Application of OsGRP1 protein and its encoding gene in regulating plant growth and development
By reducing the expression of OsGRP1 protein or gene through gene editing technology, the problem of limited sources of male sterility traits has been solved, enabling the rapid breeding of lodging-resistant male sterile rice, expanding the screening and application potential of hybrid combinations, and meeting the needs of high yield, high quality, high efficiency, safety, and ecology in agricultural production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-15
- Publication Date
- 2026-04-03
AI Technical Summary
In existing technologies, the sources of male sterility are limited, which restricts the screening and application of hybrid combinations and makes it difficult to meet the agricultural production requirements for high yield, high quality, high efficiency, safety and ecology. In addition, traditional breeding methods have long cycles and slow results, which are difficult to meet the urgent needs of production development.
By using gene editing technology, the expression level or activity of OsGRP1 protein or OsGRP1 gene is reduced, resulting in reduced plant height and fertility, thus cultivating lodging-resistant male-sterile rice. Gene editing is performed using Cas9 protein and sgRNA to specifically target the 820-839 sites of the OsGRP1 gene for mutation or knockout.
This method enables rapid and stable reduction of plant height and fertility, provides a simple method for creating lodging-resistant male-sterile rice, expands the screening and application potential of hybrid combinations, and meets the needs of agricultural production.
Smart Images

Figure CN116769822B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology technology and relates to the application of OsGRP1 protein and its encoding gene in regulating plant growth and development. Background Technology
[0002] Since the 1970s, the utilization of heterosis has made significant contributions to rice production in my country. Faced with the new and significant demands of my country's economic development for agricultural production—namely, "high yield, high quality, high efficiency, safety, and ecological sustainability"—the question of whether the potential of heterosis can be further explored to address these demands has become a serious challenge for contemporary scientists.
[0003] Heterosis is based on the combination of two different parents. To further explore its potential based on existing applications, in addition to strengthening research on the mechanism of heterosis formation, it is also urgent to establish effective methods to create male sterility traits, so as to effectively expand the screening of hybrid combinations and the application of excellent combinations in production.
[0004] Currently, most male sterility traits widely used in breeding and production originate from natural mutations and their conversion lines. The limited sources of male sterility are a serious constraint on expanding the screening of hybrid combinations, especially their application. According to current internationally accepted rules, all innovations with application potential are protected by intellectual property rights. Therefore, finding new, proprietary ideas and methods for artificially controlling crop seed size and yield has become one of the unavoidable and urgent key issues facing countries and regions hoping to gain the initiative in exploring the application potential of heterosis.
[0005] For a long time, people have been using conventional breeding methods to select hybrid crops. These methods are time-consuming and slow to produce results, and cannot meet the urgent needs of production development. Compared with traditional methods, genetic engineering methods have some advantages: shorter breeding cycles, relatively stable fertility, less susceptibility to environmental influences, less dependence on genotype, and less environmental pollution. Summary of the Invention
[0006] The purpose of this invention is to provide the application of OsGRP1 protein and its encoding gene in regulating plant growth and development.
[0007] This invention provides the application of OsGRP1 protein or OsGRP1 gene in regulating plant height and / or fertility.
[0008] The regulation means that the OsGRP1 protein content is reduced, the plant height is reduced, and / or fertility is reduced.
[0009] The regulation means that the expression level of the OsGRP1 gene is reduced, resulting in a decrease in plant height and / or fertility.
[0010] This invention also provides the application of OsGRP1 protein or OsGRP1 gene as a repression target in plant breeding; the goal of the plant breeding is to cultivate plants with reduced plant height and / or reduced fertility.
[0011] This invention also provides the application of substances that inhibit the OsGRP1 protein or the OsGRP1 gene in plant breeding; the goal of the plant breeding is to cultivate plants with reduced plant height and / or reduced fertility. Inhibition of the OsGRP1 gene specifically involves inhibiting OsGRP1 gene expression. The substance that inhibits OsGRP1 gene expression specifically includes a gene editing vector targeting the OsGRP1 gene. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsGRP1 gene. Specifically, the target of the sgRNA is: ATCGCTGTGGACCGTGAGAC. The target of the sgRNA is located at positions 820-839 of sequence 3 in the sequence listing.
[0012] The present invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: mutating the segment “GCAGATCGCTGTGGACCGTGAGACGGGGAGGTCCCGCGGGTTCGGGTTCGTGAGCTTC” in the OsGRP1 gene of the plant genomic DNA to “GCAGATCGCTGTGGACCGTGAAGACGGGGAGGTCCCGCGGGTTCGGGTTCGTGAGCTTC”.
[0013] The mutation is a homozygous mutation, meaning that the same mutation has occurred on a pair of homologous chromosomes.
[0014] This invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: gene editing of the OsGRP1 gene in a recipient plant to obtain gene-edited plants; and screening from the gene-edited plants for plants with reduced plant height and / or reduced fertility relative to the recipient plant. The gene editing is achieved by introducing a gene-editing vector. The gene-editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsGRP1 gene. Specifically, the target of the sgRNA is: ATCGCTGTGGACCGTGAGAC. The target of the sgRNA is located at positions 820-839 of sequence 3 in the sequence listing.
[0015] This invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: knocking out the OsGRP1 gene in the genome of a recipient plant to obtain a plant with reduced plant height and / or reduced fertility relative to the recipient plant. The knockout may be a complete knockout of the reading frame or a partial knockout of a segment within the reading frame.
[0016] This invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: inhibiting the expression of the OsGRP1 gene in a recipient plant to obtain plants with reduced plant height and / or reduced fertility relative to the recipient plant. Inhibition of OsGRP1 gene expression in the recipient plant is specifically achieved by introducing a gene editing vector. The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located in the OsGRP1 gene. Specifically, the target of the sgRNA is: ATCGCTGTGGACCGTGAGAC. The target of the sgRNA is located at positions 820-839 of sequence 3 in the sequence listing.
[0017] The present invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: reducing the plant height and / or fertility by reducing the content of OsGRP1 protein in the plant.
[0018] The present invention also provides a method for cultivating plants with reduced plant height and / or reduced fertility, comprising the following steps: reducing the plant height and / or reduced fertility by reducing the activity of OsGRP1 protein in the plant.
[0019] The OsGRP1 protein mentioned above is either (a1), (a2), (a3), or (a4) as follows:
[0020] (a1) The protein shown in SEQ ID NO: 1;
[0021] (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1);
[0022] (a3) Proteins related to plant height and / or fertility obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1).
[0023] (a4) is a protein derived from rice that shares more than 98% identity with (a1) and is associated with plant height and / or fertility.
[0024] The specific labels are shown in Table 1.
[0025] Table 1: Label Sequence
[0026] Label residues sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0027] The OsGRP1 gene mentioned above is the gene encoding the OsGRP1 protein.
[0028] Specifically, the OsGRP1 gene is as follows (b1) or (b2) or (b3) or (b4):
[0029] (b1) A DNA molecule with a coding region as shown in SEQ ID NO: 2;
[0030] (b2) The DNA molecule shown in SEQ ID NO: 3;
[0031] (b3) A DNA molecule derived from rice and having more than 95% identity with (b1) or (b2) and encoding the protein thereon;
[0032] (b4) A DNA molecule that hybridizes under stringent conditions to a nucleotide sequence defined in (b1) or (b2) and encodes the protein.
[0033] The above stringent conditions can be achieved by hybridization at 65°C and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS during DNA or RNA hybridization experiments.
[0034] The fertility described above can be male fertility.
[0035] The fertility described above can be manifested as pollen fertility.
[0036] The fertility described above can be reflected in the seed setting rate.
[0037] Any of the plants mentioned above may be monocotyledonous or dicotyledonous.
[0038] Any of the plants mentioned above can be plants of the Poaceae family.
[0039] Any of the plants mentioned above may be plants of the genus *Rice*.
[0040] Specifically, any of the plants mentioned above can be rice.
[0041] Specifically, any of the plants mentioned above can be rice variety Zhonghua 11.
[0042] This invention, by introducing a gene-editing vector, downregulates the expression levels of the OsGRP1 protein and OsGRP1 gene in rice, resulting in the following phenotypes: reduced plant height and / or reduced fertility. Based on these phenotypes, this invention can be used to breed lodging-resistant male-sterile rice. This invention lays the foundation for finding simpler ideas and methods for creating lodging-resistant and male-sterile crops. Attached Figure Description
[0043] Figure 1This is a schematic diagram of the components of the pCBSG032 carrier.
[0044] Figure 2 Sequencing results showing the mutation locations in osgrp1 mutant and wild-type plants.
[0045] Figure 3 This is a photograph of a mature plant from Example 3.
[0046] Figure 4 The images show photographs of the anthers and pollen after staining, as shown in Example 3.
[0047] Figure 5 The results are statistical results of the proportion of fertile pollen and the proportion of sterile pollen in Example 3.
[0048] Figure 6 This is a photograph of a mature rice ear in Example 3.
[0049] Figure 7 The results are statistical results of the proportion of full seeds and empty seeds in Example 3. Detailed Implementation
[0050] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Agrobacterium EHA105: Beijing TransGen Biotech Co., Ltd. Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0052] pCBSG032 carrier (see component schematic diagram) Figure 1): Weimi Biotechnology Co., Ltd. The pCBSG032 vector is described in the following literature: Tian Y, Zhong D, Li X, Shen R, Han H, Dai Y, Yao Q, Zhang X, Deng Q, Cao X, Zhu JK, Lu Y. High-throughput genome editing in rice with a virus-based surrogate system. J Integr Plant Biol. 2022 Oct 11. doi:10.1111 / jipb.13381. Epub ahead of print. PMID:36218268.
[0053] Zhonghua 11, a rice variety, was developed by the Institute of Crop Science, Chinese Academy of Agricultural Sciences in 1979 using Jingfeng 5 / Tetepu / Fujin as flower-cultivated varieties. Zhonghua 11 is documented in the following literature: Ni Pichong. A new flower-cultivated rice variety—Zhonghua 11. Crop Variety Resources, 1989, Issue 04. The Zhonghua 11 plant is also known as a wild-type plant, denoted by WT.
[0054] Example 1: Preparation of culture medium and infection solution
[0055] The formulation of NB basal medium is shown in Table 1.
[0056] Table 1
[0057]
[0058]
[0059] Callus induction medium (pH 5.8): Based on NB basic medium, the following were added: enzymatically hydrolyzed casein (concentration in the medium was 500 mg / L), 2,4-D (concentration in the medium was 2 mg / L), proline (concentration in the medium was 2.8 g / L), sucrose (concentration in the medium was 30 g / L), and plant gel (concentration in the medium was 2.6 g / L).
[0060] Callus subculture medium (pH 5.8): Based on NB basic medium, add enzymatically hydrolyzed casein (to a concentration of 500 mg / L), 2,4-D (to a concentration of 2 mg / L), proline (to a concentration of 0.5 g / L), sucrose (to a concentration of 30 g / L), and plant gel (to a concentration of 2.6 g / L).
[0061] Co-culture medium (pH 5.2): Based on NB basic medium, add acetosyringone (to a concentration of 100 μM), glucose (to a concentration of 10 g / L), and plant gel (to a concentration of 2.6 g / L).
[0062] Screening medium (pH 5.8): Based on NB basic medium, hydrolyzed casein (concentration in the medium is 500 mg / L), 2,4-D (concentration in the medium is 2 mg / L), proline (concentration in the medium is 2.8 g / L), sucrose (concentration in the medium is 30 g / L), G418 (concentration in the medium is 150 mg / L), cephalosporin (concentration in the medium is 500 mg / L), and plant gel (concentration in the medium is 2.6 g / L).
[0063] Differentiation medium (pH 5.8): Based on NB basic medium, add kinetin (concentration of 2 mg / L), NAA (concentration of 0.5 mg / L), sucrose (concentration of 30 g / L), sorbitol (concentration of 30 g / L), G418 (concentration of 150 mg / L), cephalosporin (concentration of 300 mg / L), and plant gel (concentration of 2.6 g / L).
[0064] Rooting medium (pH 5.8): contains 1 / 4 concentration of MS inorganic salts, 1× concentration of MS vitamins, 0.5 mg / L NAA, 1 mg / L paclobutrazol, 2.6 g / L plant gel, and the remainder is water.
[0065] The formulation of AAM infection solution (pH 5.2) is shown in Table 2.
[0066] Table 2
[0067]
[0068]
[0069] Example 2: Obtaining the osgrp1 mutant strain
[0070] In this embodiment, the Zhonghua 11 rice plant was used as the starting plant to prepare a CRISPR / Cas-mediated site-directed gene editing plant (i.e., the osgrp1 mutant) with the OsGRP1 gene as the target gene.
[0071] The OsGRP1 gene originates from rice (Oryza sativa L.) and encodes the OsGRP1 protein (composed of 104 amino acid residues) shown in Sequence 1 of the sequence listing. In rice cDNA, the coding frame of the OsGRP1 gene is shown in Sequence 2 of the sequence listing (composed of 315 nucleotides). In rice genomic DNA, the OsGRP1 gene is shown in Sequence 3 of the sequence listing (in Sequence 3 of the sequence listing, the start codon is located at positions 99-101, and the stop codon is located at positions 976-978).
[0072] I. Construction of gene editing vectors
[0073] The preset target is: ATCGCTGTGGACCGTGAGAC.
[0074] The target site is located at positions 820-839 of sequence 3 in the sequence list.
[0075] 1. Prepare single-stranded DNA molecules SGosgrp1-F and SGosgrp1-R, and then anneal them to obtain double-stranded DNA molecules with sticky ends.
[0076] SGosgrp1-F:ggcaATCGCTGTGGACCGTGAGAC;
[0077] SGosgrp1-R:aaacGTCTCACGGTCCACAGCGAT.
[0078] 2. Take the pCBSG032 vector, digest it with the restriction endonuclease BsaI, and recover the vector backbone (i.e., a large linear fragment of about 1.6 kb).
[0079] 3. The double-stranded DNA molecule with sticky ends obtained in step 1 is ligated to the vector backbone obtained in step 2 to obtain a recombinant plasmid, which is the gene editing vector. The gene editing vector has been sequenced and verified.
[0080] II. Obtaining Gene-Edited Plants
[0081] 1. Callus induction and subculture
[0082] Mature seeds of rice variety Zhonghua 11 were taken, the glumes were removed, and the seeds were disinfected with 75% ethanol solution for 1 minute, then rinsed with sterile water, then disinfected with 30% sodium hypochlorite solution for 20 minutes, then thoroughly washed with sterile water, and the moisture on the seed surface was absorbed with sterile filter paper. The seeds were then transferred to callus induction medium for culture to obtain callus tissue for Agrobacterium infection (the callus was in good condition, bright yellow in color, round and hard in texture, and the particle diameter was about 3 mm).
[0083] After callus tissue grows, it can be directly infected with Agrobacterium using the protoembryo. Small particles growing next to the protoembryo can be picked up and cultured on callus subculture medium. When they grow to a suitable size, they can also be infected with Agrobacterium.
[0084] 2. Preparation of Agrobacterium suspension
[0085] The gene-editing vector prepared in step one was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium. The recombinant Agrobacterium was cultured and the bacterial cells were collected, suspended in AAM infection solution, and OD was obtained. 600nm The value is 0.3-0.5 for Agrobacterium suspension.
[0086] 3. Agrobacterium infection
[0087] Take the callus tissue obtained in step 1, immerse it in the Agrobacterium suspension prepared in step 2, infect it at room temperature for 20 minutes (shaking it occasionally during the process), then take out the callus tissue, absorb the excess bacterial solution with sterile filter paper, and then transfer it to a co-culture medium covered with a layer of sterile filter paper, and incubate it in the dark at 26°C for 3 days.
[0088] 4. Screening and Cultivation
[0089] After completing step 3, take the callus tissue, rinse it twice with sterile water, then rinse it once with carbenicillin solution, remove excess water with a pipette, transfer it to sterile filter paper, air dry the surface moisture on a laminar flow hood, and then transfer it to a selection medium containing hygromycin. Incubate in the dark at 28-30℃ for 3-4 weeks. At this time, you can observe the growth of positive callus with a bright yellow color and a diameter of 1-2 mm.
[0090] 5. Differentiation and regeneration
[0091] Take the positive callus obtained in step 4, transfer it to differentiation medium, and culture it at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). After about 10 days of culture, green spots can be observed emerging from the callus, and seedlings will differentiate after another 10 days of culture. The differentiated seedlings will grow to a height of 2-3cm.
[0092] 6. Rooting
[0093] Take the seedlings obtained in step 5 and transfer them to rooting medium. Incubate them at 28-30℃ with alternating light and dark conditions (16h light / 8h darkness). The rooted seedlings are the T0 generation plants.
[0094] III. Identification of Mutation Types
[0095] The T0 generation plants obtained in step two are self-pollinated and their seeds are harvested. The seeds are then cultivated into plants, which are the T1 generation plants.
[0096] Leaves from T1 generation plants were collected, genomic DNA was extracted, and PCR amplification was performed using primer pairs consisting of CAS9-OsGRP1-F and CAS9-OsGRP1-R. The amplification products were then recovered and sequenced. Mutant strains were screened based on the sequencing results.
[0097] CAS9-OsGRP1-F: CGCCGGGCCAATTTATACAC;
[0098] CAS9-OsGRP1-R:TGTCCTGGAAGCTCACGAAC.
[0099] One homozygous mutant was screened from the T1 generation plants and named the osgrp1 mutant.
[0100] Compared to the wild-type plant's genomic DNA, the osgrp1 mutant strain has an insertion of one A nucleotide at the front of the second exon of the OsGRP1 gene, resulting in a frameshift (i.e., a mutation occurring in both homologous chromosomes: "GCAGATCGCTGTGGACCGTGAGACGGGGAGGTCCCGCGGGTTCGG") GTTCGTGAGCTTC ” mutates to “GCAGATCGCTGTGGACCGTGAAGACGGGGAGGTCCCGCGGGTTCGG” GTTCGTGAGCTTC The sequencing results show that the protein cannot be translated into normal protein. Figure 2 .
[0101] Example 3, Identification of Characteristics
[0102] Test seeds: Seeds obtained by self-pollination of the osgrp1 mutant obtained in Example 2, and seeds of wild-type plants.
[0103] The tested seeds were sown and cultured until germination, and then transferred to a field in the suburbs of Beijing.
[0104] 1. Observe the plant height phenotype.
[0105] See photos of mature plants Figure 3 Compared to wild-type plants, the progeny of the osgrp1 mutant showed a significantly reduced plant height.
[0106] 2. Pollen phenotype and pollen fertility analysis
[0107] During the flowering period of the plant, collect small flowers at the pollen stage, dissect them under a stereomicroscope to obtain the anthers, add I2-KI solution, quickly crush the anthers to release pollen, observe the pollen under a microscope and take pictures. I2-KI staining solution: Dissolve 0.5g KI in 1.25mL deionized water, add 0.25g iodine tablets, then dilute to 75mL and store in the dark.
[0108] See photos of anthers and pollen after staining. Figure 4 .
[0109] The statistical results of the proportion of fertile pollen and the proportion of sterile pollen are shown in [the table]. Figure 5 (Average value of 10 plants).
[0110] The mature pollen of the offspring of the wild-type plant was stained dark due to being full of starch and other metabolites, and the pollen grains were round. In the offspring of the osgrp1 mutant, over 70% of the pollen failed to stain dark, indicating abnormal pollen development. The results show that pollen development in the offspring of the osgrp1 mutant is affected; compared to the wild-type plant, the pollen fertility of the offspring of the osgrp1 mutant is significantly reduced.
[0111] 3. Analysis of rice panicle phenotype and seed setting rate
[0112] See photos of mature rice ears Figure 6 .
[0113] The statistical results of the proportion of filled seeds and empty seeds in mature rice panicles are shown in the figure. Figure 7 (Average value of 10 plants).
[0114] Compared with wild-type plants, the offspring of the osgrp1 mutant had a significantly lower seed setting rate (less than 30%).
[0115] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Knockout OsGRP1 The application of the gene in reducing rice plant height and / or reducing rice pollen fertility, the OsGRP1 The gene encodes the protein shown in SEQ ID NO:
1.
2. The application as described in claim 1, characterized in that: The OsGRP1 Genes are DNA molecules with coding regions as shown in SEQ ID NO:
2.
3. The application as described in claim 1, characterized in that: The OsGRP1 The gene is the DNA molecule shown in SEQ ID NO:
3.
4. The application as described in claim 1, characterized in that: The application uses CRISPR / Cas gene editing to induce frameshift mutations, thereby knocking out [the virus]. OsGRP1 Gene.
5. A method for breeding rice with reduced plant height and / or reduced pollen fertility, comprising the following steps: using homozygous mutations to introduce a homozygous mutation into the rice genomic DNA... OsGRP1 The gene segment "GCAGATCGCTGTGGACCGTGAGACGGGGAGGTCCCGCGGGTTCGGGTTCGTGAGCTTC" mutated to "GCAGATCGCTGTGGACCGTGAAGACGGGGAGGTCCCGCGGGTTCGGGTTCGTGAGCTTC"; OsGRP1 The gene encodes the protein shown in SEQ ID NO:
1.
6. A method for breeding rice with reduced plant height and / or reduced pollen fertility, comprising the following steps: inducing a frameshift mutation through CRISPR / Cas gene editing to knock out a gene in the recipient rice genome. OsGRP1 Genes were used to obtain rice with reduced plant height and / or reduced pollen fertility relative to the recipient rice; OsGRP1 The gene encodes the protein shown in SEQ ID NO:
1.
7. The method as described in claim 6, characterized in that: The OsGRP1 Genes are DNA molecules with coding regions as shown in SEQ ID NO:
2.
8. The method as described in claim 6, characterized in that: The OsGRP1 The gene is the DNA molecule shown in SEQ ID NO:3.
Citation Information
Patent Citations
Method for producing cold or freezing tolerant plants transformed with gene encoding osgrp1 protein from rice
KR1020110122659A