5) using CE to obtain the sequence map of the Poly(A) tail of mRNA from the Poly(A) tail fragments collected in step (4);

[0025] (6) By adding nucleic acid internal standards, the nucleic acid internal standard spectrum was obtained by CE, and the standard curve equation of the nucleic acid internal standard length (nt) and retention time (min) was fitted using R language. The length of the Poly (A) tail sequence of mRNA and its distribution were obtained based on the fitted standard curve equation.

[0026] The steps (1) to (4) are automatically processed using an automatic nucleic acid extractor, or manually processed. The automatic nucleic acid extractor can reduce the batch differences caused by manual operations, and obtain a Poly (A) tail sample of mRNA with stable quality that can be used for detection. The automatic nucleic acid extractor includes but is not limited to the Thermo Scientific KingFisher Apex nucleic acid purification system and the Roche MagNA Pure LC fully automatic nucleic acid purification and sample loading system.

[0027] In the step (6), a nucleic acid internal standard is added, and the correlation between the nucleic acid internal standard and its retention time is fitted to a standard curve using R language, and the nucleic acid length and distribution of the mRNA to be tested are output according to the standard curve; the nucleic acid internal standard can not only help obtain the Poly (A) tail sequence length of the mRNA to be tested, but also monitor the sample peak deviation.

[0028] In the steps (5) and (6), the following optimization and improvements are made to the CE detection:

[0029] (1) When using CE to detect the length of the Poly(A) tail sequence of mRNA, after the electrophoresis of each sample is completed, a reverse electrophoresis program is added for 10-60 minutes to balance the ionic strength in the positive and negative buffer bottles. This can achieve single gel filling and batch detection for multiple mRNA samples to be tested, and obtain stable results for the length of the mRNA Poly(A) tail.

[0030] (2) When using CE to detect the length of the Poly(A) tail sequence of mRNA, the sample peak time can be kept stable and the sample peak offset can be reduced by editing the program to repeat the equilibration and gel filling at intervals.

[0031] Under normal conditions, CE gel can only be used continuously for 6 hours after one gel injection. By storing the gel in a sample tray at 2-8°C, the normal physical and chemical properties of the gel can be maintained for 24 hours, allowing it to operate stably and output normal peak spectra after multiple gel injections.

[0032] (3) When using CE to detect the length of the Poly(A) tail sequence of mRNA, batch detection of the length of the Poly(A) tail sequence of mRNA can be achieved with a single start-up. When there are many nucleic acid samples to be detected, the samples should be stored in a sample tray at 2-8°C.

[0033] (4) CE detection can accurately separate the Poly(A) tail sequences of mRNA that differ by a single base. Depending on the properties of the Poly(A) tail sample of the mRNA, the length of the capillary used varies according to the resolution. The length of the capillary generally used is 10-60 cm.

[0034] The CE detector uses an ultraviolet (UV) detector or a laser-induced fluorescence (LIF) detector, wherein the minimum quantification limit and the minimum detection limit of the LIF detector for nucleic acid samples are ng / mL, and even trace amounts of mRNA Poly (A) tail sequence lengths can be accurately detected; the CE detectors used include but are not limited to BECKMAN PA800 and SCIEX PA800plus.

[0035] In the present invention, since the CE detector has high precision, sensitivity and resolution, the CE detector can be used to accurately separate the Poly(A) tail sequence of mRNA with a single base difference, and can also be used to increase the Oligo(dT) n The automatic purification step of magnetic beads obtains a low-background electrophoresis pattern, and the electrophoresis pattern is used to obtain the length of the Poly (A) tail sequence of the mRNA, effectively improving the detection accuracy.

[0036] The method for detecting the length of mRNA Poly(A) tail of the present invention can be widely applied to the quality control of mRNA in basic biological research, clinical diagnosis, drug development and drug production.

[0037] The present invention has the following technical effects: it can detect the length and distribution of the Poly(A) tail sequence of mRNA in batches; it can detect natural mRNA containing a Poly(A) tail or artificially synthesized mRNA containing a Poly(A) tail. The above technical scheme can accurately and batch detect the length of the Poly(A) tail sequence of mRNA, and has high sensitivity, good repeatability, easy results to judge, low operating cost, and is widely used in basic biological research, drug development and production quality inspection of mRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The drawings are for illustrative purposes only and are in no way limiting.

[0039] Figure 1 The figure is a flow chart for detecting the length of the Poly(A) tail sequence of mRNA, where the symbol "Y" represents uracil (U) or cytosine (C);

[0040] Figure 2 The CE electrophoresis diagram of the Poly(A) tail sequence of mRNA in Example 3;

[0041] Figure 3 This is the CE electrophoresis diagram of the first segment of Poly(A) of mRNA in Example 3;

[0042] Figure 4 This is the CE electrophoresis diagram of the second segment of Poly(A) of mRNA in Example 3;

[0043] Figure 5 This is the CE electrophoresis diagram of the nucleic acid internal standard of mRNA in Example 3;

[0044] Figure 6 The nucleotide (nt) and peak time (min) fitting curve of the nucleic acid internal standard of mRNA in Example 3;

[0045] Figure 7 This is the distribution diagram of the Poly(A) tail sequence length of mRNA in Example 3.

[0046] Unless otherwise specified, the terms used in the present invention have similar or identical meanings to those in the art.

[0047] The term "messenger RNA" refers to a polynucleotide encoding at least one polypeptide. As described herein, mRNA encompasses both modified and unmodified polynucleotides. mRNA may contain one or more coding and non-coding regions. mRNA may be purified from natural sources, or may be artificially transcribed in vitro or chemically synthesized, etc. Where appropriate, for example, in the case of chemically synthesized molecules, mRNA may contain nucleoside analogs, such as analogs with chemically modified bases or sugars, backbone modifications, etc. Unless otherwise indicated, the display direction of mRNA sequences is 5' to 3'.

[0048] The term "internal standard" is used to solve the problem of sample retention time offset in capillary electrophoresis detection, calibrate the molecular weight of the target substance to be tested, and quantitatively detect the relative molecular weight of mRNA. The term "purification" refers to reducing the impact of other small molecules in the sample to be tested on the background signal of the spectrum, and is used to reduce the background noise of the spectrum.

[0049] The term "denaturation" refers to the dissociation of duplexes or hybrids formed through Watson-Crick base pairing or non-canonical base pairing into single strands under high temperature conditions.

[0050] The term "annealing" or "hybridization" is to form a complex (also called a duplex or hybrid) between nucleotide sequences via Watson-Crick base pairing or non-canonical base pairing.

[0051] The term "nucleic acid" refers to a polymer of nucleotide monomers or their analogs, such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or a combination thereof. The terms "nucleic acid", "nucleic acid molecule", "polynucleotide" or "oligonucleotide" are used interchangeably herein.

[0052] The term "nucleotide" refers specifically to a nucleotide monomer, such as a monomer of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The terms "nucleotide", "base" or "mononucleotide" are used interchangeably herein.

[0053] The term "Oligo(dT) n ", is a polythymine (T) repeat oligonucleotide, that is, a nucleotide chain composed only of T, Oligo (dT) n It can specifically bind to the Poly(A) tail sequence of mRNA, so the Poly(A) tail sequence can be specifically separated and purified. DETAILED DESCRIPTION

[0054] The present invention provides a method for batch detecting the length of mRNA Poly (A) tail using capillary electrophoresis technology, comprising the following steps:

[0055] (1) using an RNA hydrolase having a non-adenine nucleotide (G) cleavage site to enzymatically digest the mRNA to be tested, thereby obtaining a poly (A) tail sequence fragment of the mRNA and hydrolysis products of other small enzyme-cleaved fragments;

[0056] (2) heating the hydrolyzate in step (1) to 65° C. and incubating for 2 minutes to destroy the secondary structure, and then placing the hydrolyzate on ice for 2 minutes;

[0057] (3) The hydrolyzate of step (2) was equilibrated to room temperature and then reacted with Oligo(dT) n The magnetic beads capture the Poly(A) tail sequence in the hydrolyzate of step (2);

[0058] (4) heating and denaturing the poly(A) tail sequence-magnetic bead complex obtained in step (3) to dissociate the poly(A) tail sequence from the magnetic beads, and collecting the dissociated poly(A) tail fragments;

[0059] (5) using capillary electrophoresis (CE) to obtain the poly(A) tail sequence map of mRNA from the poly(A) tail fragments collected in step (4);

[0060] (6) By adding nucleic acid internal standards, the nucleic acid internal standard spectrum was obtained by CE, and the standard curve equation of the nucleic acid internal standard length (nt) and retention time (min) was fitted using R language. The length of the Poly (A) tail sequence of mRNA and its distribution were obtained based on the fitted standard curve equation.

[0061] In the present invention, the RNA hydrolase in step (1) has a non-adenine nucleotide (U, C, G) cleavage site, and is preferably RNase T1.

[0062] In the present invention, step (1) uses RNase T1 to hydrolyze RNA in a concentration range of ≥25 U / μg, and the enzyme digestion reaction time is 10 minutes.

[0063] In the present invention, the capture magnetic beads in step (3) are Oligo(dT) n Magnetic beads, preferably Oligo(dT) 25 Magnetic beads are commercially available.

[0064] In the present invention, the thermal denaturation condition in step (4) is denaturation at 65-100°C for 2-8 minutes, preferably, 80°C for 2 minutes.

[0065] In the present invention, the process of steps (1) to (4) is carried out on an automatic nucleic acid extractor, and the automatic nucleic acid extractor is: Thermo Scientific KingFisherApex nucleic acid purification system, Roche MagNA Pure LC fully automatic nucleic acid purification and sample loading system, preferably the Thermo Scientific KingFisherApex nucleic acid purification system.

[0066] In the present invention, the length of the capillary for capillary electrophoresis in steps (5) and (6) is 10-60 cm, preferably 40 cm.

[0067] In the present invention, the processes of steps (5) and (6) are performed on a capillary electrophoresis device, and the capillary electrophoresis device is: BECKMAN PA800, SCIEX PA800plus.

[0068] In the present invention, the capillary electrophoresis described in steps (5) and (6) also includes a step of adding reverse electrophoresis for 10-60 minutes after the electrophoresis of each sample needle is completed, which is used to balance the ionic strength in the positive and negative electrode buffer bottles, so that a single gel filling and batch detection can be achieved for multiple mRNA samples to be tested, and stable results of mRNA Poly (A) tail length are obtained, preferably 20 minutes.

[0069] In the present invention, the capillary electrophoresis in steps (5) and (6) also includes, for batch detection samples, after the electrophoresis of every 3-6 samples is completed, repeating the balancing and gel filling at intervals by editing the program, so as to obtain a stable detection result of the mRNA Poly (A) tail length.

[0070] In the present invention, the capillary electrophoresis in steps (5) and (6) further comprises storing the gel used in a sample tray at 2-8° C., so as to maintain the stability of the gel properties within 24 hours.

[0071] In the present invention, the method for detecting the length of the mRNA Poly (A) tail can be widely used in basic biological research, clinical diagnosis, drug development and mRNA quality control in drug production.

[0072] The technical solution provided by the present invention is described in detail below in conjunction with embodiments.

[0073] The techniques or conditions not specified in detail in the following examples can be operated according to the literature in the art or the product instructions used.

[0074] The consumables, reagents or instruments used can be purchased through regular commercial channels.

[0075] The following examples are only used to explain the present invention, to facilitate the understanding of the technician, but not to limit the scope of the present invention. The following examples can be used as a guide for further improvements by those skilled in the art, and do not constitute any limitation of the present invention in any way.

[0076] Example 1

[0077] In this example, mRNA for testing was prepared by in vitro transcription using the co-transcription method to prepare tailed firefly luciferase (Fluc) mRNA.

[0078] The in vitro transcription product includes 5' and 3' untranslated regions, which are represented as X and Z in the following sequence (SEQ ID NO: 1), respectively, wherein the mRNA sequence of the codon-optimized firefly luciferase (Fluc) is as follows (SEQ ID NO: 1):

[0079]

[0080] The X sequence in the codon-optimized mRNA sequence of firefly luciferase (Fluc) (SEQ ID NO: 2) is as follows:

[0081] AGGGAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAA CCCGCCACC

[0082] The Z sequence in the codon-optimized mRNA sequence of firefly luciferase (Fluc) (SEQ ID NO: 3) is as follows:

[0083] CAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGCAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0084] The in vitro transcription reaction and the preparation of mRNA Poly(A) tail detection samples must be performed in a completely DNase / RNase-free environment, and unless otherwise specified, all consumables, reagents, buffers, etc. involved must be nuclease-free.

[0085] In vitro transcription is used to prepare mRNA samples containing a Poly(A) tail, using a linearized DNA plasmid or PCR product containing the Fluc gene as a transcription template after enzyme removal and purification, using a commercially available T7 in vitro transcription kit, and the reaction system is shown in Table 1.

[0086] Table 1 In vitro transcription system of mRNA containing Poly(A) tail

[0087] Components 20μL reaction system (μL) DNase / RNase-Free Water 4.4 GTP (100 mM) 2 ATP(100mM) 2 UTP1 (100 mM) 2 CTP1 (100 mM) 2 CleanCap AG(100mM) 1.6 10XTranscription Buffer 2 DNA template (2 μg) 1000 ng / μL 2 T7RNA Polymerase Mix 2 Total volume 20

[0088] According to the above system, each component was added to a 200 μL PCR tube without enzyme, mixed and centrifuged, and then placed on a PCR instrument for reaction at 37°C for 2 hours. After the transcription reaction was completed, 2U DNase I was added to each system and continued to react at 37°C for 15 minutes to remove the template DNA. The integrity of the synthesized mRNA was detected by denaturing agarose gel electrophoresis. After the test was qualified, the mRNA sample containing the Poly (A) tail was obtained by purification, and the concentration of the mRNA was detected by a micro-ultraviolet spectrophotometer.

[0089] Example 2

[0090] In this embodiment, a sample for detecting the length of mRNA Poly (A) tail is prepared. The mRNA sample is the mRNA sample synthesized by in vitro transcription in Example 1.

[0091] The instrument used for the automated processing of nucleic acid samples in this example is the Thermo Scientific King Fisher Apex Nucleic Acid Purification System.

[0092] (1) Solution preparation

[0093] RNase T1 digestion reaction buffer (10X): 500 mM Tris-HCl (pH 7.5), 20 mM EDTA.

[0094] Binding buffer: 20 mM Tris-HCl (pH 7.5), 1.0 M LiCl, 2 mM EDTA.

[0095] Wash buffer: 10 mM Tris-HCl (pH 7.5), 0.15 M LiCl, 1 mM EDTA.

[0096] (2) Automated sample processing

[0097] The samples and magnetic beads were transferred to a 96-well deep-well plate and placed on the operating tray of the Thermo Scientific KingFisherApex nucleic acid purification system, respectively, and the automated mRNA sample processing program set in Table 2 was followed.

[0098] Table 2

[0099]

[0100] Through the above-mentioned automated procedure, the purification of the mRNA Poly(A) tail detection sample is completed, and the sample can be tested on the machine after it cools to room temperature.

[0101] Example 3

[0102] In this example, CE was used to detect the length of the Poly(A) tail of mRNA, and the sample used was the sample prepared in Example 2.

[0103] The instrument used for the capillary electrophoresis technology in this embodiment is the SCIEX biopharmaceutical analysis system PA800Plus.

[0104] The conditions used for CE were: electrophoresis voltage 30 kV, UV light collection wavelength 254 nm, injection time 15 s, and the program sequence was set as shown in Table 3.

[0105] Table 3

[0106] serial number content 1 Gluing and balancing 2 Nucleic acid internal standard electrophoresis 3 Reverse balanced capillary 4 Poly(A) tail sample electrophoresis 5 Cleaning-Shutdown Procedure

[0107] After obtaining the CE electrophoresis diagram of the nucleic acid internal standard, the data of the nucleic acid internal standard length (nt) and the capillary electrophoresis retention time (min) are obtained. Based on these data (the bold part in the following code), the following R language code is used to fit the correlation between the nucleic acid molecule internal standard length (nt) and the retention time (min) to the standard curve, see Figure 6 , and obtain the Poly(A) tail length graph, such as Figure 7 .

[0108]

[0109]

[0110] In the in vitro co-transcription tailing reaction, due to the "slipping chain effect" during DNA transcription, most of the slipping occurs near the end of the Poly(A) tail. The Poly(A) tail of mRNA faces the "brake" to terminate transcription prematurely or "no time to brake" and excessive transcription leads to a longer Poly(A) tail. Therefore, the length of the Poly(A) tail in actual detection is not a fixed value, but a normal distribution centered on a fixed length. Figure 2 The results show this distribution very well. The poly (A) tail in this example is not a one-piece poly (A), but is composed of two segments of poly (A). Figure 2-4 ). Longer polyadenylic acid stretches increase mRNA stability and translation efficiency, and the segmented structure helps reduce unwanted recombination during plasmid production and maintains the stability of the template sequence. Figure 3 and Figure 4 The numbers of the Poly(A) tail peaks are marked in the figure. According to the electrophoresis spectrum of the nucleic acid internal standard ( Figure 5 ), and use the R language linear fitting fit<-lm(time-nt,data=df) to obtain the standard curve ( Figure 6 ), thereby obtaining the distribution of Poly(A) tail length and determining the length of the Poly(A) tail of mRNA ( Figure 7 ).

[0111] By adding nucleic acid internal standards, the stability of the instrument, accessories and procedures can also be monitored, and the internal standards can be used to accurately analyze the length of the Poly (A) tail of the sample. Therefore, the present invention is a method that is very suitable for detecting the length of the mRNA Poly (A) tail.

[0112] In summary, in this embodiment, the characteristic peak baseline is smooth, the signal-to-noise ratio is high, and the separation between the Poly (A) tail signal peaks of similar length is high. The present invention uses capillary electrophoresis with high sensitivity and high precision to analyze the length of the Poly (A) tail of mRNA. By setting a reverse electrophoresis program, as well as a specific gel filling and gel preservation program, batch quantitative detection of the length of the mRNA Poly (A) tail can be achieved, and once the program is set, it can run stably without modification. The method of the present invention is simple to operate, has low consumables cost, and accurate experimental results, and is very suitable for quality inspection in the industrialization of mRNA drugs.

[0113] The present invention only illustrates the detailed steps of the present invention through the above-mentioned embodiments, but the present invention is not limited to the detailed methods and scopes in the above-mentioned embodiments, that is, the present invention does not need to rely on the above-mentioned detailed methods and specific parameters to be implemented. Those skilled in the art should understand that any technical improvements to the present invention, equivalent replacement of various product raw materials used in the present invention and addition of auxiliary components, replacement of equipment and instrument models and brands involved in the present invention, selection of specific implementation methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for detecting the length of mRNA Poly(A) tail, characterized in that The following steps are involved: (1) Using an RNA hydrolase with a non-adenine nucleotide (U, C, G) cleavage site to digest the mRNA to obtain the mRNA Poly (A) tail sequence fragment and other enzyme cleavage small fragment hydrolysis products; (2) heating the hydrolyzate in step (1) to 65°C and incubating for 2 minutes to destroy the secondary structure, and then placing the hydrolyzate on ice for 2-10 minutes; (3) The hydrolyzate of step (2) was equilibrated to room temperature and then reacted with Oligo(dT) n Magnetic beads capture the poly(A) tail sequence in the hydrolysate of step (2); (4) Denaturing the poly(A) tail sequence-magnetic bead complex obtained in step (3) by heating to dissociate the poly(A) tail sequence from the magnetic beads, and collecting the dissociated poly(A) tail fragments; (5) The Poly(A) tail fragments collected in step (4) are subjected to capillary electrophoresis (CE) to obtain the Poly(A) tail sequence map of mRNA; (6) By adding nucleic acid internal standards, the nucleic acid internal standard spectrum was obtained by CE, and the standard curve equation of the nucleic acid internal standard length nt and retention time min was fitted using R language. The length of the Poly(A) tail sequence of mRNA and its distribution were obtained based on the fitted standard curve equation.

2. The method for detecting the length of mRNA Poly (A) tail according to claim 1, characterized in that The RNA hydrolase in step (1) is an RNA hydrolase that has at least one of the following properties: cleavage of guanine (G) at the 5' / 3' end, cytosine (C) at the 5' / 3' end, or uracil (U) at the 5' / 3' end of an RNA molecule; The guanine (G), cytosine (C), and uracil (U) are selected to have a suitable RNA hydrolase according to the types of unmodified / modified nucleotides actually composed in the mRNA sequence to be tested.

3. The method for detecting the length of mRNA Poly (A) tail according to claim 2, characterized in that, The RNA hydrolase in step (1) is RNase T1 which has the ability to cleave guanine (G) at the 3' end of RNA molecules. The mRNA to be tested is cleaved with the RNase T1 to obtain a Poly (A) tail sequence fragment of the mRNA, 3'-GMP, and an oligonucleotide sequence fragment containing a 3'-GMP end; the concentration of RNA hydrolyzed with RNase T1 is ≥25 U / μg, and the cleavage reaction time is 10-15 minutes.

4. The method for detecting the length of mRNA Poly (A) tail according to claim 1, characterized in that: Oligo(dT) in step (3) n In the method, n≥15 nt, the beads are captured or fixed by magnetic attraction, including but not limited to using a magnetic stand or a magnetic head of an automated nucleic acid extraction instrument; The heat denaturation in step (4) is heat denaturation at 65-100°C for 2-8 minutes; The steps (1) to (4) are automatically processed using an automatic nucleic acid extractor or manually processed. The automatic nucleic acid extractor can reduce the batch differences caused by manual operation and obtain a Poly (A) tail sample of mRNA with stable quality that can be used for detection. The automatic nucleic acid extractor includes but is not limited to the Thermo Scientific KingFisher Apex nucleic acid purification system and the Roche MagNA Pure LC fully automatic nucleic acid purification and loading system.

5. The method for detecting the length of mRNA Poly (A) tail according to claim 4, characterized in that: Oligo(dT) in step (3) n Oligo(dT) 25 Commercially available magnetic beads; The step (4) of heat denaturation is heat denaturation at 80°C for 2 minutes.

6. The method for detecting the length of mRNA Poly (A) tail according to claim 1, characterized in that The mRNA to be tested includes: (1) Natural mRNA containing a Poly(A) tail or artificially synthesized mRNA containing a Poly(A) tail; (2) The length of the Poly(A) tail of the mRNA to be tested is 15-130 nt.

7. The method for detecting the length of mRNA Poly (A) tail according to claim 1, characterized in that: When the length of the Poly(A) tail sequence of mRNA is detected by CE in step (5), after the electrophoresis of each sample is completed, a reverse electrophoresis program is added for 10-60 minutes to balance the ionic strength in the positive and negative buffer bottles, so as to achieve single gel filling and batch detection for multiple mRNA samples to be tested, and obtain stable results of the length of the mRNA Poly(A) tail; When the length of the Poly(A) tail sequence of mRNA is detected by CE in step (5), the balancing and gel filling are repeated at intervals by editing the program to maintain the stability of the sample peak time and reduce the deviation of the sample peak; Under normal conditions, CE gel can only be used continuously for 6 hours after one gel injection. By storing the gel in a sample tray at 2-8 ℃, the normal physical and chemical properties of the gel can be maintained within 24 hours, so that it can still run stably after multiple gel injections and output normal peak spectra. When the CE in step (5) detects the length of the Poly(A) tail sequence of mRNA, a single startup batch detection of the length of the Poly(A) tail sequence of mRNA is achieved. When there are many nucleic acid samples to be detected, the samples should be stored in a sample tray at 2-8°C; The CE detection in step (5) can accurately separate the Poly(A) tail sequences of mRNAs that differ by a single base. Depending on the properties of the Poly(A) tail sample of the mRNA, the length of the capillary used varies according to the resolution. The length of the capillary used is generally 10-60 cm. The CE detector in step (5) uses an ultraviolet (UV) detector or a laser-induced fluorescence (LIF) detector, wherein the minimum limit of quantification and the minimum limit of detection of the LIF detector for nucleic acid samples are ng / mL, and even trace amounts of mRNA Poly (A) tail sequence lengths can be accurately detected; the CE detectors used include but are not limited to BECKMAN PA800 and SCIEX PA800plus.

8. The method for detecting the length of mRNA Poly (A) tail according to claim 1, characterized in that, In the step (6), a nucleic acid internal standard is added, and the correlation between the nucleic acid internal standard and the retention time is fitted to a standard curve using R language, and the nucleic acid length and distribution of the mRNA to be tested are output according to the standard curve; the nucleic acid internal standard can not only help obtain the Poly (A) tail sequence length of the mRNA sample to be tested, but also monitor the sample peak deviation.

Images