SSR molecular marker primers, kit and application for rapid identification of fresh betel nut fruit shape

Abstract

The present invention provides SSR molecular marker primers for quickly identifying the shape of fresh betel nut fruits, belonging to the field of biotechnology. The primers include SSR‑2‑F and SSR‑2‑R, the nucleotide sequence of SSR‑2‑F is shown in SEQ ID NO.1, and the nucleotide sequence of SSR‑2‑R is shown in SEQ ID NO.2. The SSR molecular marker primers have high specificity for identifying the shape of fresh betel nut fruits. The betel nut genome is PCR amplified using the SSR molecular marker primers, and the amplified product is subjected to gel electrophoresis. The shape of fresh betel nut fruits can be identified based on the obtained gel electrophoresis map. The SSR molecular marker primers are used to identify the shape of fresh betel nut fruits, which has the characteristics of easy operation, high identification efficiency and reliable results, and has great potential application value. The present invention also provides a kit and application for quickly identifying the shape of fresh betel nut fruits.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to SSR molecular marker primers, a kit and applications for rapidly identifying the shape of fresh betel nut fruits. Background Art

[0002] As the first of the four major southern medicines in China, betel nut has high medicinal and edible value. Fruit is an important economic organ of fruit trees, and its distinctive appearance characteristics can directly affect the commercial value and economic benefits of fleshy fruits. Betel nut is the main edible part of betel nut. Its fresh fruit is a drupe, which is oval, spherical or cylindrical, with a thick peel and fibrous flesh. People like to chew it when it is fresh. The formation of betel nut shape is controlled by many factors, and gene regulation is an important part of it.

[0003] Fruit traits are important commercial quality characteristics of drupe trees and are also the main traits for genetic improvement. The morphology of fresh betel nut fruit has an important impact on the betel nut drying process and consumers' choice of dried betel nut. In addition, it is also extremely important for people in the market to choose fresh fruit. However, there is no scientific and rigorous screening standard for the selection of fresh betel nut fruit. Most of them are simply screened based on the single fruit quality of fresh betel nut fruit or even sensory judgment. This screening method has caused a lot of inefficient production and resource waste in the current betel nut planting and green fruit production. Therefore, there is an urgent need for a method to judge the fruit shape of fresh betel nut by the expression of differential genes. Summary of the invention

[0004] In order to solve the problem of low efficiency of the existing method for screening the shape of fresh betel nut fruits, the present invention provides SSR molecular marker primers for quickly identifying the shape of fresh betel nut fruits. The SSR molecular marker primers have high specificity for identifying the shape of fresh betel nut fruits. The betel nut genome is amplified by PCR using the SSR molecular marker primers, and the amplified products are subjected to gel electrophoresis. The shape of fresh betel nut fruits can be identified according to the obtained gel electrophoresis pattern. The SSR molecular marker primers are used to identify the shape of fresh betel nut fruits. The method has the characteristics of easy operation, high identification efficiency and reliable results, and has great potential application value.

[0005] The present invention also provides a kit for quickly identifying the shape of fresh betel nut fruits and its application.

[0006] The present invention is achieved through the following technical solutions:

[0007] The invention provides SSR molecular marker primers for rapidly identifying the shape of fresh betel nut fruits. The primers include SSR-2-F and SSR-2-R. The nucleotide sequence of the SSR-2-F is shown in SEQ ID NO.1, and the nucleotide sequence of the SSR-2-R is shown in SEQ ID NO.2.

[0008] Based on the same inventive concept, the present invention provides the application of SSR molecular marker primers for rapidly identifying the shape of fresh betel nut fruits in identifying the shape of fresh betel nut fruits.

[0009] Based on the same inventive concept, the present invention provides a kit for quickly identifying the shape of fresh betel nut fruit, the kit comprising primers SSR-2-F and SSR-2-R, the nucleotide sequence of SSR-2-F is shown in SEQ ID NO.1, and the nucleotide sequence of SSR-2-R is shown in SEQ ID NO.2.

[0010] Based on the same inventive concept, the present invention also provides a kit for quickly identifying the shape of fresh betel nut fruits and its application in identifying the shape of fresh betel nut fruits.

[0011] Furthermore, the shapes of the fresh betel nut fruits include spherical, oval and cylindrical.

[0012] Based on the same inventive concept, the present invention also provides a method for quickly identifying the shape of fresh betel nut fruit, the method comprising:

[0013] Using SSR-2-F and SSR-2-R as primers, PCR amplification was performed on the genomic DNA of the betel nut samples to be tested;

[0014] Perform gel electrophoresis on the PCR amplification product to obtain a gel electrophoresis pattern;

[0015] Identify the fresh fruit shape of the betel nut sample to be tested according to the gel electrophoresis pattern;

[0016] The nucleotide sequence of SSR-2-F is shown in SEQ ID NO.1, and the nucleotide sequence of SSR-2-R is shown in SEQ ID NO.2.

[0017] Furthermore, the betel nut sample to be tested includes betel nut leaves.

[0018] Further, the identifying the fresh fruit shape of the betel nut sample to be tested according to the gel electrophoresis pattern specifically includes:

[0019] If in the gel electrophoresis pattern, there is a band at 200bp-300bp and another band at 1000bp-1500bp, the fresh fruit shape of the betel nut sample to be tested is cylindrical;

[0020] If there is only one band at 200bp-300bp in the gel electrophoresis pattern, the fresh fruit shape of the betel nut sample to be tested is oval or spherical.

[0021] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0022] 1. The present invention is used for the SSR molecular marker primers for rapidly identifying the shape of fresh betel nut fruits. The detection primers for identifying the shape of fresh betel nut fruits are obtained by using different designs of simple base repeat sequences of different fruit shapes. The SSR molecular marker primers have high specificity for identifying the shape of fresh betel nut fruits. Only a normal betel nut sample needs to be provided, and the betel nut genome is amplified by ordinary PCR using the SSR molecular marker primers. The amplified product is subjected to gel electrophoresis, and the shape of fresh betel nut fruits can be identified according to the obtained gel electrophoresis pattern. The SSR molecular marker primers are used to identify the shape of fresh betel nut fruits. The method has the characteristics of easy operation, high identification efficiency and reliable results, and has great potential application value.

[0023] 2. The present invention provides an application of the SSR molecular marker primers for rapidly identifying the shape of fresh betel nut fruits in identifying the shape of fresh betel nut fruits. The SSR molecular marker technology is used to utilize the differential expression of simple base repeat sequences of different betel nut fruit shapes to judge the green fruits of different shapes of betel nut. The SSR molecular marker primers developed by the present invention only require providing samples and conducting PCR detection according to the provided method to determine the shape of immature fresh betel nut fruits, thereby providing a basis for subsequent screening of betel nut fruits of different shapes and improving economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0025] Figure 1 The present invention is a flow chart of the screening method of SSR molecular marker primers.

[0026] Figure 2 The shapes of fresh betel nut fruits are spherical, oval and cylindrical.

[0027] Figure 3 The following are the gel electrophoresis patterns corresponding to the three shapes of fresh betel nut fruits: spherical, oval and cylindrical. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0029] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0030] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0031] The overall idea of ​​the present invention is as follows:

[0032] At present, there is no scientific and rigorous screening standard for the screening of fresh betel nut fruit shape. Most of them are screened based on the single fruit quality or even sensory judgment of fresh betel nut fruit. This screening method has caused a lot of inefficient production and resource waste in the current betel nut planting and green fruit production. There is no detailed method for distinguishing the shape of fresh betel nut fruit at the molecular level in the existing screening technology. Most of them judge the shape of fresh betel nut fruit by personal senses. There is no report on the method of judging and screening fresh betel nut fruit by molecular markers.

[0033] Simple sequence repeat markers (SSR) were amplified into the human genome SSR sequence by Litt and Luty in 1989, and this sequence was formally defined as a microsatellite. Its principle is to design primers through complementary sequences at both ends of the microsatellite sequence, amplify the microsatellite fragment through PCR reaction, and finally amplify PCR products of different lengths by PCR method according to the different numbers of tandem repeats of the core sequence. The amplified products are subjected to gel electrophoresis, and the genotype is determined according to the size of the separated fragments and the allele frequency is calculated. At present, simple sequence repeat markers (SSR) are widely used in the fields of biological genetic diversity research, plant variety identification, kinship analysis and molecular marker assistance.

[0034] Based on this, the inventors of the present application went to different betel nut planting sites and harvested a large number of immature fresh betel nut fruits and leaves of different shapes. Afterwards, they used SSR software to analyze and design primers based on the genetic differences of betel nut fruits of different shapes. They then used artificially synthesized primers to perform PCR amplification and run gel electrophoresis on the amplified products. By comparing the fresh betel nut fruits of different shapes with the positions and sizes of the bands, they finally obtained a pair of primers SSR-2-F and SSR-2-R, and used them as SSR molecular marker primers for identifying the shape of fresh betel nut fruits.

[0035] The method of using primers SSR-2-F and SSR-2-R to identify the shape of fresh betel nut fruit is as follows:

[0036] The genomic DNA of the betel nut sample to be tested is extracted using the Tiangen quick plant genomic DNA extraction system kit, the DNA concentration detection method in the kit is used to measure the extracted DNA concentration by an ultra-micro spectrophotometer, the extracted DNA is subjected to PCR amplification reaction with primers SSR-2-F and SSR-2-R, and the obtained amplification product is subjected to gel electrophoresis; according to the gel electrophoresis diagram and the difference in the simple base repeat sequence of different fruit shapes, it is determined that the primers SSR-2-F and SSR-2-R can clearly distinguish between columnar fruits and ovoid and spherical fruits, and have specificity. The present invention utilizes the high variation in the number of microsatellite repeat units of different fruit shapes of betel nut to cause the polymorphism of multiple sites, and according to the different trend changes in the expression amount of differential genes in different treatments, the detection primers SSR-2-F and SSR-2-R for identifying the fruit shape of fresh betel nut are obtained. The primers have high specificity for identifying the fruit shape of fresh betel nut, and have the characteristics of strong specificity, easy operation, high polymorphism, high repeatability, high information content and reliable results, and have great potential application value. The SSR molecular marker primers developed by the present invention can determine the shape of immature fresh betel nut fruits by simply providing samples and performing detection according to the provided method, thereby providing a basis for subsequent screening of fruits of different shapes to improve economic benefits.

[0037] The following will describe in detail the SSR molecular marker primers, kit and application of the present application for rapid identification of the shape of fresh betel nut fruit in combination with the examples and experimental data.

[0038] Example 1

[0039] The present embodiment is used for the screening method of the primer SSR2 of the SSR molecular marker for rapid identification of the fruit shape of fresh betel nut, such as Figure 1 As shown, the following steps are included:

[0040] S101, 135 disease-free young leaves of betel nut were collected from the betel nut plantation, of which 123 were from Hainan Province, China, and 12 were from Vietnam. There was no obvious differentiation in the population of each young leaf of betel nut. The plants grew well, had high yield, high fruit setting rate, and tender green leaves.

[0041] S102, sample collection: young betel nut leaves and fresh betel nut fruits were picked in the same period of time, and betel nuts of different fruit shapes were classified and photographed. The picked samples were wiped clean with 75% ethanol, frozen in liquid nitrogen and stored at -80℃ to facilitate the preservation of samples and the extraction of betel nut leaf DNA. The genomic DNA of the samples was extracted using the Tiangen Rapid Plant Genomic DNA Extraction System Kit and stored at -20℃.

[0042] S103, SSR primer design: Based on the existing VCF file of the total betel nut gene variation sites, SSR primers were designed using MISA combined with Primer5 for PCR amplification. The 50 pairs of primers were simply named SSR-1 and SSR3-50.

[0043] Specifically, the primers designed using SSR software include:

[0044] The designed result file data.fasta.misa: can be opened with any text editor, such as Excel, NotePad++, etc. It is an important file for displaying the processing results, including ID: gene ID; SSR nr.: SSR number; SSRtype: SSR type, p1 represents one base repeated, p2 is two, c represents complex; SSR: A (31) represents A repeated 31 times; size: size; start / end: ​​starting site; data.statistics: related statistical items based on sequence and analysis; reslut.xls: completed primer design and related indicators.

[0045] S104, primer specificity verification, PCR amplification of DNA of different betel nut fruit shapes using different SSR primers: PCR amplification of DNA of different varieties of each betel nut fruit shape with the same primer, and gel electrophoresis of PCR amplification products to check the position and number of bands in the electrophoresis graph. The sizes of the target bands are 200bp-300bp and 1000bp-1500bp, respectively.

[0046] Specifically, the primer specificity verification includes: using DNA extracted from disease-free young betel nut leaves as a template, performing PCR amplification with different primers, and comparing the position and number of amplified bands in the gel electrophoresis pattern with the bp size of the primers designed by the SSR software to verify the specificity of the primers.

[0047] After screening, the primer SSR2 with high specificity for identifying the fresh fruit shape of betel nut was obtained, as follows:

[0048] SSR-2-F:GAGAAGAGGGGAAGGGAGAA

[0049] SSR-2-R:TCTTCCTGGCGGTGATCTAT

[0050] The two single-stranded DNAs in the primer pair can be packaged separately into one tube as the upstream primer F or the downstream primer R, or mixed and packaged in equimolar amounts.

[0051] The primers designed by SSR software in this embodiment are as follows:

[0052]

[0053]

[0054]

[0055] The sources of 135 betel nut germplasms in this embodiment are as follows:

[0056]

[0057]

[0058]

[0059]

[0060]

[0061] Example 2

[0062] This example further verifies SSR-2, specifically including:

[0063] (1) Using SSR-2-F and SSR-2-R as primers, PCR amplification was performed on the genomic DNA of betel nut leaf samples with fresh fruit shapes of spherical, ovoid and cylindrical. Five accessions were selected for each fruit shape. Figure 2 , the PCR reaction system is as follows:

[0064] Total reaction system 20 μL:

[0065] 2*Rapid Taq Master Mix:10μL;

[0066] SSR-F: 0.5 μL;

[0067] SSR-R: 0.5 μL;

[0068] DNA: 1 μL;

[0069] ddH2O: 8μL;

[0070] PCR reaction program: 94° pre-deformation for 10 min; 94° denaturation for 30 s, 55° annealing for 30 s, 72° extension for 90 s, for a total of 35 cycles; 72° extension for 10 min.

[0071] (2) The PCR amplification product was detected by electrophoresis on a 1.5% agarose gel to obtain a gel electrophoresis pattern (such as Figure 3 ).

[0072] Figure 2Among them, S105 is the oval fresh fruit of betel nut, S106 is the spherical fresh fruit of betel nut, and S107 is the columnar fresh fruit of betel nut.

[0073] In this example, PCR amplification was performed using leaf DNA from 5 oval, 5 cylindrical, and 5 spherical fresh betel nut fruits as templates. The resulting gel electrophoresis pattern is shown in the figure below. Figure 3 As shown, including:

[0074] M, DL2000 Plus DNAMarker;

[0075] Lanes 1-5, respectively, are Ledong Li Jianfengling oval B7, Ledong Li Jianfengling oval B8, Ledong Li Jianfengling oval B9, Ledong Li Jianfengling, Ledong Li Jianfengling oval B10, Ledong Li Jianfengling oval B11;

[0076] Lanes 6-10, respectively, are Ledong Li Jianfengling spherical shape Y19, Ledong Li Jianfengling spherical shape Y21, Ledong Li Jianfengling spherical shape Y22, Ledong Li Jianfengling spherical shape Y20, Ledong Li Jianfengling spherical shape Y13;

[0077] Lanes 11-15 are respectively Ledong Li Jianfengling column C7, Ledong Li Jianfengling column C8, Ledong Li Jianfengling column C9, Ledong Li Jianfengling column C10, Ledong Li Jianfengling column C11 Ledong Li Jianfengling.

[0078] from Figure 3 It can be seen that lanes 1-10 have bright bands at 200bp-300bp, lanes 11-15 have bands at 200bp-300bp, and there is another band at 1000bp-1500bp. That is, SSR2 is used as a primer to perform PCR amplification on the DNA of the sample to be tested, and the amplified product is subjected to gel electrophoresis. According to the number and position of the bands in the electrophoresis diagram, there are two bands, and the positions are respectively 200bp-300bp and 1000bp-1500bp, which indicates that the fruit shape is columnar fruit, and the fruit shape with only a single band is egg-shaped or spherical fruit.

[0079] In summary, the present invention can use SSR-2 as a primer to PCR amplify the betel nut genomic DNA to be tested, and identify the fresh fruit shape of the betel nut sample to be tested according to the gel electrophoresis pattern: if there is a band in the gel electrophoresis pattern and the band position is at 200bp-300bp, the fresh fruit shape of the betel nut sample to be tested is oval or spherical; if there are two bands in the gel electrophoresis pattern, and the positions are respectively at 200bp-300bp and 1000bp-1500bp, the fresh fruit shape of the betel nut sample to be tested is columnar.

[0080] The DNA extraction method and reagents used in the present invention can be replaced after confirming the principle.

[0081] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0082] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0083] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An SSR molecular marker primer for rapid identification of fresh betel nut fruit shape, characterized in that: The primers include SSR-2-F and SSR-2-R, the nucleotide sequence of SSR-2-F is shown as SEQ ID NO.1, and the nucleotide sequence of SSR-2-R is shown as SEQ ID NO.

2.

2. Application of the SSR molecular marker primer for rapid identification of the shape of fresh betel nut fruit as claimed in claim 1 in identifying the shape of fresh betel nut fruit.

3. A kit for quickly identifying the shape of fresh betel nut fruit, characterized in that: The kit comprises primers SSR-2-F and SSR-2-R, the nucleotide sequence of SSR-2-F is shown as SEQ ID NO.1, and the nucleotide sequence of SSR-2-R is shown as SEQ ID NO.

2.

4. The application of the test kit for rapid identification of fresh betel nut fruit shape as claimed in claim 3 in identifying fresh betel nut fruit shape.

5. The use according to claim 4, characterized in that: The shapes of the fresh betel nut fruit include spherical, oval and columnar.

6. A method for quickly identifying the shape of fresh betel nut fruit, characterized in that: The method comprises: Using SSR-2-F and SSR-2-R as primers, PCR amplification was performed on the genomic DNA of the betel nut samples to be tested; Perform gel electrophoresis on the PCR amplification product to obtain a gel electrophoresis pattern; Identify the fresh fruit shape of the betel nut sample to be tested according to the gel electrophoresis pattern; The nucleotide sequence of SSR-2-F is shown in SEQ ID NO.1, and the nucleotide sequence of SSR-2-R is shown in SEQ ID NO.

2.

7. A method for quickly identifying the shape of fresh betel nut fruits according to claim 6, characterized in that: The betel nut sample to be tested includes betel nut leaves.

8. A method for rapidly identifying the shape of fresh betel nut fruits according to claim 6, characterized in that: The step of identifying the fresh fruit shape of the betel nut sample to be tested according to the gel electrophoresis pattern specifically comprises: If in the gel electrophoresis pattern, there is a band at 200bp-300bp and another band at 1000bp-1500bp, the fresh fruit shape of the betel nut sample to be tested is cylindrical; If there is only one band at 200bp-300bp in the gel electrophoresis pattern, the fresh fruit shape of the betel nut sample to be tested is oval or spherical.

Images