A fermented mucus lactobacillus for alleviating hyperuricemia by simultaneously degrading uric acid and purine nucleosides and its application

Abstract

The present invention discloses a fermented mucus bacillus and its application for relieving hyperuricemia by simultaneously degrading uric acid and purine nucleosides, and belongs to the field of microbial technology. The fermented mucus lactobacillus GR-X (CCTCC NO: M 20231857) of the present invention can degrade uric acid and purine nucleosides, can be colonized in the intestinal tract to reduce the absorption of uric acid and purine nucleosides by the intestinal tract, reduce the serum uric acid, creatinine and urea nitrogen levels of hyperuricemia mice, reduce the liver and kidney damage of mice caused by hyperuricemia, and add yogurt made by fermented mucus lactobacillus GR-X to degrade intestinal uric acid, reduce the serum uric acid, creatinine and urea nitrogen levels of gout patients, promote uric acid to be discharged through urine, reduce the levels of TNF-α and IL-6 in serum, and effectively colonize in the intestinal tract at the same time. The present invention has broad application prospects in the field of functional bacterial agents, foods and medicines for relieving and / or treating hyperuricemia and gout.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a fermented mucus lactobacillus capable of alleviating hyperuricemia by simultaneously degrading uric acid and purine nucleosides and an application thereof. Background Art

[0002] Hyperuricemia (HUA) refers to a disease in which the level of uric acid in the blood exceeds the normal value. Since the sources of purine in the human body are divided into endogenous nucleic acid decomposition and exogenous food intake, when the human body's purine metabolism is disordered or too much high-purine food is consumed, excessive uric acid production and / or insufficient excretion may cause abnormal increase in serum uric acid levels or lead to HUA. Excessive uric acid forms crystal deposits, which may lead to the occurrence of gout. It is reported that the prevalence of HUA in China is 13.3%, and the overall prevalence of gout is 1.1%, and it is gradually showing a trend of younger age. At present, the means of treating HUA include drugs, dietary intervention and biological therapy. Drugs mainly reduce the conversion of purine to uric acid by reducing the activity of liver xanthine oxidase (XOD), or regulate uric acid transporters in the kidneys and intestines to inhibit uric acid reabsorption. However, drugs may cause hypersensitivity reactions, cardiovascular side effects, hepatotoxicity, gastrointestinal and skin discomfort in some patients. Dietary intervention is to reduce the absorption of purine by limiting the intake of high-purine foods, but it is difficult to comply with dietary restrictions for a long time. Unlike other uric acid-lowering therapies, biological therapies mainly reduce serum uric acid levels by degrading purines or uric acid. Recombinant uricases such as rasburicase and pegloticase can enzymatically degrade uric acid, but due to immunogenicity, the appearance of corresponding antibodies in tissues makes this treatment ineffective. Based on the current status of HUA treatment, the development of a long-lasting, safe and effective method of lowering blood uric acid has very important theoretical significance and application prospects for alleviating the treatment of HUA and gout.

[0003] As a cost-effective treatment, probiotic intervention has been widely accepted by the public because of its safety and sustained effects on the body. It has a certain effect on many diseases, even some difficult and complicated diseases. Probiotics relieve some disease symptoms by restoring the diversity of intestinal microbial flora and reducing the abundance of harmful microorganisms. It can also relieve or treat metabolic diseases by degrading the abundance of unfavorable metabolites in metabolic diseases. At present, the research on probiotics to relieve or treat hyperuricemia mainly focuses on using probiotics to degrade purine nucleosides to reduce serum uric acid levels. Probiotics reverse the increase in uric acid induced by diet by assimilating inosine and guanosine by producing inosine hydrolases. Although some currently isolated probiotics can relieve hyperuricemia by degrading only purine nucleosides or uric acid, both purine nucleosides and uric acid produced by food metabolism after diet will lead to increased serum uric acid, which in turn leads to the low ability of currently reported probiotic strains to reduce serum uric acid by degrading only purine nucleosides or uric acid.

[0004] Therefore, it is urgent to screen out probiotics that can simultaneously degrade uric acid and purine nucleosides in the intestine, in order to develop foods, health products or drugs with high uric acid-lowering effects, which will have great application prospects as a new means of preventing and / or treating hyperuricemia and gout. Summary of the invention

[0005] In order to overcome the deficiencies of the above-mentioned prior art, the present invention provides a fermented mucus lactobacillus and its application for alleviating hyperuricemia by simultaneously degrading uric acid and purine nucleosides, aiming to solve the technical problem that probiotics alleviate or treat hyperuricemia mainly by single degradation of uric acid or purine nucleosides to reduce serum uric acid levels, but both uric acid and purine nucleosides in the intestine will lead to increased serum uric acid, and there is no probiotic strain that can simultaneously degrade uric acid and purine.

[0006] The first technical solution provided by the present invention is a fermented mucus lactobacillus (Limosilactobacillusfermentum) GR-X, which was deposited in the China Center for Type Culture Collection (CCTCC) on October 11, 2023, with the deposit address: Wuhan, China; deposit number: CCTCC NO: M 20231857.

[0007] The fermented mucus lactobacillus GR-X has the following characteristics:

[0008] (1) Bacterial characteristics: The cells are long rod-shaped, without spores or flagella.

[0009] (2) Colony characteristics: Lactobacillus mucis fermentans GR-X grew well in MRS solid medium. The colonies were milky white, round, shiny, convex, with smooth edges and opaque.

[0010] (3) 16S rRNA gene sequence characteristics: As shown in the DNA molecule of SEQ ID NO.1, the highest similarity between the 16S rRNA gene sequence of Lactobacillus fermentans GR-X and the 16S rRNA gene of Lactobacillus fermentans published was between 97.99% and 98.44% through Blastn comparison.

[0011] (4) The fermented mucus Lactobacillus GR-X has the ability to degrade uric acid and purine nucleosides. Its living cells were incubated with uric acid at 37°C for 24 h. The uric acid degradation rate in the system reached 51.19%, the guanosine degradation rate reached 100%, the adenosine degradation rate was 23.06%, and the inosine degradation rate was 48.72%.

[0012] The second technical solution provided by the present invention is a microbial preparation containing the fermented mucus Lactobacillus GR-X described in the first technical solution.

[0013] In one embodiment, the amount of the fermented Lactobacillus mucilaginosus GR-X added to the microbial preparation is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0014] Furthermore, the amount of the fermented mucus Lactobacillus GR-X added to the microbial preparation is not less than 1×10 9 CFU / mL or 1×10 9 CFU / g.

[0015] The third technical solution provided by the present invention is a composition containing the fermented mucus Lactobacillus GR-X described in the first technical solution or the microbial agent described in the second technical solution.

[0016] In one embodiment, the amount of the fermented Lactobacillus mucilaginosus GR-X added to the composition is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

[0017] Furthermore, the amount of the fermented mucus Lactobacillus GR-X added to the composition is not less than 1×10 9 CFU / mL or 1×10 9 CFU / g.

[0018] In one embodiment, in the composition, the fermented Lactobacillus muciniphila GR-X is a live strain, a dried strain or an inactivated strain.

[0019] In one embodiment, in the composition, the active ingredient is the fermented Lactobacillus mucilaginosus GR-X postbiotic.

[0020] The fourth technical solution provided by the present invention is the use of the fermented mucus Lactobacillus GR-X described in the first technical solution, the microbial preparation described in the second technical solution, or the composition described in the third technical solution in the preparation of drugs for preventing and / or treating and relieving hyperuricemia and gout.

[0021] In one embodiment, the application includes at least one of the following effects:

[0022] (1) Reducing serum uric acid, creatinine and / or urea nitrogen levels in individuals with hyperuricemia;

[0023] (2) can colonize the mouse intestine;

[0024] (3) Alleviate liver or kidney damage caused by hyperuricemia;

[0025] (4) reduce serum uric acid, creatinine, urea nitrogen, TNF-α, and / or IL-6 levels in individuals with gout;

[0026] (5) Promote the excretion of uric acid in individuals through urine;

[0027] (6) Effectively colonize the human intestine.

[0028] In one embodiment, the application subject includes but is not limited to humans.

[0029] In one embodiment, the drug contains the fermented Lactobacillus mucilaginosus GR-X, a drug carrier and / or a pharmaceutical excipient.

[0030] In one embodiment, the carrier includes one or more of fillers, binders, wetting agents, disintegrants, lubricants, and flavoring agents commonly used in medicine.

[0031] In one embodiment, the dosage form of the drug is granules, capsules, tablets, pills or oral liquid.

[0032] The fifth technical solution provided by the present invention is the use of the fermented mucus Lactobacillus GR-X described in the first technical solution or the microbial preparation described in the second technical solution in the preparation of fermented food.

[0033] In one embodiment, the fermented food is fermented using food raw materials and the fermented Lactobacillus mucilaginosus GR-X or the microbial preparation as a fermentation microorganism.

[0034] In one embodiment, the fermented food comprises solid food, liquid food or semi-solid food.

[0035] In one embodiment, the fermented food is a dairy product, including fermented milk, flavored fermented milk, fermented milk beverages, cream, cheese, milk-containing beverages or milk powder.

[0036] The sixth technical solution provided by the present invention is a method for preparing yogurt, wherein milk is fermented for the first time using Lactobacillus bulgaricus and Streptococcus thermophilus, and then the fermented mucus Lactobacillus GR-X described in the first technical solution or the microbial preparation described in the second technical solution is added for a second fermentation.

[0037] In one embodiment, the temperature of the first fermentation is 42° C., and the fermentation time of the first fermentation is 6 hours; the temperature of the second fermentation is 42° C., and the fermentation time of the second fermentation is 6 hours.

[0038] The seventh technical solution provided by the present invention is the use of the fermented mucus Lactobacillus GR-X described in the first technical solution, the microbial preparation described in the second technical solution, or the composition described in the third technical solution in the preparation of functional foods or health products for preventing and / or treating and relieving hyperuricemia and gout.

[0039] In one embodiment, the application includes at least one of the following effects:

[0040] (1) Reduce serum uric acid, creatinine and / or urea nitrogen levels in hyperuricemic mice;

[0041] (2) can colonize the mouse intestine;

[0042] (3) Alleviate liver or kidney damage caused by hyperuricemia;

[0043] (4) reduce serum uric acid, creatinine, urea nitrogen, TNF-α, and / or IL-6 levels in patients with gout;

[0044] (5) Promote the excretion of uric acid through urine;

[0045] (6) Effectively colonizes the intestine.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The present invention separates and screens a fermented mucus lactobacillus GR-X with the ability to degrade uric acid and purine nucleosides from Jiangshui in Gansu Province. The strain can degrade 100.80 mg / L of uric acid to 49.20 mg / L within 24 hours, with a degradation rate of 51.19%, a degradation efficiency of 0.37 mmol / L guanosine of 100%, and a certain degradation ability for adenosine and inosine. The fermented mucus lactobacillus GR-X can degrade uric acid and purine nucleosides at the same time, and can reduce the absorption of uric acid and purine nucleosides by the intestine by degrading them at the same time, thereby reducing the serum uric acid level of hyperuricemia mice and reducing the liver and kidney damage of mice caused by hyperuricemia. Fermented Lactobacillus mucoides GR-X is used to prepare yogurt and treat gout patients. GR-X can colonize the intestinal tract and can reduce the serum uric acid level of gout patients from an average of 576.66 μmol / L to 421.66 μmol / L, which is close to the normal level. The yogurt prepared by GR-X promotes the excretion of uric acid through urine. The yogurt prepared by fermented Lactobacillus mucoides GR-X reduces the levels of creatinine, urea nitrogen, TNF-α and IL-6 in gout patients. The fermented Lactobacillus mucoides GR-X of the present invention is used to develop functional bacterial agents, foods or drugs for preventing and / or treating hyperuricemia and gout, which has broad application prospects.

[0048] Biomaterial Deposit

[0049] Fermented mucus Lactobacillus GR-X, classified as Limosilactobacillus fermentum, was deposited in the China Center for Type Culture Collection (CCTCC) on October 11, 2023, with the deposit address being Wuhan, China; deposit number: CCTCCNO:M20231857. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The colony morphology of Lactobacillus mucilaginosus GR-X growing on MRS plates;

[0051] Figure 2 The 16S rRNA phylogenetic tree of fermentative Lactobacillus mucilaginosus GR-X (a) and the morphological characteristics of fermentative Lactobacillus mucilaginosus GR-X under scanning electron microscope (b);

[0052] Figure 3 This is the test result of the ability of fermented Lactobacillus mucilaginosus GR-X to degrade uric acid in vitro, * represents P < 0.05;

[0053] Figure 4 This is the mass spectrum of the intermediate metabolites produced by the degradation of uric acid by fermentation of Lactobacillus mucilaginosus GR-X;

[0054] Figure 5 is the proposed pathway for uric acid degradation by Lactobacillus mucilaginosus GR-X;

[0055] Figure 6 is the degradation of guanosine, adenosine, and inosine by fermentative Lactobacillus mucilaginosus GR-X, * represents P < 0.05;

[0056] Figure 7 is the effect of constructing the hyperuricemia mouse model, * represents P < 0.05;

[0057] Figure 8 The statistical results of the effect of fermented Lactobacillus mucinus GR-X on reducing serum uric acid level (a), serum creatinine level (b), and serum urea nitrogen level (c) in hyperuricemia mice, and the colonization of fermented Lactobacillus mucinus GR-X in the intestine of hyperuricemia mice (d), * represents P < 0.05;

[0058] Fig. 9 The fermented Lactobacillus mucilaginosus GR-X alleviated liver and kidney damage in hyperuricemia mice;

[0059] Fig.10 The colonization of Lactobacillus mucinus GR-X in feces of gout patients after drinking yogurt prepared with Lactobacillus mucinus GR-X for 2 consecutive months;

[0060] Fig.11 Serum uric acid level (a), urine uric acid content (b), fecal uric acid content (c), and fecal degradation capacity of uric acid (d) in gout patients after drinking yogurt prepared by fermentation of Lactobacillus mucilaginosus GR-X for 2 consecutive months;

[0061] Fig.12Allantoin content in urine (a) and feces (b) of gout patients after drinking yogurt prepared by fermentation of Lactobacillus mucilaginosus GR-X for 2 consecutive months;

[0062] Fig.13 Figure 3 Changes in serum creatinine level (a), serum urea nitrogen level (b), serum tumor necrosis factor (TNF-α) content (c), and blood interleukin (IL-6) content (d) in gout patients after they drank yogurt prepared with fermented Lactobacillus mucinus GR-X for 2 consecutive months. DETAILED DESCRIPTION

[0063] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings. It should be understood that the specific embodiments are only used to explain the present invention and do not constitute a limitation of the present invention in any way. Unless otherwise specified, the materials, reagents and instruments used in the following examples can all be obtained from commercial sources.

[0064] The culture medium involved in the following examples is as follows:

[0065] M9 medium: NH4Cl 0.5 g / L, Na2HPO4 3.0 g / L, KH2PO4 1.5 g / L, 1 mL MgSO4·7H2O (1 M), 5 ml glucose [20% (w / v)] and 0.2 mL calcium chloride (1 M).

[0066] MRS broth medium: Ingredients (g / L): peptone 10.0, beef extract powder 5.0, yeast extract powder 4.0, glucose 20.0, dipotassium hydrogen phosphate 2.0, triammonium citrate 2.0, sodium acetate 5.0, magnesium sulfate 0.2, manganese sulfate 0.05. Add 20g agar to the solid medium.

[0067] The detection method involved in the following embodiments is as follows:

[0068] Uric acid and purine nucleoside concentrations were determined by HPLC under the following conditions: Agilent 1260 equipped with a UV detector and a Hypersil ODS column (5 μm, 4.6 mm × 150 mm) at 25 °C and 254 nm. The mobile phase was potassium dihydrogen phosphate buffer (10 mM) and methanol in a volume ratio of 9:1, with a flow rate of 1 mL / min and a sample volume of 10 μL.

[0069] The intermediate products after uric acid degradation were analyzed by liquid chromatography-mass spectrometry (LC-MS), and the detection conditions were as follows: ThermoFisher LTQ Orbitrap EDT mass spectrometer was used for analysis. 5 μL of the filtered supernatant was loaded onto a reversed phase Hypersil GOLD-C18 analytical column (3.0 μm, 100×2.1 mm). The mobile phase was 0.1% formic acid in water (A) and methanol (B) at a flow rate of 0.3 mL / min. The LC conditions were as follows: the mobile phase contained acetonitrile (A) and 0.1% formic acid (B), the flow rate was 0.3 mL / min, 90% A for 2 minutes, reduced to 10% A within 8 minutes, maintained for 2 minutes, and then increased to 90% A. MS analysis was performed using electrospray ionization (ESI) in negative ionization mode, with an m / z scan range of 100-400.

[0070] Example 1

[0071] Screening of strains capable of degrading uric acid and purine nucleosides

[0072] The 6 kinds of pulp water purchased from various parts of Gansu Province were mixed and allowed to stand for 5 minutes. 10ml of the supernatant was inoculated into 90ml of M9 medium containing 1g / L glucose, and 100mg / L uric acid was added as a co-carbon source. The conical flask was placed in an anaerobic culture bag and cultured at 37°C for 3 days, during which it was rotated and mixed 3 times. 10ml of culture was transferred to the new culture medium every three days, and the transfer was continuous for 2 times. During this period, only the glucose concentration dropped from 0.5g / L to 0, and other conditions were the same. The final enrichment was then diluted and spread on MRS agar medium. After culturing at 37°C for 48 hours, a single colony was picked and incubated in MRS broth medium for 24 hours, named and preserved. After the remaining bacterial liquid was centrifuged and washed three times with PBS, it was incubated in M9 medium (glucose content was 0) containing 100mg / L uric acid, and their uric acid and purine nucleoside degradation capabilities were evaluated using high performance liquid chromatography (HPLC). A strain (GR-X) with the highest uric acid degradation efficiency and 100% guanosine degradation was selected for further analysis. The phylogenetic characteristics of the isolated strain were identified by 16S rRNA gene sequencing, and the morphological characteristics of the strain were observed using scanning electron microscopy (SEM; FEI ApreoS, USA).

[0073] The results of 16S rDNA sequence determination are shown in SEQ ID No.1.

[0074] The results are as follows Figure 1 , Figure 2 As shown, GR-X grows well in MRS solid medium. The colonies are milky white, round, shiny, convex, with smooth edges and opaque ( Figure 1The highest similarity between the 16S rRNA gene sequence of probiotic GR-X and the 16S rRNA gene of the published Lactobacillus fermentans is between 97.99% and 98.44% ( Figure 2 a), we named it Limosilactobacillus fermentum GR-X, hereinafter referred to as GR-X. GR-X cells are long rod-shaped, without spores and flagella ( Figure 2 b).

[0075] Example 2

[0076] Characteristics of uric acid and purine nucleosides degradation by GR-X

[0077] GR-X was cultured statically at 37°C in MRS medium until the logarithmic growth phase. After centrifugation and three washes, it was suspended in PBS and inoculated into M9 medium with 100 mg / L uric acid or 0.37 mmol\L purine nucleoside as the sole carbon source at a 5% inoculation amount, and incubated statically in a 37°C constant temperature incubator for 24 hours. The positive control was commercially available Bifidobacterium breve. The incubated culture solution was centrifuged and the supernatant was collected every 2 hours or 4 hours. After filtering through a 0.22 μm filter membrane, the degradation of uric acid and purine nucleosides was detected by HPLC, and the degradation rates of uric acid and purine nucleosides were calculated; the intermediate products after uric acid was degraded by GR-X were analyzed using liquid chromatography-mass spectrometry (LC-MS).

[0078] The results are as follows Figure 3 , Figure 4 and Figure 5 As shown, GR-X can degrade 100.80 mg / L of uric acid to 49.20 mg / L within 24 hours ( Figure 3 a), the degradation rate reached 51.19% ( Figure 3 b). After uric acid was degraded by GR-X, S-allantoin was detected in the supernatant ( Figure 4 a), 2-oxo-4-hydroxy-4-carboxyl-5-ureido imidazoline (OHCU) ( Figure 4 b) and allantoin ( Figure 4 c) The presence of degradation products. Based on the analysis of degradation products, the proposed pathways for GR-X to degrade uric acid are as follows Figure 5 , uric acid is degraded into 5-hydroxyisouric acid, OHCU, S-allantoin and allantoin in turn. GR-X also has a good degradation rate for guanosine, adenosine and inosine, among which the degradation rate for 0.37mmol\L guanosine is 100% ( Figure 6 a). Guanosine is degraded into xanthine and guanine ( Figure 6 b), adenosine is degraded to adenine ( Figure 6 c), inosine is degraded to hypoxanthine ( Figure 6d). The above data show that GR-X can degrade both purine nucleosides and uric acid. Compared with the currently reported probiotics that can only treat human hyperuricemia by degrading purine nucleosides or uric acid, GR-X has more comprehensive functions and may be an excellent probiotic for the treatment of hyperuricemia.

[0079] Example 3

[0080] Application of GR-X in treating / alleviating hyperuricemia in mice

[0081] Male Kunming mice aged 4 weeks were purchased from the Medical Animal Experiment Center of Lanzhou University, and all animals were kept under specific pathogen-free conditions. The mice were raised normally for 7 days to adapt to the environment, irradiated with artificial light for 12 h per day (06:00-18:00 light cycle, 18:00-06:00 dark cycle), fed with standard laboratory food, and allowed to drink water freely. The ambient temperature was 25 ° C and the relative humidity was 60%. After the adaptation period (7 days), 60 mice were divided into 5 groups, 10 in each group (20 hyperuricemia model groups were avoided from death): control group, GR-X group, hyperuricemia model group, hyperuricemia model + Bifidobacterium breve administration group, hyperuricemia model + GR-X administration group. The sample size was based on the availability of animals in the facility, and 5 mice were fed in one cage.

[0082] To induce hyperuricemia, mice in the model, model+bifid, and model+GR-X groups were orally injected with uric acid (1% body weight / day) and potassium oxyphosphate (OP) (4% body weight / day) dissolved in sodium carboxymethylcellulose. Mice in the GR-X, model+bifid, and model+GR-X groups were given 100 μL of 10 9 CFU / mL corresponds to probiotics dissolved in saline, while the control group and model group were given the same volume of saline. The mice were treated and cultured for 14 consecutive days. On the 15th day, the mice were anesthetized with ether, and blood was collected from the ophthalmic vein and allowed to stand for 30 minutes. The collected blood samples were centrifuged at 4000rpm for 20min to obtain serum. The serum uric acid level of mice was detected by HPLC. The levels of creatinine (CRE) and urea nitrogen (BUN) in serum samples were detected using commercial kits (Nanjing Jiancheng, China) according to the protocol provided by the manufacturer.

[0083] To detect GR-X colonization, feces were collected and identified using qPCR technology. The specific qPCR primer sequences for GR-X were ATGGAGATTGGTAAAGATGACCATATCC in the forward direction and TCATTCTAATTTCACCTCCTTTTTGCG in the reverse direction. The universal primers for bacteria were GCAGGCCTAACACATGCAAGTC in the forward direction and CTGCTGCCTCCCGTAGGAGT in the reverse direction, which were used to amplify total bacterial 16S rRNA. The PCR products of the specific gene of GR-X and the 16S rRNA gene of Escherichia coli were used to construct a standard curve. The obtained PCR products were cloned into T vector (Takara) and transformed into DH-5α. After incubation at 37°C for 10 h, the plasmids were extracted using PlasmidMini Kit I (EZNA) as qPCR standard samples. The mouse fecal DNA was extracted using Stool DNA Kit (Solarbio) according to the manufacturer's instructions. GR-X cultured with MRS for 24 h was considered positive. The absolute abundance of GR-X in fecal samples was quantified using Taq II (Takara) and a real-time quantitative PCR instrument (Bio-RAD CFX96), and all tests were performed in quintuplicate.

[0084] The collected mouse liver and kidney samples were rinsed with PBS, and then the liver and the whole kidney with a volume of 0.8×0.8 cm were taken and fixed with 4% paraformaldehyde solution at room temperature for one day. The samples were then sent to Lanzhou University School of Medicine for physiological sectioning and hematoxylin and eosin (HE) staining. The liver and kidney damage of each group of mice was observed under a microscope (OLYMPUSBX53).

[0085] The construction of hyperuricemia mice Figure 7 As shown in Figure 2, oral injection of uric acid (1% body weight / day) and potassium oxyphosphate (OP) (4% body weight / day) effectively increased the serum uric acid level of mice to 217.33 μmol / L, so this injection amount was used to carry out animal experiments. Figure 8 As shown in the results, the serum uric acid level of mice in the model group was as high as 217.00 μmol / L, and Bifidobacterium breve only slightly reduced the serum uric acid level. However, the serum uric acid level of mice in the model + GR-X group was reduced to 144.66 μmol / L, which was significantly (P<0.05) reduced by 33.34% compared with the model group. Figure 8 a), and the serum creatinine and urea nitrogen levels of mice in the model+GR-X group were significantly lower than those in the model group (P<0.05). Figure 8b, c), indicating that GR-X treatment can significantly reduce the serum uric acid level in hyperuricemia mice. In addition, GR-X can effectively colonize in the mouse intestine, with a colonization rate of 0.18%. Histopathological analysis showed that the liver and kidneys of hyperuricemia model mice were damaged to varying degrees by the impact of hyperuricemia. The liver and kidney sections of the model group showed enlarged intercellular spaces and deeper nuclear staining. GR-X treatment alleviated the degree of damage to the liver and kidneys of the model mice and restored a certain amount of intercellular spaces ( Fig. 9 ), indicating that GR-X can alleviate liver or kidney damage caused by hyperuricemia and GR-X can prevent and / or treat hyperuricemia and gout.

[0086] Example 4

[0087] Using GR-X to prepare yogurt

[0088] GR-X, Lactobacillus bulgaricus and Streptococcus thermophilus were cultured separately and made into bacterial powder (1×10 9 CFU / g). Bulgarian lactobacillus and thermophilic streptococcus were added to pure milk (2g bacterial powder / L pure milk, 1:1 mixture of Lactobacillus Bulgarian and thermophilic streptococcus powder), and fermented at 42°C for 6h. Then, GR-X powder (2g bacterial powder / L pure milk) was added for secondary fermentation for 6h. The fermented yogurt was sent to an institution with testing qualifications to test the quality of the yogurt. The GR-X content in the yogurt was detected by the above-mentioned qPCR method, and the GR-X content was about 1×10 9 The test results of yogurt are shown in Table 1, which shows that all indicators of yogurt meet the national food safety standards.

[0089] Table 1 Test results of various indicators in yogurt prepared by GR-X

[0090]

[0091]

[0092] Example 5

[0093] GR-X probiotic yogurt reduces serum uric acid levels in patients with gout

[0094] Sixty gout volunteers with high serum uric acid levels (>420 μmol / L) were recruited. The volunteers were randomly assigned to three independent groups: control group, ordinary yogurt group, and GR-X yogurt group. Both ordinary yogurt and GR-X yogurt contained Lactobacillus bulgaricus and Streptococcus thermophilus, and GR-X yogurt also contained GR-X at a concentration of 1×10 9. The ordinary yogurt group and the GR-X yogurt group drank 250g of the corresponding yogurt every day for two consecutive months, while the control group did not drink it. After 2 months, blood samples were drawn from the volunteers for routine blood tests, and the levels of uric acid, creatinine and urea nitrogen in the blood supernatant were analyzed. The levels of tumor necrosis factor (TNF-α) and interleukin (IL-6) in the serum were determined by enzyme-linked immunosorbent assay kit (mlbio, Shanghai, China) according to the manufacturer's instructions. At the same time, urine and feces of the volunteers were collected, and the levels of uric acid and allantoin in urine and feces were detected by HPLC. 10mL fecal samples were co-incubated with 100mg\L uric acid to detect the degradation ability of feces on uric acid. In addition, the colonization of GR-X in feces was detected by qPCR, and the qPCR method was described in Example 3. This study was approved by the Ethics Committee of the School of Life Sciences of Lanzhou University (EAF2023022). All participants signed informed consent before the experiment.

[0095] GR-X colonization in the intestine Fig.10 As shown, the abundance of GR-X was detected at 0.23% in the feces of volunteers in the GR-X yogurt group, indicating that GR-X effectively colonized in the human intestine.

[0096] The average serum uric acid level of the volunteers in the control group was 576.66 μmol / L, while after drinking the yogurt containing GR-X, the average serum uric acid level dropped to 421.66 μmol / L, a significant decrease of 26.89% (P<0.05); the serum uric acid level of the volunteers in the ordinary yogurt group only decreased slightly ( Fig.11 a). After drinking GR-X yogurt, the uric acid content in urine increased by 20.40% compared with the control group volunteers ( Fig.11 b), indicating that GR-X yogurt can promote the excretion of uric acid through urine; and the uric acid content in feces decreased from 1002.93μmol / g to 812.53μmol / g ( Fig.11 c); After drinking yogurt containing GR-X, the degradation rate of uric acid in feces increased to 61.8% ( Fig.11 d). Correspondingly, the allantoin content in urine and feces increased to 13.34 μmol / L ( Fig.12 a) and 4.49 μmol / g( Fig.12 b), indicating that drinking GR-X yogurt can improve the degradation of uric acid by intestinal flora.

[0097] Significant reductions were also observed in serum creatinine and urea nitrogen levels after consuming GR-X yogurt ( Fig.13 a, b); Compared with the control group and the group of volunteers drinking ordinary yogurt, it was detected that the levels of TNF-α and IL-6 in the serum of volunteers were significantly reduced after drinking GR-X yogurt ( Fig.13 c,d).

[0098] The above human experimental results show that by drinking yogurt prepared with GR-X, GR-X can effectively colonize in the intestine and degrade intestinal uric acid, promoting the excretion of uric acid through urine; at the same time, it can effectively reduce the serum uric acid, creatinine, urea nitrogen levels, as well as TNF-α and IL-6 in gout patients. GR-X and the functional bacterial agents, foods or drugs prepared using it are effective means to relieve and / or treat hyperuricemia and gout, and have broad application prospects.

[0099] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A fermented mucus lactobacillus (Limosilactobacillus fermentum) GR-X, characterized in that: It was deposited in the China Center for Type Culture Collection (CCTCC) on October 11, 2023, with the deposit number CCTCC NO:M20231857.

2. A microbial preparation containing the fermented Lactobacillus mucilaginosus GR-X according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The amount of fermented mucus lactobacillus GR-X added to the microbial preparation is not less than 1×10 6 CFU / mL or 1×10 6 CFU / g.

4. A composition comprising the fermented Lactobacillus mucilaginosus GR-X according to claim 1 or the microbial agent according to claim 2 or 3.

5. The composition according to claim 4, characterized in that In the composition, the fermented Lactobacillus mucilaginosus GR-X is a live strain, a dried strain or an inactivated strain.

6. Use of the fermented mucus Lactobacillus GR-X according to claim 1, the microbial preparation according to claim 2 or 3, or the composition according to claim 4 or 5 in the preparation of a medicament for preventing and / or treating and relieving hyperuricemia and gout.

7. The use according to claim 6, characterized in that: The application includes at least one of the following functions: (1) Reducing serum uric acid, creatinine and / or urea nitrogen levels in individuals with hyperuricemia; (2) reduce liver or kidney damage caused by individuals with hyperuricemia; (3) reduce serum uric acid, creatinine, urea nitrogen, TNF-α, and / or IL-6 levels in individuals with gout; (4) Promote the excretion of uric acid through urine.

8. Use of the fermented Lactobacillus mucilaginosus GR-X according to claim 1 or the microbial preparation according to claim 2 or 3 in the preparation of fermented food.

9. Use of the fermented mucus Lactobacillus GR-X according to claim 1 or the microbial preparation according to claim 2 or 3 in preparing yogurt, characterized in that: The milk is fermented for the first time using Lactobacillus bulgaricus and Streptococcus thermophilus, and then the fermented Lactobacillus mucosa GR-X described in claim 1 or the microbial preparation described in claim 2 or 3 is added for the second fermentation.

Images