mRNA, capping enzyme activity detection kit, detection system and detection method, and application

Abstract

The present application relates to mRNA, capping enzyme activity detection kit and detection system and detection method, application. The mRNA is used for detecting capping enzyme activity, the chain length of the mRNA is 20nt-40nt, the base sequence of the mRNA is composed of A base and G base, and the number of A base accounts for 29%-71%. In the present study, the mRNA optimized by sequence is composed of adenine ribonucleotide (A) and guanine ribonucleotide (G), which can minimize the degradation of RNase in the environment, and can stably and repeatedly detect the capping enzyme activity, so as to stably and efficiently screen the capping enzyme and its mutant strain.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to mRNA, a capping enzyme activity detection kit, a detection system and a detection method, and application. BACKGROUND

[0002] In recent years, mRNA drugs have attracted widespread attention from the international academic and industrial communities due to their short development cycle, easy expansion, low cost, ability to act on intracellular and extracellular targets, expression of multiple proteins, no entry into the nucleus, and no need for in vitro expression. However, during the production and development of mRNA drugs, mRNA sample preparation is an essential step. However, due to the poor stability of mRNA, it is easily degraded and has uncontrollable immunogenicity, and in practical applications, a Cap structure is often added to the 5' end of mRNA to improve the stability, translation efficiency, and immunogenicity of synthetic mRNA.

[0003] Currently, co-transcriptional capping and enzymatic reaction capping are two ways to synthesize mRNA with a cap structure at the 5' end. Co-transcriptional capping involves adding mRNA cap structure analogs (such as dinucleotide cap analog ARCA (3'-O-Me-m7GpppG), m7Gpppm7G, or trinucleotide cap analog m7GpppA*pG) in a T7 RNA polymerase-mediated in vitro transcription reaction system, introducing the cap analog at the start of transcription, and then extending the transcript along the cap analog. The mRNA with a cap structure can be obtained after transcription is complete. Although this method is simple to operate, it has high production costs for industrial applications. Moreover, if the cap structure analog is incorporated into the mRNA in the wrong direction, it cannot be effectively translated, resulting in low target protein yield. Enzymatic reaction capping involves the catalytic action of a capping enzyme to form a 5'GpppG cap structure at the end of mRNA using GTP and SAM as substrates, and then methylating to produce a m7GpppG cap (referred to as Cap 0), or further adding a methyl group to the 2'-O site of the first nucleotide of Cap0 under the action of mRNA Cap - 2'-oxymethyltransferase to form mRNA with a Cap1 structure. Compared with co-transcriptional capping, enzymatic reaction capping has a higher capping rate (close to 100%) and forms a natural Cap1 structure with lower immunogenicity. Therefore, it is of great significance for the research and development and production of mRNA innovative drugs to repeatedly and stably detect the activity of capping enzymes. SUMMARY

[0004] Therefore, it is necessary to provide an mRNA that can repeatedly and stably detect the activity of a capping enzyme.

[0005] In addition, it is also necessary to provide a capping enzyme activity detection kit, a detection system and a detection method, and application.

[0006] An mRNA for detecting capping enzyme activity, a base sequence of the mRNA is composed of A bases and G bases, and the number of A bases accounts for 29-71%.

[0007] RNase A specifically recognizes and degrades cytosine ribonucleotides (C) or uracil ribonucleotides (U) residues on single-stranded RNA, and conventional mRNA is easily contaminated by RNase A in the environment. In this study, the sequence-optimized mRNA is composed of adenine ribonucleotides (A) and guanine ribonucleotides (G), which minimizes its degradation by RNase in the environment, and can stably and repeatedly detect capping enzyme activity, so as to stably and efficiently screen capping enzyme and its mutant strains. It has been verified by experiments that, using the mRNA of this study as the substrate of the capping enzyme to be detected for capping reaction, and using HPLC (High Performance Liquid Chromatography) to detect the mRNA after capping reaction, the activity of the capping enzyme to be detected can be obtained, and the mRNA after capping reaction is diluted by 10 times and 20 times, and repeated 5 times in parallel, and the corresponding RSD is 0.79% and 0.89% respectively, which indicates that the repeatability is good, and the detection result is stable and reliable.

[0008] In one embodiment, the base sequence of the mRNA is shown in SEQ ID No. 6-SEQ ID No. 9.

[0009] A capping enzyme activity detection kit, comprising the mRNA described above.

[0010] In one embodiment, further comprising: capping reaction reagents, the capping reaction reagents comprising GTP, S-adenosyl methionine, inorganic pyrophosphatase, RNase inhibitor.

[0011] A capping enzyme activity detection kit, comprising a primer pair for synthesizing mRNA, the mRNA being used for detecting capping enzyme activity, the mRNA having a length of 20-40 nt, and a base sequence of the mRNA being composed of A bases and G bases, and the number of A bases accounting for 29-71%.

[0012] In one embodiment, the primer pair has a T7 promoter, and the primer pair comprises a forward primer and a reverse primer, and the reverse primer has a base sequence with a length of 20-40 nt and composed of T bases and C bases.

[0013] In one of the embodiments, the base sequence of the forward primer is shown in SEQ ID No. 1, and the reverse primer is selected from at least one of the base sequences shown in SEQ ID No. 2-SEQ ID No. 5.

[0014] In one of the embodiments, the kit further comprises a primer annealing reagent, an in vitro transcription reagent, and a capping reagent.

[0015] A capping enzyme activity detection system comprises a detection device and a capping enzyme activity detection kit as described above.

[0016] In one of the embodiments, the detection device is a high performance liquid chromatography detection device.

[0017] A capping enzyme activity detection method comprises the following steps:

[0018] The capping enzyme to be tested is subjected to a capping reaction with mRNA to obtain a reaction product, the mRNA has a strand length of 20 nt-40 nt, and the base sequence of the mRNA is composed of A bases and G bases;

[0019] The reaction product is detected by a high performance liquid chromatography method or an LC-MS method, and the 5' end capping rate of the mRNA is calculated to obtain the activity of the capping enzyme to be tested.

[0020] In one of the embodiments, before the step of subjecting the capping enzyme to be tested to a capping reaction with mRNA, the method further comprises a step of synthesizing the mRNA:

[0021] A primer pair is subjected to an annealing reaction to form a transcription template, the primer pair has a T7 promoter, and the primer pair comprises a forward primer and a reverse primer, the reverse primer has a base sequence composed of T bases and C bases and has a strand length of 20 nt-40 nt;

[0022] The transcription template is subjected to an in vitro transcription reaction to obtain the mRNA.

[0023] In one of the embodiments, the step of detecting the reaction product by a high performance liquid chromatography method and calculating the 5' end capping rate of the mRNA comprises the following steps: detecting the peak time and peak area of the mRNA and the reaction product by a high performance liquid chromatography method, and calculating the 5' end capping rate of the mRNA according to the peak time and peak area of the mRNA and the reaction product.

[0024] The gradient elution is carried out by using the mobile phase A and the mobile phase B, the elution program comprises: 0-30 min, the volume ratio of the mobile phase A and the mobile phase B is gradient eluted from 71% and 29% to 65% and 25% respectively, 30.1 min-40 min, the mobile phase A with the volume ratio of 71% and the mobile phase B with the volume ratio of 29% are used for elution; the mobile phase A is a pH 7.0, 0.1M triethylamine acetate solution, and the mobile phase B contains acetonitrile and a pH 7.0, 0.1M triethylamine acetate solution with a volume ratio of 25:75.

[0025] The mRNA, the cap enzyme activity detection kit, the cap enzyme activity detection system or the cap enzyme activity detection method is used for screening a cap enzyme. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 It is a detection result graph of the mRNA product after transcription in Example 2 (i.e. a negative control);

[0027] Figure 2 It is a detection result graph of the completely capped mRNA in Example 2;

[0028] Figure 3 It is a detection result graph of the uncapped mRNA and the completely capped mRNA mixed in a volume ratio of 1:1 in Example 2;

[0029] Figure 4 It is a detection result graph of the mRNA capped by the Haianxinxin enzyme vaccinia virus cap enzyme in Example 2;

[0030] Figure 5 It is a detection signal analysis graph of the mRNA capped by the Haianxinxin enzyme vaccinia virus cap enzyme in Example 3. DETAILED DESCRIPTION

[0031] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application will be described in detail below with reference to the specific embodiments and the accompanying drawings. In the following description, a large number of specific details are set forth in order to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the scope of the present application, so the present application is not limited to the specific embodiments disclosed below.

[0032] The mRNA is used for detecting cap enzyme activity, the mRNA has a strand length of 20 nt-40 nt, and the base sequence of the mRNA is composed of A bases and G bases, and the number of A bases accounts for 29%-71%.

[0033] RNase A specifically recognizes and degrades cytosine ribonucleotides (C) or uracil ribonucleotides (U) residues on single-stranded RNA, and conventional mRNA is easily contaminated by RNase A in the environment. In this study, the sequence-optimized mRNA is composed of adenine ribonucleotides (A) and guanine ribonucleotides (G), which minimizes its degradation by RNase in the environment, and can repeatedly and stably detect capping enzyme activity, so as to stably and efficiently screen capping enzyme and its mutant strains.

[0034] In some embodiments, the number of A bases accounts for 29%-71% of the base sequence of the mRNA. The mRNA with this setting avoids being easily degraded when it is all A bases, has better stability, and can be repeatedly and stably used for capping enzyme activity detection.

[0035] In some embodiments, the base sequence of the mRNA is as shown in SEQ ID No. 6-SEQ ID No. 9.

[0036] Specifically, the sequence as shown in SEQ ID No. 6 is 5'-pppGGAAGGAGAGGAAGGAAAGGGAAGAAAGAAG-3'. The sequence as shown in SEQ ID No. 7 is 5'-pppGGAGAGGGAGGAGGAGGGAGGG-3'. The sequence as shown in SEQ ID No. 8 is 5'-pppGGAAAAAGAAGAAAAGAAAGAAAGAAGGAAGAAAGAAG-3'. The sequence as shown in SEQ ID No. 9 is 5'-pppGGAAGGAGAGAGGGAGAGGAAAGGAGAAGAAGGAG-3'.

[0037] In this study, the sequence-optimized mRNA is composed of adenine ribonucleotides (A) and guanine ribonucleotides (G), which minimizes its degradation by RNase in the environment, and can repeatedly and stably detect capping enzyme activity, so as to stably and efficiently screen capping enzyme and its mutant strains. It has been verified by experiments that, when the mRNA of this study is used as the substrate of the capping enzyme to be detected for capping reaction, and HPLC (High Performance Liquid Chromatography) is used to detect the mRNA after capping reaction, the activity of the capping enzyme to be detected can be obtained, and the mRNA after capping reaction is diluted by 10 times and 20 times, and repeated for 5 parallel times, and the corresponding RSD is 0.79% and 0.89% respectively, which indicates that the repeatability is good, and the detection result is stable and reliable.

[0038] The capping enzyme activity detection kit according to an embodiment of the present application comprises a primer pair for synthesizing mRNA for detecting capping enzyme activity, wherein the mRNA has a length of 20-40 nucleotides and a base sequence composed of A and G bases.

[0039] The mRNA for detecting capping enzyme activity has been described above and will not be repeated here.

[0040] In some embodiments, the capping enzyme activity detection kit further comprises capping reaction reagents. The capping reaction reagents comprise GTP, S-adenosyl methionine, inorganic pyrophosphatase, and RNase inhibitor.

[0041] In the capping enzyme activity detection kit, the mRNA is composed of adenine ribonucleotides (A) and guanine ribonucleotides (G), which minimizes degradation by RNase in the environment and enables repeated and stable detection of capping enzyme activity, thereby stably and efficiently screening capping enzymes and mutant strains thereof.

[0042] The capping enzyme activity detection kit according to an embodiment of the present application comprises a primer pair for synthesizing mRNA for detecting capping enzyme activity, wherein the mRNA has a length of 20-40 nucleotides and a base sequence composed of A and G bases.

[0043] The mRNA for detecting capping enzyme activity has been described above and will not be repeated here.

[0044] In some embodiments, the primer pair has a T7 promoter, and the primer pair comprises a forward primer and a reverse primer, wherein the reverse primer has a base sequence composed of T and C bases and has a length of 20-40 nucleotides. This arrangement enables repeated and stable detection of capping enzyme activity by synthesizing mRNA having a length of 20-40 nucleotides and a base sequence composed of A and G bases. It should be noted that the reverse primer can have a promoter sequence, such as a T7 promoter sequence, in addition to the base sequence composed of T and C bases and having a length of 20-40 nucleotides.

[0045] Further, the base sequence of the forward primer is shown in SEQ ID No. 1, and the reverse primer is selected from at least one of the base sequences shown in SEQ ID No. 2-SEQ ID No. 5. This arrangement avoids degradation of mRNA composed of A bases only and has better stability, thereby enabling repeated and stable detection of capping enzyme activity.

[0046] Specifically, the sequence as shown in SEQ ID No. 1 is 5'-CGAAATTAATACGACTCACTATAGGA-3'. The sequence as shown in SEQ ID No. 2 is 5'-CTTCTTTCTTCCCTTTCCTTCCTCTCCTTCCTATAGTGAGTCGTATTAATTTCG-3'. The sequence as shown in SEQ ID No. 3 is 5'-CCCTCCCTCCTCCTCCCTCTCCTATAGTGAGTCGTATTAATTTCG-3'. The sequence as shown in SEQ ID No. 4 is 5'-CTTCTTTCTTCCTTCTTTCTTTCTTTTCTTCTTTTTCCTATAGTGAGTCGTATT AATTTCG-3'. The sequence as shown in SEQ ID No. 5 is 5'-CTCCTTCTTCTCCTTTCCTCTCCCTCTCTCCTTCCTATAGTGAGTCGTATTAA TTTCG-3'.

[0047] In some embodiments, the capping enzyme activity detection kit further comprises: primer annealing reaction reagents, in vitro transcription reaction reagents and capping reaction reagents.

[0048] The primer annealing reaction reagents comprise annealing buffer and DNase / RNase-Free Distilled Water (nuclease-free water or DEPC water).

[0049] The in vitro transcription reaction reagents comprise 10×T7 Buffer, ATP, GTP, inorganic pyrophosphatase, RNase Inhibitor, T7 RNA polymerase, nuclease-free water or DEPC water.

[0050] The capping reaction reagents comprise GTP, S-adenosyl methionine, inorganic pyrophosphatase and RNase inhibitor.

[0051] In the capping enzyme activity detection kit described above, the primer pair can synthesize mRNA composed of adenine ribonucleotides (A) and guanine ribonucleotides (G), which is least degraded by RNase in the environment, and can repeatedly and stably detect capping enzyme activity, so as to stably and efficiently screen capping enzyme and its mutant strains.

[0052] Further, the above-mentioned capping enzyme activity detection kit reduces the generation of 3'-extended non-uniform products in the in vitro transcription process of T7 RNA polymerase. The optimized template sequence only forms the theoretical sequence (for example, the sequences shown in SEQ ID No. 6-SEQ ID No. 9) and the sequence with one more molecule of AMP than the theoretical sequence in the in vitro transcription process of T7 RNA polymerase. The sequence-optimized template DNA and the mRNA obtained by transcription thereof are the basis for stable detection of capping enzyme activity.

[0053] An embodiment of the present research provides a capping enzyme activity detection system, comprising the above-mentioned capping enzyme activity detection kit and a detection device.

[0054] The specific description of the above-mentioned capping enzyme activity detection kit is described above, and will not be repeated here.

[0055] In one embodiment, the detection device is a high-performance liquid chromatography detection device. The high-performance liquid chromatography detection device comprises a high-performance liquid chromatograph and a chromatographic column. Specifically, the chromatographic column is a DNA Core 1000 C18 column.

[0056] The above-mentioned capping enzyme activity detection system comprises a capping enzyme activity detection kit, which contains or can synthesize mRNA for detecting capping enzyme activity, the mRNA is composed of adenine ribonucleotide (A) and guanine ribonucleotide (G), which minimizes its degradation by RNase in the environment, and can repeatedly and stably detect capping enzyme activity, so as to stably and efficiently screen capping enzyme and its mutant strains.

[0057] Further, compared with the magnetic bead capture-fluorescence quantitative PCR method, the capping enzyme activity detection system of the present application adopts the HPLC method for enzyme activity detection, and the detection signal directly comes from the capped or uncapped RNA, without amplification process, and the detection signal is more reliable; compared with the LC-MS detection method, the capping enzyme activity detection system adopts the HPLC method for enzyme activity detection, the data processing process is more clear and obvious, and the repeatability is better, and the detection result is more reliable.

[0058] Preferably, the capping enzyme activity detection system of the present application adopts the HPLC method for enzyme activity detection, and the signal peaks of the capped and uncapped RNA are significantly different, and the capped RNA is the direct product of the capping enzyme, which has good universality and can be applied to all capping enzyme activity detection.

[0059] An embodiment of the present research provides a capping enzyme activity detection method, comprising the following steps S110-S120:

[0060] S110, performing a capping reaction on the to-be-tested capping enzyme and the mRNA to obtain a reaction product, the mRNA having a strand length of 20 nt-40 nt, the mRNA having a base sequence composed of A bases and G bases, and the number of A bases accounting for 29%-71%.

[0061] It should be noted that the mRNA is the mRNA used for detecting the capping enzyme activity as described above, and the specific description is detailed above, which will not be repeated here.

[0062] In one specific example, the step of performing a capping reaction on the to-be-tested capping enzyme and the mRNA to obtain a reaction product includes: adding the mRNA into a 1.5 mL centrifuge tube, diluting to 39 μL with nuclease-free water; heating at 65°C for 5 min; taking out the centrifuge tube and placing it on ice for 5 min to obtain the denatured mRNA; sequentially adding the reaction system components in Table 4 into a 1.5 mL centrifuge tube, mixing gently, incubating at 37°C for 1 h, and then immediately returning to ice; then performing lithium chloride precipitation to recover the capped mRNA, dissolving in 100 μL of nuclease-free water, filtering, and then placing in a liquid phase bottle for detection to obtain the reaction product.

[0063] It should be noted that the concentrations and volumes of the components of the capping reaction system in Table 4 are not limited to the amounts indicated in the table, and can be scaled up proportionally.

[0064] Table 4 Capping reaction system (the reaction system can be scaled up proportionally)

[0065] Ingredients Reaction volume / μL Denatured mRNA 39 10X Capping Buffer 6 GTP (10 mM) 3 SAM (2 mM) 3 Inorganic Pyrophosphatase 1.5 RNase Inhibitor 1.5 Capping Enzyme 3 DNase / RNase-Free Distilled Water Up to 60

[0066] In some embodiments, the step of performing a capping reaction on the to-be-tested capping enzyme and the mRNA is preceded by the step of synthesizing the mRNA: S101-S102.

[0067] S101, performing an annealing reaction on a primer pair to form a transcription template, the primer pair having a T7 promoter, the primer pair including a forward primer and a reverse primer, the reverse primer having a base sequence composed of T bases and C bases and having a strand length of 20 nt-40 nt.

[0068] This setting synthesizes mRNA having a strand length of 20 nt-40 nt and a base sequence composed of A bases and G bases, which can repeatedly and stably detect capping enzyme activity.

[0069] Further, the base sequence of the forward primer is shown in SEQ ID No. 1, and the reverse primer is selected from at least one of the base sequences shown in SEQ ID No. 2-SEQ ID No. 5. This setting synthesizes mRNA that can repeatedly and stably detect capping enzyme activity.

[0070] Specifically, the sequences shown as SEQ ID No. 1-SEQ ID No. 5 are described above, and will not be repeated here.

[0071] In one specific example, the primer annealing reaction system is shown in Table 1. The primer annealing program is shown in Table 2. It should be noted that the concentrations and volumes of the components of the primer annealing reaction system in Table 1 are not limited to the amounts indicated in the table, and can be scaled up proportionally.

[0072] Table 1 Primer annealing reaction system (the reaction system can be scaled up proportionally)

[0073] Ingredients Volume / μL 10X Annealing Buffer 5 T7-F (100 μM) 20 T7-R (100 μM) 20 DNase / RNase-Free Distilled Water 5

[0074] Table 2 Primer annealing program

[0075] Temperature Time and cycle number 95℃ 4 min 95℃ 20 s, -0.5°C / cycle, 150 cycles 20℃ 60 min 4℃ Forever

[0076] S102, performing an in vitro transcription reaction on the transcription template to obtain mRNA.

[0077] Specifically, the reaction solution is prepared according to the in vitro transcription reaction system in Table 3, and incubated at 37°C for 4h; after the reaction is completed, 2U DNase I is added and incubated at 37°C for 30min, and then lithium chloride precipitation is performed to recover the mRNA, and the concentration of the mRNA is determined for standby; and sequence-optimized mRNA is obtained by in vitro synthesis. It should be noted that the concentrations and volumes of the components of the in vitro transcription reaction system in Table 3 are not limited to the amounts indicated in the table, and can be scaled up proportionally.

[0078] Table 3 In vitro transcription reaction system (the reaction system can be scaled up proportionally)

[0079] Ingredients Added volume / μL 10X T7 Buffer 2 ATP / GTP (100 mM each) 4 each The above Annealing Mix 2 Inorganic Pyrophosphatase 1 RNase Inhibitor (40 U / μL) 1 T7 RNA Polymerase (50 U / μL) 2 Nuclease-free water or DEPC water Up to 20

[0080] S120, detecting the reactants by high performance liquid chromatography or LC-MS method and calculating the 5' end capping rate of the mRNA to obtain the activity of the capping enzyme to be detected.

[0081] It can be understood that the mRNA is uncapped mRNA, and the reactants can contain capped mRNA; for example, if the capping enzyme to be detected has capping enzyme activity, the reactants contain capped mRNA.

[0082] In some embodiments, the step of detecting the reactants by high performance liquid chromatography and calculating the 5' end capping rate of the mRNA includes: detecting the peak time and peak area of the mRNA and the reactants by high performance liquid chromatography, and calculating the 5' end capping rate of the mRNA according to the peak time and peak area of the mRNA and the reactants.

[0083] In some embodiments, in the step of detecting the peak time and peak area of the mRNA and the reactant by high performance liquid chromatography, gradient elution is performed using mobile phase A and mobile phase B. The elution program includes: 0-30 min, gradient elution from 71% and 29% to 65% and 25% of the volume ratio of mobile phase A and mobile phase B, respectively; 30.1 min-40 min, elution using mobile phase A with a volume ratio of 71% and mobile phase B with a volume ratio of 29%. Mobile phase A is a 0.1 M triethylamine acetate solution with pH 7.0. Mobile phase B contains 25:75 acetonitrile: 0.1 M triethylamine acetate solution with pH 7.0.

[0084] Further, the chromatographic column is a DNA Core 1000 C18 column, 4.6x150 mm, with a particle size of 5 μm. The flow rate is 1 mL / min. The column temperature is 60°C. The detection wavelength is 280 nm. The injection volume is 20 μL.

[0085] In some embodiments, by comparing the peak time and peak area of the mRNA and the reactant, the activity of the test capping enzyme is calculated. The peak time of the mRNA is T3 and T4, the peak area of the mRNA is M3 and M4, the reactant does not peak at the peak time T3 and T4, or peaks at a time earlier than T3 and between T3 and T4, indicating that the test capping enzyme has capping enzyme activity.

[0086] Further, the step of S120 includes: the test capping enzyme detects the peak time and peak area of the mRNA, the completely capped mRNA and the reactant by high performance liquid chromatography. The peak time of the completely capped mRNA is T1 and T2, the peak area of the completely capped mRNA is M1 and M2, the peak time of the mRNA is T3 and T4, the peak area of the mRNA is M3 and M4, the reactant does not peak at the peak time T3 and T4, or peaks at a time earlier than T3 and between T3 and T4, i.e. the reactant peaks at T1 and T2 or peaks at T1-T4, indicating that the test capping enzyme has capping enzyme activity. (The peak times T1, T2, T3 and T4 are not detected, indicating that this detection is abnormal and needs to be re-detected). The completely capped mRNA is obtained by purifying and recovering after capping reaction by an excess of capping enzyme.

[0087] Specifically, the capping rate of the capping enzyme to be detected is calculated according to the peak time and peak area of the detected mRNA, completely capped mRNA and reactant, and the activity of the capping enzyme to be detected is obtained. The peak time of the mRNA is T3 and T4, the peak area of the mRNA is M3 and M4, and the capping rate is 100%-M3-M4=0. The peak time of the completely capped mRNA is T1 and T2, the peak area of the completely capped mRNA is M1 and M2, and the capping rate is M1+M2=100%. The peak time of the reactant is T1, T2 or T3, T4, the peak area of the reactant is M1, M2 or M3, M4, and the capping rate is M1+M2 or 100%-M3-M4.

[0088] The common capping enzyme activity detection method is currently mainly for vaccinia virus capping enzyme, including radioactive isotope detection method, cell transfection method and liquid chromatography mass spectrometry. The radioactive detection method is to add radioactive 32P-GTP substrate to GTP, and form radioactive capped mRNA under the action of vaccinia virus capping enzyme, and the activity of the capping enzyme is determined by detecting the radioactivity of the product. This method has low safety, complicated operation, high requirement for experimental environment and cannot be quantitatively detected; the cell transfection method compares the expression of fluorescent protein mRNA in the capping and non-capping conditions of the transfected cells, and observes the expression amount of the fluorescent protein in the cells to determine the activity of the vaccinia virus capping enzyme. This method is simple to operate, but has low sensitivity, many interference factors, and the detection result can only be qualitatively observed, and it is difficult to quantitatively calculate, and the enzyme activity determination error is large. A study discloses a method for determining the activity of vaccinia virus capping enzyme by comparing the molecular weight difference of the products before and after capping. The sequence of the in vitro transcription is not optimized, and various 3'-extended non-uniform products are easily formed in the in vitro transcription reaction catalyzed by T7 RNA polymerase, which leads to inaccurate molecular weight of the target fragment in the mass spectrometry detection; even if the molecular weight of the target fragment is occasionally correctly detected, high sensitivity mass spectrometry is also needed to analyze the proportion of the capped mRNA, and different degrees of sodium addition molecules will appear when the same sample is analyzed by mass spectrometry at different times, which interferes with the analysis of the results, leading to too long time consumption to obtain accurate results. Another study also discloses a method for detecting the activity of vaccinia virus capping enzyme. The method first caps mRNA by 3'-biotin-GTP and vaccinia virus capping enzyme, then captures the capped mRNA by streptavidin-labeled magnetic beads, and then uses the magnetic bead-captured capped mRNA as a template for RT-qPCR amplification, and determines the activity of the vaccinia virus capping enzyme by the difference in CT value before and after capping. The method has complicated operation steps, long time consumption, and needs to be combined with PCR to realize the detection, and the detection signal comes from the amplification product, not the capped mRNA, which is an indirect detection method, and the reproducibility of the method needs to be proved.

[0089] Therefore, in view of the defects of the prior art, the capping enzyme activity detection method of the present research is a detection method with good stability, high universality, safety and effectiveness, rapidity and directness, low cost, and high-throughput screening of capping enzyme and mutant activity. The capping enzyme activity detection method of the present research has at least the following advantages:

[0090] Compared with radioactive labeling, the present method avoids the pollution caused by radioactive labeling and is safer; compared with in vitro translation method, the detection results of the present method can be quantitatively output, avoiding the influence of subjective factors in qualitative observation, and high-throughput and automatic detection can be realized.

[0091] Compared with the magnetic bead capture-fluorescence quantitative PCR method, the detection signal of the present method directly comes from capped or uncapped RNA, without amplification process, and the detection signal is more reliable.

[0092] Furthermore, the signal peak difference between capped and uncapped RNA measured by the present method is significant, and the capped RNA is the direct product of capping enzyme, so the present method has good universality and can be applied to all capping enzyme activity detection.

[0093] Finally, the capping enzyme activity detection method of the present research uses T7 RNA polymerase to synthesize mRNA in vitro with sequence-optimized DNA template, and the recovered mRNA is used as a substrate for enzymatic capping reaction under the catalysis of capping enzyme. The capping reaction product is recovered and detected by HPLC or LC-MS method to calculate the 5' end capping rate of mRNA, and the activity of the capping enzyme to be detected is obtained. The sample detection sensitivity is high, the repeatability is good, the operation is simple, and high-throughput can be realized, which has good industrial application value.

[0094] The following is the specific embodiment part.

[0095] In the examples, reagents and instruments are used as commonly selected in the art unless otherwise specified. The experimental methods not specified in the examples are usually carried out according to conventional conditions, such as the conditions described in the literature, books or the methods recommended by the reagent kit manufacturers. The reagents used in the examples are commercially available.

[0096] The reagents and consumables required in the following examples, unless otherwise specified: 10x Annealing Buffer: 100 mM Tris-HCl (pH 7.5), 10 mM EDTA, 1 mM NaCl (all reagents are molecular grade); anhydrous ethanol, acetonitrile, acetic acid, triethylamine, DNase I (RNase-free), DNase / RNase-Free Distilled Water, lithium chloride; pipette tips of various ranges, filters, syringes, 0.22 μΜ filter membranes, in-line tubes, liquid phase vials, chromatographic column DNA Core 1000C184.6x150mm 5μm, etc.

[0097] The instruments required in the following examples, unless otherwise specified: centrifuge, vortex shaker, constant temperature water bath, clean bench, PCR instrument, vacuum pump, liquid chromatograph, etc.

[0098] Example 1 In vitro synthesis of sequence-optimized mRNA

[0099] 1. Design of primers T7-F and T7-R

[0100] The primer pair T7-F and T7-R with T7 promoter is annealed under certain conditions to form a transcription template, and the specific sequence is as follows:

[0101] The T7-F1 primer is as follows:

[0102] 5'-CGAAATTAATACGACTCACTATAGGA-3' (as shown in SEQ ID No. 1);

[0103] The T7-R1 primer is as follows:

[0104] 5'-CTTCTTTCTTCCCTTTCCTTCCTCTCCTTCCTATAGTGAGTCGTATTAATTTCG-3' (as shown in SEQ ID No. 2).

[0105] The T7-R2 primer is as follows:

[0106] 5'-CCCTCCCTCCTCCTCCCTCTCCTATAGTGAGTCGTATTAATTTCG-3' (as shown in SEQ ID No. 3).

[0107] The T7-R3 primer is as follows:

[0108] 5'-CTTCTTTCTTCCTTCTTTCTTTCTTTTCTTCTTTTTCCTATAGTGAGTC GTATTAATTTCG-3' (as set forth in SEQ ID No. 4).

[0109] The T7-R4 primer is as follows:

[0110] 5'-CTCCTTCTTCTCCTTTCCTCTCCCTCTCTCCTTCCTATAGTGAGTCGT ATTAATTTCG-3' (as set forth in SEQ ID No. 5).

[0111] The sequence of the mRNA of interest synthesized in vitro is as follows:

[0112] The nucleotide sequence of the 31 nt mRNA is as follows:

[0113] 5'-pppGGAAGGAGAGGAAGGAAAGGGAAGAAAGAAG-3' (as set forth in SEQ ID No. 6).

[0114] The nucleotide sequence of the 22 nt mRNA is as follows:

[0115] 5'-pppGGAGAGGGAGGAGGAGGGAGGG-3' (as set forth in SEQ ID No. 7).

[0116] The nucleotide sequence of the 38 nt mRNA is as follows:

[0117] 5'-pppGGAAAAAGAAGAAAAGAAAGAAAGAAGGAAGAAAGAAG-3' (as set forth in SEQ ID No. 8).

[0118] The nucleotide sequence of the 35 nt mRNA is as follows:

[0119] 5'-pppGGAAGGAGAGAGGGAGAGGAAAGGAGAAGAAGGAG-3' (as set forth in SEQ ID No. 9).

[0120] Because RNase A is most easily contaminated in the environment, it specifically recognizes and degrades cytosine ribonucleotide (C) or uracil ribonucleotide (U) residues on single-stranded RNA. However, the sequence-optimized mRNA consists only of adenine ribonucleotide (A) and guanine ribonucleotide (G), minimizing its degradation by environmental RNases. Simultaneously, it reduces the generation of heterogeneous 3′-extended products during in vitro transcription by T7 RNA polymerase. The optimized template sequence produces only the theoretical sequence (as shown in SEQ ID No. 6-SEQ ID No. 9) and a sequence containing one more AMP molecule than the theoretical sequence during in vitro transcription by T7 RNA polymerase (see...). Figure 1 B and Figure 2 (Two peak clusters in B). The sequence-optimized template DNA and its transcribed mRNA are the basis for the stable activity assay of the capped enzyme.

[0121] 2. Primer annealing reaction

[0122] 1) The primer annealing reaction system is shown in Table 1.

[0123] Table 1 Primer annealing reaction system (the reaction system can be scaled up proportionally)

[0124] Ingredients Volume / μL 10X Annealing Buffer 5 T7-F (100 μM) 20 T7-R (100 μM) 20 DNase / RNase-Free Distilled Water 5

[0125] 2) The primer annealing procedure is shown in Table 2.

[0126] Table 2 Primer annealing procedure

[0127] Temperature Time and cycle number 95℃ 4 min 95℃ 20 s, -0.5°C / cycle, 150 cycles 20℃ 60 min 4℃ Forever

[0128] After the PCR program is completed, the Annealing Mix is ​​obtained and stored at -20℃ for later use.

[0129] 3. In vitro transcription

[0130] Specifically, the in vitro transcription reaction system is shown in Table 3.

[0131] Table 3. In vitro transcription reaction system (the reaction system can be scaled up proportionally).

[0132] Ingredients Added volume / μL 10X T7 Buffer 2 ATP / GTP (100 mM each) 4 each The above Annealing Mix 2 Inorganic Pyrophosphatase 1 RNase Inhibitor (40 U / μL) 1 T7 RNA Polymerase (50 U / μL) 2 Nuclease-free water or DEPC water Up to 20

[0133] Incubate at 37℃ for 4 hours; after the reaction, add 2U DNase I and digest at 37℃ for 30 minutes, then precipitate with lithium chloride to recover mRNA and determine the mRNA concentration for later use; obtain in vitro synthesized mRNA with optimized sequence.

[0134] Example 2 Capping enzyme performs capping reaction on mRNA (take 31 nt mRNA as an example, i.e. the sequence as shown in SEQ ID No. 6)

[0135] Take 15 μg of mRNA (31 nt, i.e. the sequence as shown in SEQ ID No. 6) after in vitro transcription and lithium chloride purification into a 1.5 mL centrifuge tube, dilute to 39 μL with nuclease-free water; heat at 65°C for 5 min; take out the centrifuge tube and place it on ice for 5 min, and then add the reaction system components as shown in Table 4 to the 1.5 mL centrifuge tube in turn.

[0136] Table 4 Capping reaction system (the reaction system can be scaled up proportionally)

[0137] Ingredients Reaction volume / μL Denatured mRNA 39 10X Capping Buffer 6 GTP (10 mM) 3 SAM (2 mM) 3 Inorganic Pyrophosphatase 1.5 RNase Inhibitor 1.5 Capping Enzyme 3 DNase / RNase-Free Distilled Water Up to 60

[0138] Note: In the negative control group (uncapped) reaction system, 3 μL of capping enzyme is replaced with an equal volume of nuclease-free water.

[0139] Gently mix, incubate at 37°C for 1 h, then immediately put back on ice; then perform lithium chloride precipitation to recover the capped mRNA, dissolve in 100 μL of nuclease-free water, filter and then place in a liquid phase bottle for detection.

[0140] Example 3 HPLC method for analyzing the activity of capping enzyme (take 31 nt mRNA as an example, i.e. the sequence as shown in SEQ ID No. 6)

[0141] 1. Preparation of HPLC detection conditions

[0142] Use a chromatographic column DNA Core 1000C18 4.6x150mm 5μm, prepare the mobile phase: A: 0.1M triethylamine acetate solution, pH 7.0, B: acetonitrile: 0.1M triethylamine acetate solution (pH 7.0) = 25:75, set the instrument detection parameters flow rate: 1 mL / min, column temperature: 60°C; detection wavelength: 280 nm; injection volume: 20 μL; set the flow phase gradient conditions for sample detection according to Table 5.

[0143] Table 5 Chromatographic conditions for sample detection

[0144] Time A(％) B(％) 0 71 29 30 65 35 30.1 71 29 40 71 29

[0145] 2. HPLC detection of capping enzyme activity

[0146] Step one: synthesize annealing primers T7-F and T7-R1, mix the primers and anneal to obtain a transcription template, wherein the sequences of the T7-F and T7-R1 primers are as shown in SEQ ID No. 1 and SEQ ID No. 2, respectively;

[0147] Step two: add ATP and GTP, in vitro transcription by T7 RNA polymerase, purify and recover RNA;

[0148] Step three: cap the 5' end of the transcription product mRNA under the action of capping enzyme;

[0149] Step four: use HPLC to detect the products of the capping reaction, compare the peak time and peak area of mRNA before and after capping, and calculate the activity of the capping enzyme.

[0150] Use the above detection method to detect the sample to be tested, the negative control group ( Figure 1 ), the positive control group 1 ( Figure 2 ), the positive control group 2 ( Figure 3 ), the experimental group ( Figure 4 ), wherein Figure 1 is uncapped mRNA; Figure 2 is completely capped mRNA; Figure 3 is a mixture of uncapped mRNA and completely capped mRNA in a volume ratio of 1:1; Figure 4 is the result of vaccinia virus capping enzyme of Haishen Enzyme Co., Ltd. on mRNA capping.

[0151] The time required for the detection step of the present embodiment is 40 min, Figure 1 The results show that the peak time of uncapped mRNA is 17.689 min and 19.713 min, and the peak area percentage is 60.10% and 39.9%; Figure 2 The results show that the peak time of completely capped mRNA is 17.663 min and 19.755 min, and the peak area percentage is 59.43% and 40.57%; Figure 3 The results show that the peak time of capped mRNA mixed with uncapped mRNA and completely capped mRNA in a volume ratio of 1:1 is 18.562 min and 20.697 min, and the corresponding peak area percentage is 30.91% and 22.11%, and the peak time of uncapped mRNA is 19.454 min and 21.601 min, and the corresponding peak area percentage is 27.45% and 19.53%, indicating that this method can separate mRNA before and after capping; and Figure 4 The results are consistent with Figure 3 , indicating that the mRNA capping is successful, and the enzyme has capping activity. The HPLC peak time and peak area percentage are shown in Table 6.

[0152] Table 6 Peak time and peak area percentage

[0153]

[0154]

[0155] 3. Reproducibility verification of the method for detecting capping enzyme activity (taking 31 nt mRNA as an example)

[0156] The experimental groups in Example Three were diluted 10 times and 20 times, respectively, and each group was repeated 5 times to prepare detection samples. The enzyme activity was determined by the method in Example Three, and the results are as follows (Table 7):

[0157] Table 7 Reproducibility verification of the enzyme activity determination method

[0158]

[0159] The results show that the parallel group experimental results corresponding to 10 times dilution and 20 times dilution have good reproducibility, and the corresponding RSDs are 0.79% and 0.89%, respectively, indicating that the detection results are reliable; and under the same conditions, the capping rate of the capping enzyme diluted 10 times is higher than that diluted 20 times, indicating that the method can accurately distinguish capping enzymes with different activities. At the same time, the reproducibility verification of the enzyme activity detection of the same samples by LC-MS method is consistent with the reproducibility detection results of HPLC, and the reproducibility is good. When the optimized sequence is used, whether HPLC method or LC-MS method can obtain stable capping enzyme activity detection results. However, compared with HPLC method, LC-MS is to analyze the theoretical and actual molecular weight of the substance, and calculate the capping rate according to the signal intensity percentage detected by the instrument, which takes too long to obtain accurate results.

[0160] Example 4 Comparison of HPLC and LC-MS methods for detecting vaccinia virus capping enzyme activity (taking 31 nt mRNA as an example)

[0161] Step 1: Synthesize annealing primers T7-F and T7-R1, and anneal the mixed primers to obtain a transcription template, wherein the primer sequences of T7-F and T7-R1 are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively;

[0162] Step 2: Add ATP and GTP, and perform in vitro transcription by T7 RNA polymerase to purify the mRNA back;

[0163] Step 3: Cap the 5' end of the transcription product mRNA under the action of capping enzyme;

[0164] Step 4: First, use LC-MS to detect the capping rate of the 5' end of the mRNA, so as to determine the activity of the vaccinia virus capping enzyme. The detection results and Figure 5 A and Table 8, according to the mass spectrum analysis, Uncapped RNA and Capped RNA are detected, and the mass-to-charge ratio and signal intensity are shown, and then the results show that the capping rate of the capping enzyme to be tested is 92.96%.

[0165] Table 8 Analysis of results of LC-MS assay

[0166]

[0167] At the same time, the activity of the batch of capping enzyme was detected using the HPLC method, and the detection results are as follows Figure 5 According to the peak time and peak area, the capping rate of the detected vaccinia virus capping enzyme was 88.38%, and the detection results were basically consistent with the above LC-MS. However, in data processing, the HPLC method directly displays the ratio of capped RNA and uncapped RNA, and the calculation of capping rate is simple and rapid; while the LC-MS needs to find the peaks of capped RNA and uncapped RNA according to the theoretical molecular weight of mRNA, and the different Na + The modification product affects the positioning of a specific peak and affects the judgment of the capping rate, resulting in relatively long time-consuming for result analysis.

[0168] Table 9 Analysis of results of HPLC assay

[0169]

[0170] In summary, in the mRNA and capping enzyme activity detection kit of the present application, the sequence-optimized mRNA is composed of adenine ribonucleotide (A) and guanine ribonucleotide (G), which can minimize its degradation by RNase in the environment, and can stably and repeatedly detect the activity of capping enzyme, so as to stably and efficiently screen capping enzyme and its mutant strains. The capping enzyme activity detection system and detection method of the present application can stably, universally, safely and effectively detect the activity of capping enzyme, and can high-throughput screen the activity of capping enzyme and mutants.

[0171] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.

[0172] See the electronic sequence table for details.

Claims

1. A capping enzyme activity assay kit, characterized in that, The mRNA for detecting capping enzyme activity, the mRNA has a length of 20 nt-40 nt, the base sequence of the mRNA is composed of A base and G base, and the number of A base accounts for 29%-71%; wherein: The base sequence of the mRNA is shown in any one of SEQ ID No. 6-SEQ ID No. 9: The nucleotide sequence of the 31 nt mRNA is shown in SEQ ID No. 6; The nucleotide sequence of the 22 nt mRNA is shown in SEQ ID No. 7; The nucleotide sequence of the 38 nt mRNA is shown in SEQ ID No. 8; The nucleotide sequence of the 35 nt mRNA is shown in SEQ ID No.

9.

2. The capping enzyme activity assay kit of claim 1, wherein, Further comprising: Capping reaction reagent, the capping reaction reagent includes GTP, S-adenosyl methionine, inorganic pyrophosphatase and RNase inhibitor.

3. A capping enzyme activity assay kit characterized in that, The primer pair for synthesizing mRNA for detecting capping enzyme activity, the mRNA has a length of 20 nt-40 nt, the base sequence of the mRNA is composed of A base and G base, and the number of A base accounts for 29%-71%; wherein: The base sequence of the mRNA is shown in any one of SEQ ID No. 6-SEQ ID No. 9: The nucleotide sequence of the 31 nt mRNA is shown in SEQ ID No. 6; The nucleotide sequence of the 22 nt mRNA is shown in SEQ ID No. 7; The nucleotide sequence of the 38 nt mRNA is shown in SEQ ID No. 8; The nucleotide sequence of the 35 nt mRNA is shown in SEQ ID No.

9.

4. The capping enzyme activity assay kit of claim 3, wherein, The primer pair with T7 promoter, the primer pair includes forward primer and reverse primer, the reverse primer contains base sequence with a length of 20 nt-40 nt and composed of T base and C base.

5. The capping enzyme activity assay kit of claim 4, wherein, The base sequence of the forward primer is shown in SEQ ID No. 1, and the reverse primer is selected from at least one of the base sequences shown in SEQ ID No. 2-SEQ ID No.

5.

6. The capping enzyme activity assay kit according to any one of claims 3 to 5, characterized in that, Further comprising: Primer annealing reaction reagent, in vitro transcription reaction reagent and capping reaction reagent.

7. A capping enzyme activity detection system characterized in that, The detection device is a high performance liquid chromatography detection device or an LC-MS device.

8. The capping enzyme activity detection system of claim 7, wherein, The detection device is a high performance liquid chromatography detection device or an LC-MS device.

9. A method for detecting capped enzyme activity, characterized in that, The steps include: The capping reaction of the capping enzyme to be detected and mRNA, the mRNA has a length of 20 nt-40 nt, the base sequence of the mRNA is composed of A base and G base, and the number of A base accounts for 29%-71%; wherein: The base sequence of the mRNA is shown in any one of SEQ ID No. 6-SEQ ID No. 9: The nucleotide sequence of the 31 nt mRNA is shown in SEQ ID No. 6; The nucleotide sequence of the 22 nt mRNA is shown in SEQ ID No. 7; The nucleotide sequence of the 38 nt mRNA is shown as SEQ ID No. 8; The nucleotide sequence of the 35 nt mRNA is shown as SEQ ID No. 9; The reaction is detected by high performance liquid chromatography or LC-MS method, and the 5' end capping rate of the mRNA is calculated to obtain the activity of the capping enzyme to be detected; The step of detecting the reaction by high performance liquid chromatography and calculating the 5' end capping rate of the mRNA comprises: detecting the peak time and peak area of the mRNA and the reaction by high performance liquid chromatography, and calculating the 5' end capping rate of the mRNA according to the peak time and peak area of the mRNA and the reaction. The chromatographic column used is DNA Core 1000 C18, the detection wavelength is 280 nm, and gradient elution is performed using mobile phase A and mobile phase B; the elution program is as follows: The mobile phase A is a 0.1M triethylamine acetate solution with pH 7.0, and the mobile phase B contains acetonitrile and a 0.1M triethylamine acetate solution with pH 7.0 at a volume ratio of 25:

75.

10. The capped enzyme activity detection method of claim 9, wherein, Before the step of performing capping reaction on the mRNA by the capping enzyme to be detected, the method further comprises the step of synthesizing the mRNA: The primer pair is subjected to annealing reaction to form a transcription template, the primer pair has a T7 promoter, and the primer pair comprises a forward primer and a reverse primer, the reverse primer has a base sequence with a chain length of 20-40 nt and composed of T and C bases; The transcription template is subjected to in vitro transcription reaction to obtain the mRNA.

11. Use of the capping enzyme activity detection kit of any one of claims 1-6, or the capping enzyme activity detection system of any one of claims 7-8, or the capping enzyme activity detection method of any one of claims 9-10 in screening capping enzymes.

Images