Application of integration sites as targets in the synthesis of vanillin

Abstract

The present invention relates to the field of bioengineering, and in particular to the use of integration sites as targets in the synthesis of vanillin. The present invention provides the use of integration sites as targets in the synthesis of vanillin; the integration sites include: one or more of delta17 site, aro10 site, delta9 site, DAK2-ZNF1 site and / or TKL2-TEF2 site. The present invention provides a new approach to synthesizing vanillin using glucose and xylose as precursors, thereby providing a universal strategy for realizing high-value utilization of all components of lignocellulose through bioconversion.

Description

Technical Field

[0001] The invention relates to the field of bioengineering, and in particular to the application of integration sites as targets in the synthesis of vanillin. Background Art

[0002] Lignocellulose mainly includes three components: cellulose, hemicellulose and lignin. It is renewable, has abundant natural reserves and is inexpensive. It is economically and socially beneficial to use it as raw material to synthesize high value-added products through biotransformation. In addition to lignin-derived monomers, which are a rich source of aromatic compounds, monosaccharides obtained from cellulose and hemicellulose by enzymatic hydrolysis, mainly including glucose and xylose, are also important biotransformation raw materials. However, traditionally, the utilization of the three components of lignocellulose is classified. For example, when cellulosic biomass is utilized, the lignin component is often removed as a by-product, resulting in a waste of resources. Therefore, it is of great significance to convert all available monomers derived from the three components of lignocellulose into high value-added products.

[0003] Vanillin (also known as vanillin) is one of the most widely used flavoring agents in the world. The traditional production method is very costly and has limited production, which cannot meet the world market demand for vanillin. By building a microbial cell factory and using the aromatic compound conversion method to produce vanillin, the produced vanillin can be regarded as natural vanillin or bio-vanillin, but the pure precursor is often expensive, which also becomes a limiting factor in its production. Summary of the invention

[0004] In view of this, the present invention provides an application of the integration site as a target in the synthesis of vanillin. The present invention provides a new way to synthesize vanillin using glucose and xylose as precursors, thereby providing a universal strategy for realizing high-value utilization of all components of lignocellulose through bioconversion.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides the use of the integration site as a target in the synthesis of vanillin;

[0007] The integration sites include: one or more of a delta17 site, an aro10 site, a delta9 site, a DAK2-ZNF1 site and / or a TKL2-TEF2 site.

[0008] The present invention also provides the use of expressed genes and / or knocked-out genes in the synthesis of vanillin;

[0009] The expressed genes include: exogenous genes and / or endogenous genes;

[0010] The knockout genes include: genes encoding decarboxylase;

[0011] The exogenous gene comprises: one or more of EcoAroL from Escherichia coli, FjTAL from Flavobacterium johnsoniae, XYL1 from Scheffersomyces stipitis, mXYL2 from Scheffersomyces stipitis, XKS1 from Scheffersomyces stipitis and / or a gene encoding methoxytransferase;

[0012] The endogenous genes include: ARO7 G141S Gene, aro3 K222L gene and / or aro4 K229L One or more of the genes;

[0013] In some embodiments of the present invention, in the above application, the gene encoding the methoxytransferase comprises: one or more of HsCOMT derived from Homo sapiens, AtCOMT derived from Arabidopsis thaliana and / or NtCOMT derived from Nicotiana tabacum;

[0014] The gene encoding the decarboxylase includes: one or more of the PDC5 gene, the PAD1 gene and / or the FDC1 gene.

[0015] In some embodiments of the present invention, in the above application, the gene encoding methoxytransferase includes: AtCOMT derived from Arabidopsis thaliana.

[0016] In some embodiments of the present invention, in the above application, the EcoAroL has:

[0017] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0018] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0019] (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); or

[0020] The FjTAL has:

[0021] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0022] (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0023] (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); or

[0024] The XYL1 has:

[0025] (7), the nucleotide sequence shown in SEQ ID NO: 3; or

[0026] (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or

[0027] (9), a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8); or

[0028] The mXYL2 has:

[0029] (10), the nucleotide sequence shown in SEQ ID NO: 4; or

[0030] (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or

[0031] (12) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (10) or (11); or

[0032] The XKS1 features:

[0033] (13), the nucleotide sequence shown in SEQ ID NO: 5; or

[0034] (14) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as the nucleotide sequence shown in (13); or

[0035] (15) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (13) or (14).

[0036] In some embodiments of the present invention, the sequence of the above-mentioned EcoAroL is: (as shown in SEQ ID NO:1)

[0037] In some embodiments of the present invention, the sequence of the above-mentioned FjTAL is: (as shown in SEQ ID NO:2)

[0038] In some embodiments of the present invention, the sequence of the above-mentioned XYL1 is: (as shown in SEQ ID NO:3)

[0039] In some embodiments of the present invention, the sequence of mXYL2 is: (as shown in SEQ ID NO:4)

[0040] In some embodiments of the present invention, the sequence of the above-mentioned XKS1 is: (as shown in SEQ ID NO:5)

[0041] In some embodiments of the present invention, the sequence of AtCOMT is: (as shown in SEQ ID NO:6)

[0042] The present invention also provides an expression module including: a first expression module, a second expression module, a third expression module, a fourth expression module and / or a fifth expression module;

[0043] The first expression module comprises: the EcoAroL derived from Escherichia coli, the FjTAL derived from Flavobacterium johnsoniae and the ARO7 G141S Gene;

[0044] The second expression module includes: the aro3 in the above application K222L gene, aro4 K229L gene and the PDC5 gene;

[0045] The third expression module comprises: the XYL1 derived from Scheffersomyces stipitis, the mXYL2 derived from Scheffersomyces stipitis and the XKS1 derived from Scheffersomyces stipitis in the above application;

[0046] The fourth expression module comprises: mXYL2 derived from Scheffersomyces stipitis and XKS1 derived from Scheffersomyces stipitis in the above application;

[0047] The fifth expression module comprises: the gene encoding methoxytransferase in the above application, the PAD1 gene and the FDC1 gene.

[0048] In some embodiments of the present invention, in the above expression modules, the first expression module is expressed at the delta17 site in the above application;

[0049] The second expression module is expressed at the aro10 site in the above application;

[0050] The third expression module is expressed at the delta9 site in the above application;

[0051] The fourth expression module is expressed at the DAK2-ZNF1 site in the above application;

[0052] The fifth expression module is expressed at the TKL2-TEF2 site in the above application.

[0053] The present invention also provides an expression vector, comprising the above expression module.

[0054] The present invention also provides a strain, into which the above expression module and / or the above expression vector are introduced.

[0055] In some embodiments of the present invention, the above-mentioned chassis strain includes SyBE_Sc05220018 (ZR05) and / or SyBE_Sc05220038 (VAN01).

[0056] In some embodiments of the present invention, the above-mentioned chassis strains include VA09, VA10 and / or VA11.

[0057] In some embodiments of the present invention, the construction method of the chassis strain VA09 includes: the strain VAN01 already contains 4CL from Petroselinum crispum and Ech from Pseudomonas putida KT2440, which can catalyze ferulic acid to produce vanillin, and can also convert p-coumaric acid into p-hydroxybenzaldehyde as verified by experiments. On this basis, PaphaB from Pseudomonas aeruginosa, SephaC from Salmonella enterica, AtCOMT from Arabidopsis thaliana or NtCOMT from Nicotiana tabacum are further expressed.

[0058] In some embodiments of the present invention, the construction method of the chassis strain VA10 comprises: based on the strain VA09, further expressing the fused SehpaC-(GGGGS)3-PahpaB and adding a copy of AtCOMT.

[0059] In some embodiments of the present invention, the construction method of the chassis strain VA11 comprises: on the basis of strain VA09, further expressing fused SehpaC-(GGGGS)3-PahpaB and adding a copy of AtCOMT, overexpressing MET13 atsc , SAH1 and MET6 to strengthen the SAM recycling process.

[0060] In some embodiments of the present invention, the sequence of PaphaB is: (as shown in SEQ ID NO:7)

[0061] In some embodiments of the present invention, the sequence of SephaC is: (as shown in SEQ ID NO:8)

[0062] In some embodiments of the present invention, the above The sequence is:

[0063]

[0064] AATAA. (as shown in SEQ ID NO:9) in bold Corresponds to the bold bases in the sequence.

[0065] The present invention also provides the use of the above expression module, the above expression vector and / or the above strain in synthesizing vanillin.

[0066] The invention provides a method for synthesizing vanillin, wherein all components of lignin are used as substrates and mixed with the fermentation liquid of the above-mentioned strain to obtain the vanillin.

[0067] In some embodiments of the present invention, in the above method, the whole lignin component is added in the form of a liquid and / or solid containing the whole lignin component.

[0068] In some embodiments of the present invention, in the above method, the method for preparing the liquid comprises the following steps: mixing straw with an alkaline solution, oil bathing, cooling, and solid-liquid separation to obtain the liquid.

[0069] In some embodiments of the present invention, in the above method, the preparation method of the solid comprises the following steps: mixing the straw with an alkaline solution, oil bathing, cooling, solid-liquid separation, removing the liquid portion, washing, and enzymolysis to obtain the solid.

[0070] In some embodiments of the present invention, in the above method, the cleaning is performed no less than 3 times, and each time is no less than 20 minutes.

[0071] In some embodiments of the present invention, in the above method, the enzymatic hydrolysis system is:

[0072]

[0073] In some embodiments of the present invention, in the above method, the enzymatic hydrolysis time is 24 to 48 hours, the temperature is 50° C., and the speed is 200 rpm.

[0074] In some embodiments of the present invention, in the above method, the alkaline solution includes NaOH (0.1 g NaOH / g straw).

[0075] In some embodiments of the present invention, in the above method, the final loading amount of the alkaline solution is 100 mg / g.

[0076] In some embodiments of the present invention, in the above method, the added amount of the straw is 10%wt.

[0077] In some embodiments of the present invention, in the above method, the temperature of the oil bath is 130° C. and the time is 30 min.

[0078] In some embodiments of the present invention, in the above method, the pH value of the liquid is 6-11.

[0079] In some embodiments of the present invention, in the above method, the whole lignin components include: one or more of coumaric acid, ferulic acid, glucose and / or xylose.

[0080] The present invention provides the use of the integration site as a target in the synthesis of vanillin;

[0081] The integration sites include: one or more of a delta17 site, an aro10 site, a delta9 site, a DAK2-ZNF1 site and / or a TKL2-TEF2 site.

[0082] The beneficial effects of the present invention include:

[0083] (1) Compared with the existing lignin fiber utilization method, the treatment method of the present invention is mild, less polluting, low-cost, and can fully utilize the three major components, reducing waste;

[0084] (2) Compared with the existing vanillin synthesis method, starting from corn stalks, the raw materials are cheap, readily available and sustainable, replacing expensive pure monomers as precursors;

[0085] (3) As a recognized safe strain, Saccharomyces cerevisiae has better biosafety than other lignin-degrading bacteria and is easier to achieve subsequent optimization processes;

[0086] (4) The fermentation is carried out by mixing the lignin hydrolysate stock solution and the enzymatic hydrolysate, without the need for the previous monomer separation and inhibitor detoxification process, and without the need to add an additional carbon source.

[0087] (5) Compared with other chassis microorganisms, Saccharomyces cerevisiae has biosafety and good robustness, a clear genetic background, and mature molecular manipulation technology, which facilitates the introduction of exogenous pathways and metabolic regulation;

[0088] (6) Saccharomyces cerevisiae is easy to culture at high density, which can effectively alleviate the problem of substrate and product inhibition and improve the expression level and catalytic efficiency of inefficient enzymes;

[0089] (7) Compared with the published methods for the biosynthesis of vanillin, the “biofunnel pathway” proposed in this study greatly broadens the substrate spectrum and provides more reference significance and research targets for the biosynthesis of vanillin;

[0090] (8) The processing of lignocellulose is simple and gentle, does not use pollutants and expensive reagents, reduces costs and reduces the pressure of agricultural waste on the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0091] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0092] Figure 1 The fermentation verification of p-coumaric acid-p-hydroxybenzaldehyde pathway is shown;

[0093] Figure 2 Shows the pathway for ferulic acid and p-coumaric acid to be converted into vanillin;

[0094] Figure 3 The results of the fermentation of lignin-derived monomers into vanillin are shown in Figure 1. A shows the fermentation results of ferulic acid-vanillin; B shows the fermentation results of p-coumaric acid-vanillin;

[0095] Figure 4 The results of enzyme fusion-enhanced hydroxylation are shown;

[0096] Figure 5 Two pathways of p-coumaric acid-vanillin are shown;

[0097] Figure 6 This shows the result of SAM regulation and strengthening the methoxyl transfer process;

[0098] Figure 7 Shows the results of glucose-vanillin fermentation;

[0099] Figure 8 The synthesis pathway and optimization of lignocellulose-vanillin are summarized;

[0100] Fig. 9 The process of synthesizing vanillin using corn straw as raw material is shown. DETAILED DESCRIPTION

[0101] The invention discloses the application of an integration site as a target in the synthesis of vanillin.

[0102] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0103] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0104] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0105] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0106] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0107] Taking the synthesis of vanillin in brewer's yeast as an example, the present invention provides a new pathway for synthesizing vanillin using glucose and xylose as precursors by means of synthetic biology, genetic engineering, metabolic engineering and the like, and also provides a strategy for realizing the high value of all components of lignocellulose by utilizing the biological funnel pathway.

[0108] In short, the present invention uses a vanillin non-degrading yeast strain as a chassis, designs and constructs a new and efficient pathway for synthesizing vanillin using glucose and xylose as precursors, and a biological funnel pathway for synthesizing vanillin from the three major components of non-natural lignocellulose monomers: (a) regulating the shikimic acid pathway; (b) deleting the branch pathway; (c) constructing and optimizing the xylose metabolic pathway; (d) alleviating feedback inhibition. Strategies (a) and (c) achieve the conversion of p-coumaric acid to synthesize vanillin; all of the above strategies combined with previous inventions jointly achieve the purpose of converting all the main monomers obtained by pretreatment and enzymatic hydrolysis of corn straw, such as glucose, xylose, ferulic acid, p-hydroxybenzaldehyde and p-coumaric acid, to synthesize vanillin. The present invention helps to establish a sustainable solution for the biosynthesis of vanillin and the high value of lignocellulose.

[0109] In Embodiments 1 to 6 of the present invention,

[0110] (1) Obtaining a Saccharomyces cerevisiae strain capable of synthesizing and stably accumulating vanillin using ferulic acid as a precursor

[0111] Provided by Yuan Yingjin's research group, the strain number is SyBE_Sc05220038 (strain VAN01 in patent CN 113201465 A). This strain can only use ferulic acid monomers to synthesize vanillin, but cannot use p-coumaric acid (the content in lignin is 3-4 times that of ferulic acid), which is not conducive to the effective utilization of resources.

[0112] In Examples 1 to 6 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0113] The present invention will be further described below in conjunction with embodiments:

[0114] Example 1 Obtaining a Saccharomyces cerevisiae strain capable of synthesizing and stably accumulating vanillin using lignin-derived monomers p-coumaric acid and ferulic acid as precursors

[0115] The strain VAN01 already contains the 4CL gene from Petroselinum crispum and the Ech gene from Pseudomonas putidaKT2440. These two genes can catalyze the production of vanillin from ferulic acid. Experimental results have shown that they can also convert p-coumaric acid into p-hydroxybenzaldehyde (such as Figure 1 On this basis, PaphaB from Pseudomonas aeruginosa, SephaC from Salmonella enterica, AtCOMT from Arabidopsis thaliana or NtCOMT from Nicotiana tabacum were further expressed to construct the p-coumaric acid-p-hydroxybenzaldehyde-protocatechuic aldehyde-vanillin pathway. The resulting strain was able to convert ferulic acid and p-coumaric acid into vanillin (as shown in Figure 2A). Figure 2 shown).

[0116] Experimental methods:

[0117] Yeast promoter and terminator were obtained by PCR amplification and connected to each gene by Overlap PCR method to form module T PGI1 -P PGK1 -PahpaB-T HXT7 , T TDH1 -P TEF2 -SehpaC-T ADH2 and T HXT7 -P TDH3 -AtCOMT-T TDH1 , sequence verification; PCR obtained about 400 bp sequences on the left and right of Saccharomyces cerevisiae HO, named HO-L and HO-R, respectively, andPGI1 and T ADH2 Overlap the sequences to obtain HO-LT PGI1 and HO-RT ADH2 As the connecting homology arm (HO-HAs). According to the HO sequence, the gRNA plasmid (containing the gene encoding the cas9 protein) was constructed, and the gRNA plasmid, HO-HAs, and module T PGI1 -P PGK1 -PahpaB-T HXT7 , T TDH1 -P TEF2 -SehpaC-T ADH2 and T HXT7 -P TDH3 -AtCOMT-T TDH1 The transformants were introduced into Saccharomyces cerevisiae SyBE_Sc05220038 by lithium acetate transformation method, and SC screening plates were coated. The obtained transformants were streaked for pure culture and the yeast genome was extracted for PCR verification and sequencing. The verified correct transformant was named VA09.

[0118] Experimental results:

[0119] The ability of strain VA09 to produce vanillin was verified by fermentation using p-coumaric acid and ferulic acid as substrates. Figure 3 , as shown in Table 1 and Table 2 ( Figure 3 A uses ferulic acid as substrate to generate 2.49mmol / L vanillin. Figure 3 B is the product of 0.37 mmol / L vanillin using p-coumaric acid as substrate).

[0120] Table 1 Ferulic acid-vanillin fermentation results

[0121]

[0122] Table 2 p-Coumaric acid-vanillin fermentation results

[0123]

[0124] Example 2 Construction of Saccharomyces cerevisiae strains VA10 and VA11 with enhanced hydroxylation and methoxy transfer steps

[0125] From the fermentation results of the above strain VA09, it can be seen that the yield and conversion rate of vanillin synthesized with ferulic acid as the substrate are relatively high, but when p-coumaric acid is used as the substrate, the conversion rate is low, and there are 0.06mmol / L p-hydroxybenzaldehyde and 0.06mmol / L protocatechuic aldehyde intermediates accumulated, so it is necessary to further strengthen the two catalytic processes of hydroxylation and methoxy transfer. Based on the strain VA09, by further expressing the fused SehpaC-(GGGGS)3-PahpaB and adding a copy of AtCOMT, MET13 was overexpressed. atsc , SAH1 and MET6 strengthen the SAM cycle process and enhance the hydroxylation and methoxyl transfer processes in the vanillin synthesis pathway.

[0126] Experimental methods:

[0127] The fusion protein linker sequence GGGGS is encoded by GGTGGTGGTGGTTCT (as shown in SEQ ID NO: 10). PGI1 -P PGK1 -PahpaB-T HXT7 and T TDH1 -P TEF2 -SehpaC-T ADH2 As a template, PCR amplification obtained T PGI1 -P PGK1 and PahpaB-T HXT7 ; T PGI1 -P PGK1 , gene SehpaC, 3 groups of connecting sequences (GGGGS) 3 (i.e. GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT) and PahpaB-T HXT7 The fragments were connected and named SehpaC-(GGGGS)3-PahpaB. The PCR obtained about 400 bp sequences of Saccharomyces cerevisiae delta15, named delta15-L and delta15-R, and ligated to the terminator T PGI1 and T ADH1 Overlap the sequence to obtain delta15-LT PGI1 and delta15-RT ADH1 As the connecting homology arm (delta15-HAs). According to the delta15 sequence, the gRNA plasmid was constructed. The delta15 gRNA plasmid, delta15-HAs, SehpaC-(GGGGS)3-PahpaB and T HXT7 -P TDH3 -AtCOMT-T TDH1They were introduced into VA09 through the lithium acetate conversion method and named VA10 after successful verification of the above method.

[0128] Construct module T in the same way CHO1 -P TDH3 -SAH1-T PGI1 , T PGI1 -P GPM1 -MET6-T TEF1 , T TEF1 -T CYC1 and T CYC1 -P PDC1 -MET13 atsc -T TDH3 , and delta22-LT CHO1 and delta22-RT ADH3 (delta22-HAs), delta22-gRNA plasmid, lithium acetate was transformed into VA10 and verified to obtain strain VA11.

[0129] Experimental results:

[0130] First, p-coumaric acid was used as a substrate to verify the ability of strain VA10 to convert p-coumaric acid into vanillin. Figure 4 As shown in Table 3, compared with VA09, the vanillin yield (0.31mmol / L) did not increase, but a new substance accumulation was found in the system, namely caffeic acid (0.32mmol / L). The appearance of caffeic acid indicates the existence of another synthesis pathway (such as Figure 5 As shown in the figure, the enhancement of the hydroxylation process diverts the substrate of the p-coumaric acid-p-hydroxybenzaldehyde process, and also indicates the necessity of further improving the methoxy transfer process.

[0131] Table 3 Enzyme fusion enhanced hydroxylation fermentation results

[0132]

[0133] Therefore, the methoxyl transfer process was further enhanced by strengthening the SAM cycle, and the resulting strain VA11 was able to synthesize 0.53 mmol / L vanillin using p-coumaric acid as a substrate, with almost no accumulation of p-hydroxybenzaldehyde, protocatechuic aldehyde, and caffeic acid (e.g. Figure 6 and Table 4), indicating that the methoxyl transfer process was effectively enhanced.

[0134] Table 4 Results of SAM regulation and enhancement of methoxyl transfer process

[0135]

[0136] Example 3 Construction of Saccharomyces cerevisiae strain VA12 for the synthesis of vanillin using glucose as a precursor

[0137] Based on strain VA11, EcoAroL from Escherichia coli, FjTAL from Flavo bacterium johnsoniae, and site-directed mutation of yeast endogenous ARO7 were expressed at the delta17 locus. G141S (i.e. module T HXT7 -P TDH3 -ARO7 G141S -T TGH1 -P TEF2 -FjTAL-T ADH2 -P ENO2 -EcAROL-T CYC1 ), expressing a site-directed mutant of yeast endogenous aro3 at the aro10 locus K222L and aro4 K229L (i.e. module T ADH2 -P ENO2 -aro3 K222L -T CYC1 -P PDC1 -aro 4K229 LT TDH3 ), and knocked out the decarboxylase encoding gene PDC5 to achieve the construction and optimization of the glucose-vanillin pathway. The heterologous gene sequence after codon optimization is shown in SEQ ID NO: 1 to SEQ ID NO: 2.

[0138] Experimental results:

[0139] After fermentation in SC medium, VA12 was able to synthesize 24 mg / L vanillin using glucose as the only precursor (e.g. Figure 7 and Table 5).

[0140] Table 5 Glucose-vanillin fermentation results

[0141] strain OD600 Vanillin(mg / L) Protocatechuic aldehyde(mg / L) p-Hydroxybenzaldehyde(mg / L) VA12 2.2±0.1 24±1 3±0 12±1

[0142] Example 4 Construction of Saccharomyces cerevisiae strain VA13 for the synthesis of vanillin using xylose as a precursor

[0143] Based on strain VA12, P was introduced at the delta9 locus PGK1 -XYL1-T CYC1 -P TDH3 -mXYL2-T TEF1 -T FBA1 -P TPI1 -XKS1-T XKS1 Module, strain VA13 was obtained, and the gene sequence after codon optimization is shown in SEQ ID NO:3 to SEQ ID NO:5.

[0144] Experimental results:

[0145] Strain VA13 uses xylose as the only precursor and can produce 7 mg / L vanillin in SX medium (initial xylose concentration is 10 g / L). The slow consumption of xylose and accumulation of xylitol are the main reasons for the low yield. The xylose consumption, xylitol accumulation and product synthesis in this fermentation process are shown in Table 6.

[0146] Table 6 Xylose-vanillin fermentation results

[0147] strain Xylose consumption (g / L) Xylitol residue (g / L) Vanillin(mg / L) VA13 2.40±0.04 0.50±0.05 7±0

[0148] Example 5 Construction of the optimized strain VA14 for the synthesis of vanillin using glucose and xylose as precursors

[0149] Knockout of PHA2 or PGM1 in the branch pathway based on VA13; add one copy of T at the DAK2-ZNF1 locus CYC1 -P TDH3 -mXYL2-T TEF1 -T FBA1 -P TPI1 -XKS1-T XKS1 module, strengthen xylitol conversion; add module T in TKL2-TEF2 GPD1 -AtCOMT-P TDH3 -P TDH3 -AtCOMT-T GPD1 The expression of methoxyl transfer was further enhanced; the endogenous yeast decarboxylases PAD1 and FDC1 were knocked out to reduce the decarboxylation of substrates p-coumaric acid and ferulic acid to form other byproducts (optimized pathways such as Figure 8 The resulting strain was named VA14.

[0150] The strain VA14 can synthesize vanillin using p-coumaric acid, ferulic acid, glucose and xylose as precursors, that is, it can synthesize vanillin using all components of lignocellulose. According to the four monomers in corn stalks, a simulation system was configured with 15-20g / L glucose, 6-10g / L xylose, 650-850mg / L p-coumaric acid and 180-300mg / L ferulic acid as substrates for fermentation to verify the synthesis of vanillin by VA14. The results are shown in Table 7.

[0151] Table 7 Results of vanillin production by fermentation in the simulated system

[0152]

[0153] Example 6: Synthesis of Vanillin Using Lignocellulose Monomers as Precursors

[0154] The general process flow is shown in Fig. 9 . The preliminary planned treatment method for converting all components of lignocellulose into vanillin is to pretreat corn straw with a NaOH loading of 100 mg / g, a solid content of 10% wt, and an oil bath at 130°C for 30 min, with 6*15g straw per batch. After treatment, it is cooled to room temperature and solid-liquid separation is performed. The APL stock solution obtained is 600-610mL, and the pH is about 11. It is necessary to adjust the pH to 6 with 3M HCl, and the precipitated solid components are removed by centrifugation. The solid part is washed three times with three times the volume of water (900mL*3), soaking for 20 minutes each time, and collected separately. The solid part after washing three times with water is freeze-dried and then enzymatically hydrolyzed (the system is shown in Table 8, the conditions are 50°C, 200rpm, 24-48h).

[0155] The main difficulty of this part is to make the strain maintain good activity and the ability to convert and synthesize the target product in the real system, so it is necessary to control the solid content, antibacterial substances and solid-liquid separation method after enzymatic hydrolysis. The solid content involves the glucose-xylose content of the system after subsequent mixing with APL; the use of sodium azide as an antibacterial substance will inhibit the growth of yeast in the later stage, and the mixed addition of ampicillin and kanamycin is more suitable for the later fermentation process; the system after enzymatic hydrolysis needs to be centrifuged to remove the solid part.

[0156] In order to reduce the loss of lignin monomers, the first washing liquid (containing about 0.3g / L p-coumaric acid and 0.1g / L ferulic acid) was also tried. The best way is to use it in the preparation process of the enzymatic hydrolysis system, using the first washing liquid instead of water, so that the two monomers enter the enzymatic hydrolysis system and enter the fermentation system later. After experiments, there was no obvious inhibitory effect on the enzymatic hydrolysis efficiency. Since the concentration of the two monomers in the second and third washing liquids is very low, recycling is not considered.

[0157] Finally, the centrifuged APL and enzymatic hydrolysate were sterilized separately and then mixed for use. After fermentation, VA14 was able to synthesize 1.97 mmol (300 mg / L) vanillin from the system obtained by corn straw pretreatment-enzymatic hydrolysis, with a yield of 5.0 mg / g straw (the specific results are shown in Table 9), successfully achieving the goal of synthesizing vanillin from the three major components of lignocellulose monomers with high value.

[0158] Table 8 Solid component enzymatic hydrolysis system

[0159]

[0160] Table 9 Conversion of all components of lignocellulose into synthetic vanillin

[0161]

[0162] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain, characterized in that Import the expression module into the chassis strain; The expression module comprises: a first expression module to a fifth expression module; The first expression module is integrated into delta17 Site; The second expression module is integrated into aro10 Site; The third expression module is integrated into delta9 Site; The fourth expression module is integrated into DAK2-ZNF1 Site; The fifth expression module is integrated into TKL2-TEF2 Site; The first expression module comprises: Escherichia coli Source EcoAroL , Flavobacterium johnsoniae Source Fj and ARO7 G141S Gene; The second expression module comprises: aro3 K222L Genes and aro4 K229L Gene; The third expression module comprises: Scheffersomyces stipitis Source XYL , Scheffersomyces stipitis Source mXJL and XKS1 Gene; The fourth expression module comprises: Scheffersomyces stipitis Source mXYL and XKS1 Gene; The fifth expression module includes: a gene encoding a methoxytransferase; The genes encoding methoxytransferase include: Homo sapiens of HkDJ , originated from Arabidopsis thaliana of AtCOMT and / or derived from Nicotiana tabacum of NtCOMT One or more of; Said ARO7 G141S Gene, aro3 K222L Gene, aro4 K229L Genes and XKS1 The gene is derived from Saccharomyces cerevisiae; Said delta17 site, aro10 site, delta9 site, DAK2-ZNF1 Site and TKL2- TEF2 The locus is located in Saccharomyces cerevisiae; Said EcoAroL The sequence is: the nucleotide sequence shown in SEQ ID NO: 1; or Said Fj The sequence is: the nucleotide sequence shown in SEQ ID NO: 2; or Said XYL The sequence is: the nucleotide sequence shown in SEQ ID NO: 3; or Said mXJL The sequence is: the nucleotide sequence shown in SEQ ID NO: 4; or Said XKS1 The sequence is: the nucleotide sequence shown in SEQ ID NO: 5; The chassis strain is: Saccharomyces cerevisiae; The chassis strain knocks out endogenous genes: PDC5 Gene, PAD1 Genes and FDC1 Gene.

2. Use of the strain as claimed in claim 1 in synthesizing vanillin.

3. A method for synthesizing vanillin, characterized in that: The vanillin is obtained by mixing the whole components of lignin as a substrate with the fermentation liquid of the strain according to claim 1; The whole lignin component is added in the form of a liquid and / or a solid containing the whole lignin component.

4. The method according to claim 3, characterized in that The complete lignin components include: one or more of coumaric acid, ferulic acid, glucose and / or xylose.

Images