A method for modifying the sequence expressing human type III collagen α1 chain

Abstract

The present invention discloses a method for modifying a sequence expressing a human type III collagen α1 chain. The method is characterized in that the second or third amino acid in the Gly-X-Y glycine tripeptide of the selected human type III collagen α1 chain fragment sequence is mutated to proline (Pro) or tyrosine (Tyr) after the 10th to 16th amino acids, which can significantly reduce the degradation of collagen products by proteases, and the collagen produced by secretory expression of Pichia pastoris X33 has a high molecular weight. The ability of the third amino acid to resist protease degradation is stronger after the third amino acid is mutated to proline or tyrosine than after the second amino acid is mutated.

Description

Technical Field

[0001] The present invention relates to the technical field of methods for modifying human type III collagen, and in particular to a method for modifying a sequence for expressing human type III collagen α1 chain. Background Art

[0002] Collagen is a type of extracellular matrix protein. It is the most abundant in mammals, generally accounting for 25% to 30% of the total protein. Collagen is the main protein component of connective tissue and is also present in the interstitial tissue of almost all solid organs. It plays an important role in maintaining the integrity of cell structure and various physiological functions. Collagen has been widely used in the fields of medicine, beauty, health care and food. Collagen has good biodegradability, bioabsorbability, and extremely low antigenicity. It also has the function of hemostasis and cell growth promotion. These excellent properties have attracted more and more researchers to the attention of collagen. So far, more than 20 different types of collagen have been found in the human body. Almost all collagen contains repeated glycine tripeptide (i.e. Gly-XY) domains, which are the basis for collagen to form a triple helix structure.

[0003] According to the structure formed by collagen, it can be divided into several types, which are named type I collagen, type II collagen... XX, VII, XIX, XXI and other types of collagen. Among them, type III collagen is a fibroblast collagen with a high content in blood vessels. On the one hand, it can enhance the strength and elasticity of blood vessels, and on the other hand, it provides sufficient nutrition for cells. Type III collagen can also directly bind to angioblasts and form new blood vessels through the growth process. After entering the human body, type III collagen can be quickly absorbed by the human body to replenish the collagen that is gradually lost in the skin with age, so that the skin has elasticity, maintains sufficient moisture and can significantly reduce the crow's feet and forehead wrinkles of the skin. At present, type III collagen has been widely used as a skin filler in cosmetic surgery to treat wrinkles and skin aging. It can also be used as a rehabilitation aid for burn patients. It can also be used in bone reconstruction and various dental, plastic surgery and surgical operations to achieve artificial repair effects. In addition, the unique properties of type III collagen, such as permeability, hydrophilicity, and stable guidance and chemotaxis in the body, also give it significant advantages in bone transplantation, tissue regeneration, wound healing and other clinical treatments. Type III collagen can even be used as a food additive, mainly as a meat product improver, a food clarifier for beverages and alcoholic beverages, and a dairy product additive. Such additives can significantly delay food aging time and increase food softness and taste.

[0004] Industrially produced collagen has always been extracted from animal skin and bones by chemical and bioenzymatic methods, that is, the main source is animal connective tissue. However, collagen extracted from animal tissues has the risks of too low yield and purity, environmental pollution and animal-derived diseases, and large-scale collagen preparation will cause a run on animal breeding on the supply side. With the rapid development of genetic engineering technology in recent years, genetic engineering recombinant expression of collagen technology has become the main way to prepare and produce collagen, and has successfully solved the bottleneck of large-scale preparation of collagen. Collagen genes can be derived from any mammal, and after modification, they can be expressed in model organisms such as Escherichia coli, yeast and animal cells, and then the product is obtained after high-density fermentation. Recombinant collagen has the same characteristics as human collagen, and it also effectively avoids animal-derived diseases. At the same time, the production cycle is short, cost-saving, and can be quickly scaled up, which is suitable for industrial large-scale production. In recent years, there have been a large number of reports on recombinant collagen at home and abroad. Among them, the representative work is that Professor Fan Daidi of Northwest University used Escherichia coli and Pichia pastoris X33 to produce human-like collagen, and at the same time highly expressed proline hydroxylase in the cell, so that the production of recombinant collagen was stabilized at more than 20g / L (patents: CN1196712C; CN114539389B; CN 103725622A; CN 103725623A, etc.). Since the molecular weight of collagen expressed by Pichia pastoris X33 is relatively large, it will cause a certain expression burden on the Pichia pastoris X33 expression system, and there are multiple protease degradation sites in the recombinant collagen sequence, so the long-chain collagen finally obtained will be degraded, and the problem of protein degradation needs to be solved urgently during the fermentation production process. Some studies have reported that adding 15 g / L of casein amino acids during the induction expression process can competitively reduce the degradation of recombinant collagen (patent CN 202111190388.2);

[0005] There is also a method reported in a patent, that is, after 84 hours of methanol induction, adding 0.2-0.5ML lysine or 0.3LML arginine to the fermenter at one time can effectively prevent the target product from being degraded by proteases (patent CN201810049618.5). Although this method of adding additional amino acids can prevent the degradation of collagen to a certain extent, the addition of amino acids will increase the production cost and also increase the difficulty of product purification. The present invention provides a simple and effective method for secretory expression of recombinant human type III collagen α1 chain by Pichia pastoris X33 (Pichia pastoris X33), which can significantly reduce the degradation of collagen products by proteases, and the collagen produced by secretory expression of Pichia pastoris X33 (Pichiapastoris X33) has a high molecular weight. Summary of the invention

[0006] The invention mainly uses Pichia pastoris X33 as an expression host to secrete and express a modified sequence of human type III collagen α1 chain, wherein the modified sequence has the following characteristics: after the 10th to 16th amino acids in the sequence, the second or third amino acid in the Gly-XY glycine tripeptide is mutated to proline (Pro) or tyrosine (Tyr), wherein the ability of resisting protease degradation after the third amino acid is mutated to proline or tyrosine is stronger than that after the second amino acid is mutated.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A method for modifying a sequence expressing human type III collagen α1 chain, comprising the following steps:

[0009] S1. Select appropriate host bacteria and appropriate collagen gene fragments;

[0010] S2, cloning gene fragments COL3A2 and COL3A2M by PCR technology;

[0011] S3. Preparation of Pichia pastoris X33 competent cells;

[0012] Furthermore, the host bacteria is preferably Pichia pastoris X33, and the collagen gene fragment COL3A is preferably selected from human type III collagen αⅠ chain (NCBI sequence number: NM_000090.4), which is derived from a partial continuous gene at the human C-terminus, and its sequence is located at nucleotides 2701 to 3420 of the human type III collagen α1 chain gene sequence. After removing N segments of 36 nucleotides from this sequence, it is repeatedly connected after the first segment to form the collagen gene fragment COL3A2.

[0013] Furthermore, the sequence was synthesized after codon optimization by Pichia pastoris X33, and the corresponding gene sequence was SEQ ID NO.1, and its amino acid sequence was shown in SEQ ID NO: 2. The second or third amino acid in the Gly-XY glycine tripeptide at positions 26 to 97 was mutated to proline (Pro) or tyrosine (Tyr), and the amino acid sequence was obtained as shown in SEQ ID NO: 3. The formed collagen gene fragment was named COL3A2M, and its corresponding gene fragment nucleotide sequence was shown in SEQ ID NO: 4.

[0014] Furthermore, the cloning aspects in step S2 include:

[0015] S2-1. The expression vector pPICZαA of Pichia pastoris X33 was amplified by PCR with primers pPICZαA-F / R (SEQ ID NO: 6) to obtain a vector connection fragment, and the cloned gene fragments COL3A2 and COL3A2M and the pPICZαA vector fragment were mixed at a concentration ratio of 3:1;

[0016] S2-2, using Gibson Assembly seamless ligation technology to connect the two fragments at the EcoRI site of the vector pPICZαA, and sequentially connect to construct recombinant plasmids pPICZαA-A2 and pPICZαA-A2M;

[0017] S2-3. The reaction conditions are as follows: incubate in a 50°C water bath or metal bath for 30 minutes and then cool on ice; then use the 42°C heat shock method to transform E. coli T1 competent cells, pick the positive clones grown on the kanamycin-containing plate after overnight culture, inoculate the clones in a 3mL test tube at 30°C, 220rpm overnight, extract the plasmid and send it to a sequencing company for sequencing to verify whether the recombinant gene is consistent with the design.

[0018] Furthermore, the competent cell preparation in step S3 includes:

[0019] S3-1, 1 μg of linearized plasmids pPICZαA-A2 and pPICZαA-A2M were mixed with Pichia pastoris X33 competent cells in a total volume of 100 μL, and electroporation was performed to transform the recombinant plasmids into the competent cells;

[0020] S3-2. The transformed strain is placed in a 30°C constant temperature incubator and cultured upside down for 2 to 4 days until a single colony appears. A single colony is picked to extract the genome for PCR and sent to a sequencing company for sequencing verification;

[0021] S3-3. Perform pressure screening on the verified recombinants, i.e., screen them at a G418 concentration range of 100 μg / mL to 1 mg / mL 48 hours after inoculation, and select the recombinant strains that can grow clones for seed preservation;

[0022] S3-4. Pick a verified recombinant single colony and add it to 5 mL YPD liquid culture medium. Culture it overnight at 30°C and 200 rpm for activation.

[0023] S3-5, inoculate 100 mL of BMGY liquid medium with an inoculum of 1%, and culture at 30°C, 200 rpm until OD600 = 3.0-6.0; collect the bacteria by centrifugation at 25°C for 6 min, and suspend them in 200 mL of BMMY liquid medium to an initial concentration of OD600 = 1.0, and culture at 30°C, 200 rpm, and add methanol at a final concentration of 0.5-1.0% every 24 hours to induce expression;

[0024] S3-6. After 72 hours of induction, the culture medium was centrifuged at 12,000 rpm for 2 minutes, and the supernatant was used to verify the protein expression by SDS-PAGE experiment.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides a simple and effective method for obtaining recombinant human type III collagen α1 chain secreted and expressed by Pichia pastoris X33. The method is characterized in that the second or third amino acid in the Gly-XY glycine tripeptide is mutated to proline (Pro) or tyrosine (Tyr) after the 10th to 16th amino acids of the selected human type III collagen α1 chain fragment sequence, so that the degradation of collagen products by proteases can be significantly reduced, and the collagen produced by secretory expression of Pichia pastoris X33 has a higher molecular weight. The ability of the third amino acid to resist protease degradation is stronger after the third amino acid is mutated to proline or tyrosine than after the second amino acid is mutated. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the construction of the recombinant plasmids pPICZαA-A2 and pPICZαA-A2M proposed in the present invention;

[0028] Figure 2 The collagen electrophoresis results proposed in the present invention. M, marker; 1-3, COL3A2; 4-5, schematic diagram of COL3A2M

[0029] Figure 3 This is the result of collagen electrophoresis proposed in the present invention. M, marker; 1-3, COL3A2; 2-3, COL3A2M-2; 5, schematic diagram of COL3A2M. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0031] In the description of the present invention, it is necessary to understand that the terms "upper", "lower", "front", "back", "left", "right", "top", "bottom", "inside", "outside", etc., indicating the orientation or position relationship are based on the orientation or position relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention.

[0032] like Figure 1-3 As shown, the host bacteria of the present invention is preferably Pichia pastoris X33, and the collagen gene fragment COL3A is preferably selected from human type III collagen αⅠ chain (NCBI sequence number: NM_000090.4), which is derived from a part of the continuous gene at the C-terminus of human, and its sequence is located at nucleotides 2701 to 3420 of the human type III collagen α1 chain gene sequence. After removing N segments of 36 nucleotides from this segment, the segment is repeatedly connected to the first segment to form the collagen gene fragment COL3A2;

[0033] The preferred sequence was synthesized after being encoded by Pichia pastoris X33 and codon optimized. The corresponding gene sequence is SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO:2;

[0034] SEQ ID NO.2

[0035]

[0036] The third amino acid in the Gly-XY glycine tripeptide at positions 26 to 97 is mutated to proline (Pro) or tyrosine (Tyr) to obtain the amino acid sequence shown in SEQ ID NO: 3:

[0037] SEQ ID NO.3

[0038]

[0039] The formed collagen gene fragment is named COL3A2M, and the corresponding gene fragment nucleotide sequence is shown in SEQ ID NO:4:

[0040] SEQ ID NO.4

[0041]

[0042] In addition, in order to compare the effects of mutations in the second and third amino acids in the Gly-XY glycine tripeptide, a collagen gene fragment with mutations in the second amino acid was designed and named COL3A2M-2, whose amino acid sequence is shown in SEQ ID NO:7:

[0043] SEQ ID NO.7

[0044]

[0045]

[0046] The corresponding nucleotide fragment is shown in SEQ ID NO:8:

[0047] SEQ ID NO.8

[0048]

[0049] The gene fragments COL3A2, COL3A2M and COL3A2M-2 were all sent to General Bio (Anhui) Synthesis Company for full sequence synthesis.

[0050] Further, PCR was used with primers COL3A2-F / R (SEQ ID NO: 5, the amino acid sequence of which is shown below:

[0051] SEQ ID NO.5

[0052] COL3A2-F:gaaaagagaggctgaagctgGGCAAGGATG GGCCCCCA

[0053] COL3A2-R: GCCTGCAGGTCCTGGACTGacggccggctgggccacgtgaatt)

[0054] The synthesized gene fragments COL3A2, COL3A2M and COL3A2M-2 were cloned; primers pPICZαA-F / R (SEQ ID NO: 6, the amino acid sequence of which is shown below:

[0055] SEQ ID NO.6

[0056] pPICZαA-F:aattcacgtggcccagccggc

[0057] pPICZαA-R:cagcttcagcctctcttttctcgagagataccc)

[0058] The expression vector pPICZαA of Pichia pastoris X33 was amplified to obtain the vector connection fragment, and the cloned gene fragments COL3A2, COL3A2M and COL3A2M-2 and the pPICZαA vector fragment were mixed at a concentration ratio of 3:1; the two fragments were sequentially connected using the Gibson Assembly seamless connection technology to construct the recombinant plasmids pPICZαA-A2, pPICZαA-A2M and pPICZαA-A2M-2;

[0059] The reaction conditions are as follows: incubate in a 50°C water bath or metal bath for 30 minutes and then cool on ice; then use the 42°C heat shock method to transform E. coli T1 competent cells, pick the positive clones grown on the kanamycin-containing plate after overnight culture, inoculate the clones in a 3mL test tube at 30°C, 220rpm overnight, extract the plasmid and send it to a sequencing company for sequencing to verify whether the recombinant gene is consistent with the design.

[0060] Prepare Pichia pastoris X33 competent cells. Pick a single colony of Pichia pastoris X33 on a YPD (1% yeast extract, 2% peptone, 2% glucose) plate, inoculate it into a test tube containing YPD liquid culture medium, and culture it at 30°C, 220rpm, and shake overnight; take 500 μL of the culture solution and inoculate it into a triangular flask containing 50 mL of fresh YPD culture medium, and culture it until OD 600 =1.2. The above culture was transferred into a sterile centrifuge tube, centrifuged at 6000 rpm at 4°C for 10 min, and the supernatant was removed;

[0061] The above bacteria were resuspended in 20 mL of LiAc solution (100 mM LiAc, 10 mM DTT, 0.6 M sorbitol, 10 mM Tris-HCl, pH 7.5), cultured on a shaking platform at 30 °C for 30 min, centrifuged and the supernatant removed;

[0062] 1 μg of linearized plasmids pPICZαA-A2 and pPICZαA-A2M were mixed with Pichia pastoris X33 competent cells in a total volume of 100 μL, transferred to a 0.2 cm pre-cooled electroporation cuvette, and placed on ice for 5-10 min;

[0063] According to the electroporation parameters: electroporation voltage 1.5kV, capacitance 25μF, resistance 200Ω, electroporation time 5msec. Immediately after the electroporation, add 1mL of pre-cooled 1M sorbitol solution into the electroporation cup, gently blow and mix, and quickly transfer to a 1.5mL centrifuge tube, and incubate at 30℃, 220rpm for 1-2h.

[0064] Take 200μL of bacteria and spread it on a YPD plate with a final concentration of 100μg / mL G418. Place it in a 30℃ constant temperature incubator and culture it upside down for 2-4 days until a single colony appears. Pick a single colony to extract the genome for PCR and send it to a sequencing company for sequencing verification. The verified recombinants are subjected to pressure screening, that is, 48h after inoculation, they are screened in the G418 concentration range of 100μg / mL to 1mg / mL and the culture medium is replaced every 3 days, keeping the G418 concentration unchanged, and the recombinant strains that can grow clones are picked out for seed preservation.

[0065] Pick a verified recombinant single colony and add it to 5 mL YPD liquid medium, and culture it at 30°C, 200 rpm overnight for activation; inoculate it into 100 mL BMGY liquid medium at a 1% inoculum, and culture it at 30°C, 200 rpm until OD600 = 3.0-6.0; collect the bacteria by centrifugation at 25°C for 6 min, and suspend it in 200 mL BMMY liquid medium to make its initial concentration be OD 600 =1.0, cultured at 30°C, 200rpm; added methanol with a final concentration of 0.5-1.0% every 24h to induce expression; after induction for 72h, the culture medium was centrifuged at 12000rpm for 2min, and the supernatant was taken to verify the protein expression by SDS-PAGE experiment.

[0066] The experimental results are shown in Figure 2:The molecular weight of the mutated collagen COL3A2M is basically the same as that of the unmutated protein COL3A2, both of which are 25.1kD. From the results of SDS-PAGE protein electrophoresis, it can be seen that the molecular weight of the original collagen COL3A2 without mutation is about 30kD, which is larger than the 25.1kD predicted by bioinformatics. The molecular weight of the mutated collagen COL3A2M is about 32-35kD, which is also larger than the predicted value. It is speculated that the reason may be due to the glycosylation modification of yeast cells. In addition, the molecular weight of the mutated collagen COL3A2M is greater than that of the unmutated protein COL3A2, which is probably because the mutant is less affected by protease degradation.

[0067] In addition, the experiment also found that Figure 3 As shown, lane 1 is the collagen with the original sequence; lanes 2 to 3 are collagen with mutations in the second amino acid; lane 5 is collagen with mutations in the third amino acid. The results show that in the Gly-XY glycine tripeptide at positions 26 to 97 of the original collagen fragment, the ability to resist protease degradation is stronger after the third amino acid mutates to proline or tyrosine than after the second amino acid mutates.

[0068] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for modifying a sequence expressing human type III collagen α1 chain, comprising the following steps: S1. Select appropriate host bacteria and appropriate collagen gene fragments; S2, clone the gene fragment COL3A2M by PCR technology; S3, preparing Pichiapastoris X33 competent cells; The third amino acid in the Gly-XY glycine tripeptide at positions 26 to 97 in the amino acid sequence SEQ ID NO:2 was mutated to proline or tyrosine to obtain the amino acid sequence SEQ ID NO:3, the corresponding gene fragment was named COL3A2M, and the corresponding gene fragment nucleotide sequence was shown in SEQ ID NO:

4.

2. According to the method for modifying the sequence expressing human type III collagen α1 chain according to claim 1, the cloning in step S2 comprises: S2-1, the cloned gene fragment COL3A2M and the pPICZαA vector fragment were mixed at a concentration ratio of 3:1; S2-2, using Gibson Assembly seamless ligation technology to connect the gene fragment COL3A2M at the EcoRI site of the vector pPICZαA to construct the recombinant plasmid pPICZαA-A2M; S2-3. The reaction conditions are as follows: incubate in a 50°C water bath or metal bath for 30 minutes and then cool on ice; then use the 42°C heat shock method to transform E. coli T1 competent cells, pick the positive clones grown on the kanamycin-containing plate after overnight culture, inoculate the clones in a 3mL test tube at 30°C, 220rpm overnight, extract the plasmid and send it to a sequencing company for sequencing to verify whether the recombinant gene is consistent with the design.

3. According to the method for modifying the sequence expressing human type III collagen α1 chain according to claim 1, the competent cell preparation in step S3 comprises: S3-1, mix 1 μg of linearized plasmid pPICZαA-A2M with Pichiapastoris X33 competent cells in a total volume of 100 μL, and transform the recombinant plasmid into the competent cells by electroporation; S3-2. The transformed strain is placed in a 30°C constant temperature incubator and cultured upside down for 2 to 4 days until a single colony appears. A single colony is picked to extract the genome for PCR and sent to a sequencing company for sequencing verification; S3-3. Perform pressure screening on the verified recombinants, i.e., screen them at a G418 concentration range of 100 μg / mL to 1 mg / mL 48 hours after inoculation, and select the recombinant strains that can grow clones for seed preservation; S3-4, pick a verified recombinant single colony and add it to 5 mL YPD liquid culture medium, and culture it overnight at 30°C and 200 rpm for activation; S3-5, inoculate 100 mL of BMGY liquid medium with an inoculum of 1%, and culture at 30°C, 200 rpm until OD600 = 3.0-6.0; collect the bacteria by centrifugation at 25°C for 6 min, and suspend them in 200 mL of BMMY liquid medium to an initial concentration of OD600 = 1.0, and culture at 30°C, 200 rpm, and add methanol at a final concentration of 0.5-1.0% every 24 hours to induce expression; S3-6. After 72 hours of induction, the culture medium was centrifuged at 12,000 rpm for 2 minutes, and the supernatant was used to verify the protein expression by SDS-PAGE experiment.

Images