Dual digital PCR method based on Brucella

Abstract

The invention discloses a dual digital PCR method based on Brucella, specifically, VirB8 and VirB12 in Brucella are analyzed, and the method belongs to the technical field of molecular biology. The method comprises extraction of DNA templates of VirB8 and VirB12 and PCR amplification, and synchronous detection and analysis of the VirB8 and VirB12 are performed by a digital PCR reactor, thereby realizing synchronous qualitative analysis and quantitative analysis of VirB8 and VirB12; the invention also provides a sensitivity detection method of the method, and the detection limit of the method is obtained by detecting and analyzing standard plasmids of different concentrations, thereby ensuring the accuracy of the method in use; the invention also provides a specific detection method for detecting and analyzing Brucella, and other bacterial species such as Escherichia coli are used as controls, thereby obtaining a conclusion on the effectiveness of the method for detecting Brucella.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a double digital PCR method based on Brucella. Background Art

[0002] Brucella is an intracellular parasitic pathogen, and its virulence gene lies in the type IV secretion system. The intracellular transport of Brucella is completed under the regulation of the type IV secretion system encoded by VirB. The type IV secretion system can transport proteins and / or DNA and / or protein complexes, establish a transport channel across the cell membrane and then bind to the target cell, so that the secreted protein reaches the target cell; Brucella gene coding region has 12 open reading frames, namely VirB1~VirB11 and VirB12, among which VirB1~VirB11 is homologous to the VirB coding region of Agrobacterium, and VirB12 has no homology with the VirB coding region of Agrobacterium. During intracellular transport, VirB8 establishes a channel for VirB protein to enter the outer membrane, and VirB12 enters the cell to play a role in the pathogenicity of Brucella. Therefore, the detection of VirB8 and VirB12 is essential in the study of Brucella pathogenicity.

[0003] There are many methods for detecting VirB8 and VirB12 in the prior art, among which the PCR detection method is the most common one. A master's thesis entitled "Establishment and Application of Brucella VirB8-PCR Diagnostic Method and Cloning and Sequence Analysis of Ery Gene" (Wu Dongling, Xinjiang Agricultural University, pages 12-25) discloses a Brucella VirB8-PCR method. Using the Brucella pathogenic factor VirB8 gene as a template, primers were designed, reaction conditions and procedures were optimized, and a VirB8-PCR method was established for the detection of the VirB8 pathogenic factor. The Brucella pathogenic factor VirB8 can be effectively detected by the PCR method. In addition, Chinese invention patent CN116183902A discloses a serological method for distinguishing animals immunized with Brucella A19-VirB12 vaccine and infected animals. Specifically, calves are inoculated with A19-VirB12 vaccine by subcutaneous injection and serum is collected. The serum samples are tested by the NH-AGID method. When the test results show two precipitation lines of LPS and NH or only one NH precipitation line, it indicates that the serum is positive for Brucella infection antibodies.

[0004] The above method can be used to detect the virulence factors of VirB8 and VirB12. However, the prior art still has the following defects in the process of detecting the virulence factors of VirB8 and VirB12: the detection method in the prior art cannot detect the virulence factors of VirB8 and VirB12 simultaneously, and can only detect the virulence factors of VirB8 or VirB12 separately, and whether the PCR method or the NH-AGID method is used for detection, only qualitative analysis can be performed, and quantitative analysis cannot be performed, and the detection requirements for Brucella cannot be met. Therefore, designing a method that can simultaneously detect the virulence factors of VirB8 and VirB12 is particularly important in the study of the virulence factors of Brucella. Summary of the invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0006] In order to solve the problem that the virulence factors VirB8 and VirB12 cannot be detected synchronously when studying Brucella in the prior art, the present invention adopts the following technical solution.

[0007] A dual digital PCR method based on Brucella, characterized in that it comprises the following steps:

[0008] Extraction of DNA template: Extract DNA templates from Brucella, including VirB8 and VirB12 DNA templates;

[0009] PCR amplification: VirB8 and VirB12 DNA templates were added to the PCR reaction system for droplet treatment and then PCR amplification was performed;

[0010] Qualitative and quantitative analysis: Conduct qualitative and quantitative analysis on the system after PCR amplification.

[0011] Preferably, in the above-mentioned dual digital PCR method, the PCR reaction system comprises:

[0012] 2×supermix reaction solution; VirB8-F primer; VirB8-R primer; VirB8-Probe probe; VirB12-F primer; VirB12-R primer; VirB12-Probe probe and the VirB8 and VirB12 DNA templates and DEPC water.

[0013] Preferably, in the above-mentioned dual digital PCR method,

[0014] The gene sequence of the VirB8-F primer is shown in SEQ NO.1;

[0015] The gene sequence of VirB8-R primer is shown in SEQ NO.2;

[0016] The gene sequence of VirB8-Probe probe is shown in SEQ NO.3;

[0017] The gene sequence of the VirB12-F primer is shown in SEQ NO.4;

[0018] The gene sequence of VirB12-R primer is shown in SEQ NO.5;

[0019] The gene sequence of VirB12-Probe probe is shown in SEQ NO.6.

[0020] Preferably, in the above-mentioned dual digital PCR method,

[0021] The PCR reaction system includes:

[0022] 2×supermix reaction solution 15uL;

[0023] VirB8-F primer 1.6uL;

[0024] VirB8-R primer 1.6uL;

[0025] VirB8-Probe probe 0.8uL;

[0026] VirB12-F primer 1.6uL;

[0027] VirB12-R primer 1.6uL;

[0028] VirB12-Probe probe 0.8uL;

[0029] VirB8 template 1uL;

[0030] VirB12 DNA template 1uL;

[0031] DEPC water 5uL.

[0032] Preferably, in the above-mentioned dual digital PCR method, the step of droplet processing is:

[0033] The reaction system was added to the first row of 8 wells of the DG8 well plate, and droplet generating oil was added to the second row of the DG8 well plate. The well plate containing the reaction system and droplet generating oil was sealed with a droplet generating plate rubber pad, and the well plate containing the reaction system and droplet generating oil was placed in a droplet generator for droplet treatment to form oil-in-water droplets.

[0034] Preferably, in the above-mentioned dual digital PCR method, the steps of qualitative and quantitative analysis are as follows:

[0035] A digital PCR droplet analyzer was used to detect the droplets in the well plate through FAM and VIC channels and record the proportion of positive droplets;

[0036] The FAM channel detects the VirB8 gene sequence, and the VIC detects the VirB12 gene sequence.

[0037] Another aspect of the present invention further provides a sensitivity detection method of the above dual digital PCR method, comprising the following steps:

[0038] Construction of plasmids: including construction of VirB8 plasmid and VirB12 plasmid;

[0039] Plasmid dilution: dilute the above VirB8 plasmid or VirB12 plasmid in equal proportions;

[0040] PCR detection: The diluted VirB8 plasmid or VirB12 plasmid was subjected to digital PCR detection.

[0041] Preferably, in the above sensitivity detection method, the steps of constructing the VirB8 plasmid are as follows:

[0042] Using the gene sequence plasmid shown in SEQ NO.7, namely the PUC plasmid, as a template, the VirB8 gene sequence shown in SEQ NO.8 was inserted into the PUC plasmid to construct the VirB8 plasmid.

[0043] Preferably, in the above sensitivity detection method, the steps of constructing the VirB12 plasmid are as follows:

[0044] Using the gene sequence plasmid shown in SEQ NO.7, namely the PUC plasmid, as a template, the VirB12 gene sequence shown in SEQ NO.9 was inserted into the PUC plasmid to construct the VirB12 plasmid.

[0045] Preferably, in the above sensitivity detection method, the concentration of the diluted VirB8 plasmid or VirB12 plasmid is: 1.0×10 5 copies / μL, 1.0×10 4 copies / μL, 1.0×10 3 copies / μL, 1.0×10 2 copies / μL, 1.0×10 1 copies / μL, 0.5×10 1 copies / μL, 0.25×10 1copies / μL, 0.125×10 1 copies / μL, 0.1×10 1 copies / μL.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The invention provides a dual digital PCR method based on Brucella, specifically for detecting VirB8 and VirB12 in Brucella, comprising the following steps: firstly, performing PCR amplification on VirB8 and VirB12, placing the amplified system in a digital PCR analyzer for dual-channel detection, and performing synchronous detection on VirB8 and VirB12 respectively, thereby achieving the purpose of synchronous detection of VirB8 and VirB12; in addition, the detection method of the invention can record the proportion of positive droplets of VirB8 and VirB12, thereby achieving qualitative analysis of VirB8 and VirB12 on the one hand, and quantitative analysis of VirB8 and VirB12 on the other hand.

[0048] The dual digital PCR method in the present invention also performs a sensitivity analysis when used to detect the sensitivity of the method. Specifically, a standard plasmid is constructed and the plasmid of standard concentration is gradiently diluted. By performing PCR detection and analysis on standard plasmids of different concentrations, the detection limit of the method can be obtained. Therefore, the sensitivity of the method can be analyzed, so that the method can be applied to technologies with different detection requirements. On the one hand, the sensitivity of the method is guaranteed, and on the other hand, the scope of application of the method is expanded.

[0049] In addition, the PCR method of the present invention also provides a specific analysis method. Specifically, using other bacteria such as Escherichia coli as controls, this method is used to analyze and detect Brucella and other control bacteria. The results show that this method can effectively detect Brucella, ensure the accuracy of the detection method, and clarify the effectiveness of the detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 It is a FAM scatter plot in the dual digital PCR sensitivity experiment of the present invention;

[0051] Figure 2 It is a VIC scatter plot in the dual digital PCR sensitivity experiment of the present invention;

[0052] Figure 3 It is a FAM scatter plot in the dual digital PCR specificity experiment of the present invention;

[0053] Figure 4It is a VIC scatter plot in the dual digital PCR specificity experiment of the present invention. DETAILED DESCRIPTION

[0054] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the accompanying drawings.

[0055] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0056] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not refer to the same embodiment, nor is it a separate or selective embodiment that is mutually exclusive with other embodiments. The present invention provides the following embodiments.

[0057] The embodiment of the present invention provides a method for synchronously detecting VirB8 and VirB12 pathogenic factors. Specifically, a digital PCR method is used to synchronously detect VirB8 and VirB12 pathogenic factors, which solves the defect that VirB8 and VirB12 pathogenic factors cannot be synchronously detected in the prior art. The detection method detects VirB8 and VirB12 pathogenic factors by a double digital PCR method. The specific method includes the following steps:

[0058] First, probes for VirB8 and VirB12 were designed and synthesized. The specific primer and probe sequences of VirB8 and VirB12 are as follows:

[0059] VirB8-F: 5'-ACGAAACCGTAGGCATGTT-3'

[0060] VirB8-Probe: (FAM)5'-AAGCCAGTTCCAGGCGATAAGG-3' (BHQ1)

[0061] VirB8-R: 5'-GCGCACATTTGAGCCATATT-3'

[0062] VirB12-F: 5'-GCCTGACGGACAACAACTC-3'

[0063] VirB12-Probe: (VIC)5'-CGTGCGCTGGCTATCTATAATTGGCT-3'(BHQ1)

[0064] VirB12-R: 5'-CGGGTACGCCTTGATTGAT-3';

[0065] Secondly, collect samples. Specifically, take animal tissues or diseased materials infected with Brucella and put them in a 2 mL centrifuge tube, cut them into pieces, add an appropriate amount of sterilized PBS, put in steel balls, and vibrate them at a frequency of 20-30 Hz for 2 min. Then take out the steel balls, and then place the diseased materials in a -80 ℃ refrigerator and freeze and thaw them repeatedly for 3 times. Then put them in a centrifuge and centrifuge them for 5 minutes. The operating speed of the centrifuge is 10,000 rpm. After completing the above operations, store the samples in a -80 ℃ refrigerator for later use.

[0066] Furthermore, the DNA template is subjected to a digital PCR method, the method comprising the following steps:

[0067] The first step is to extract DNA templates from the collected samples, and use a kit method to extract DNA of Brucella from the samples, and mark them as DNA templates.

[0068] The second step is to construct a digital PCR reaction system. Specifically, 15uL of 2×supermix reaction solution, 1.6uL of VirB8-F primer shown in SEQ NO.1, 1.6uL of VirB8-R primer shown in SEQ NO.2, 0.8uL of VirB8-Probe probe shown in SEQ NO.3, 1.6uL of VirB12-F shown in SEQ NO.4, 1.6uL of VirB12-R shown in SEQ NO.5, 0.8uL of VirB12-Probe probe shown in SEQNO.6, 1uL of VirB8 DNA template, 1uL of VirB12 DNA template and 5uL of DEPC water are added to a sterilized PCR reaction tube to construct a digital PCR reaction system. The total volume of the reaction system is 30uL.

[0069] The third step is droplet treatment. The above reaction system is added to the 8 wells in the first row of the DG8 well plate, and 180uL of droplet generating oil is added to the second row of the DG8 well plate. The well plate containing the above reaction system and droplet generating oil is sealed with a rubber pad. The well plate containing the above reaction system and droplet generating oil is placed in a droplet generator. Droplets can be generated by running a computer program for 300s to form oil-in-water droplets.

[0070] The fourth step is PCR amplification, and PCR amplification is performed according to the reaction conditions shown in Table 1;

[0071] Table 1: PCR reaction conditions

[0072]

[0073] The fifth step is to conduct qualitative and quantitative analysis on the system after the above amplification reaction. Specifically, the amplified DG8 well plate is placed in the digital PCR droplet analyzer, and the droplet data is read through a computer program. The digital PCR droplet analyzer will automatically absorb the droplets in the well plate for FAM and VIC channel detection, wherein the FAM channel detects the VirB8 gene sequence, and the VIC detects the VirB12 gene sequence. The blue fluorescent signal that can be detected is the FAM positive droplet, the green fluorescent signal that can be detected is the VIC positive droplet, the droplet without blue fluorescent signal is the FAM negative droplet, and the droplet without green fluorescent signal is the VIC negative droplet. The software will automatically record the proportion of positive droplets in the sample and calculate the detection concentration copy number based on the Poisson distribution principle.

[0074] Through this qualitative and quantitative analysis, the VirB8 and VirB12 pathogenic factors can be detected qualitatively and quantitatively simultaneously to meet the detection requirements for Brucella.

[0075] This embodiment provides, on one hand, the above-mentioned method for simultaneously detecting the pathogenic factors of VirB8 and VirB12, and on the other hand, provides a method for sensitive detection using the above-mentioned dual digital PCR method, which specifically includes the following steps:

[0076] First, construct a plasmid. Using the gene sequence plasmid shown in SEQ NO.7, i.e., the PUC plasmid, as a template, the VirB8 gene sequence shown in SEQ NO.8 is inserted into the PUC plasmid to construct the VirB8 plasmid; using the gene sequence plasmid shown in SEQ NO.7, i.e., the PUC plasmid, as a template, the VirB12 gene sequence shown in SEQ NO.9 is inserted into the PUC plasmid to construct the VirB12 plasmid.

[0077] Among them, the gene sequence of the PUC plasmid is:

[0078]

[0079] The fragment sequence of VirB8 inserted into the PUC plasmid gene is as follows:

[0080] ATGTTTGGACGCAAACAATCTCCACAGAAATCAGTAAAGAACGGGCAGGGCAATGCGCCTTCGGTATATGACGAAGCGTTGAACTGGGAGGCCGCGCACGTCCGGCTGGTCGAAAAATCCGAACGCCGCGCGTGGAAAATCGCCGGGGCTTTCGGCACCATTACCGTGCTGCTCGGGATCGGCATCGCCGGGATGTTACCGCTAAAGCAACATGTGCCCTACCTGGTGCGCGTCAACGCACAGACAGGTGCGCCTGATATCCTGACCTCGCTCGACGAGAAGAGTGTCAGCTACGACACTGTAATGGATAAATACTGGCTCTCGCAGTACGTGATAGCGCGTGAAACCTACGACTGGTACACGCTGCAAAAGGACTACGAAACCGTAGGCATGTTGTCGTCGCCGTCCGAAGGGCAGAGCTATGCAAGCCAGTTCCAGGGCGATAAGGCGCTTGACAAGCAATATGGCTCAAATGTGCGCACATCGGTAACGATCGTAAGCATCGTGCCGAACGGCAAGGGCATCGGCACGGTGCGCTTTGCGAAGACGACAAAGCGCACCAACGAGACCGGTGACGGCGAAACAACGCACTGGATCGCCACCATTGGCTACCAATACGTCAATCCCTCTTTGATGTCGGAATCGGCCCGCCTGACAAACCCGCTGGGTTTCAATGTCACGAGCTATCGCGTTGACCAGAAATGGGAGTGGTGCAATGA;

[0081] The fragment sequence of VirB12 inserted into the PUC plasmid gene is as follows:

[0082] ATGCGCACATTGGTTATGGTCGCATGCGCTGTCTCTCTGGCCGCTTGTTCCAGCCCGCCGAAGCCGCCCACAGTCAGCGGACGCCACCGCATTCCGATAAACAGCCCGGCGGCACAAGAGGAACTGCGCT TGCAGGTTTTCCCGCAAGAACCCACCGCGCAAGCAACCATGTGGCCAGCACGGCCGCCCAAACAAACAGTCAACGTGTATTTTCCCCAGGATGTGACGGTATTCCGGCCAACATCCGCACAGATAAACCA ACTCCACACACTGCTCTGGCCCGTGCCCAAGCATATCAACGTCAGGGGCCTGACGGACAACAACTGCCCTCCTCCCGGTGATACGCAAGTCGCGCGTGTCCGTGCGCTGGCTATCTATAATTGGCTGATC AATCAAGGCGTACCCGCCAGCAGGATCACCATAAGCTATGCCCCGGTAAAAGATTACGCATCAAATGCCCCCCTTTCACCGGGCCGCGTCCTGAACAGGCGCGTGGATATCGAAATTTTACGCAAGTAA.

[0083] VirB8 and VirB12 plasmid standards were used as samples and diluted to 1.0×10 5 copies / μL, and then 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Ten-fold gradient dilution was performed to carry out digital PCR reaction, and the amplification was detected by FAM and VIC channels; then when the plasmid concentration was 1.0×10 copies / μL, the number of positive droplets could still be detected, and the plasmid concentration was 1.0×10 copies / μL, and the dilution was carried out in multiples, that is, 1:2, 1:4, and 1:8. The results are shown in the table. The sensitivity of this method for VirB8 and VirB12 detection was 2.5 copies / μL and 1.25 copies / μL, respectively. The sensitivity detection results are shown in Table 2.

[0084] Table 2 Sensitivity test results

[0085]

[0086] As can be seen from Table 2, when the above sensitivity detection method is used to detect VirB8, it can be detected when the concentration of the VirB8 plasmid standard is 2.5 copies / uL, and it can be detected when the concentration of the VirB12 plasmid standard is 1.25 copies / uL. Therefore, the detection sensitivities of VirB8 and VirB12 are 2.5 copies / μL and 1.25 copies / μL, respectively.

[0087] In addition, this embodiment also provides a dual digital PCR specific experimental method, which is as follows:

[0088] The above VirB8 and VirB12 plasmid standards were used as samples, Escherichia coli, Salmonella, and Mycobacterium tuberculosis were used as control samples, and PBS was used as a negative control and a blank control, and the above method was used for comparison, and the results were read respectively. The results are shown in Table 3.

[0089] Table 3 Specificity results

[0090]

[0091] From the above, it can be seen that the use of VirB8-F primer shown in SEQ NO.1, VirB8-R primer shown in SEQ NO.2, VirB8-Probe probe shown in SEQ NO.3, VirB12-F primer shown in SEQ NO.4, VirB12-R primer shown in SEQ NO.5, and VirB12-Probe probe shown in SEQ NO.6 can effectively amplify and express VirB8 and VirB12, while no expression results are found for Escherichia coli, Mycobacterium tuberculosis and Salmonella.

[0092] The above content is a further detailed description of the present invention in combination with specific implementation methods. It cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the scope of protection determined by the claims submitted for the present invention.

Claims

1. A dual digital PCR method based on Brucella for non-diagnostic purposes, characterized in that, The steps include: Extraction of DNA template: Extract DNA templates from Brucella, including VirB8 and VirB12 DNA templates; PCR amplification: VirB8 and VirB12 DNA templates were added to the PCR reaction system for droplet treatment and then PCR amplification was performed; Qualitative and quantitative analysis: Conduct qualitative and quantitative analysis on the system after PCR amplification; The PCR reaction system includes: 2×supermix reaction solution; VirB8-F primer; VirB8-R primer; VirB8-Probe probe; VirB12-F primer; VirB12-R primer; VirB12-Probe probe and the VirB8 and VirB12 DNA templates and DEPC water; The gene sequence of the VirB8-F primer is shown in SEQ NO.1; The gene sequence of VirB8-R primer is shown in SEQ NO.2; The gene sequence of VirB8-Probe probe is shown in SEQ NO.3; The gene sequence of the VirB12-F primer is shown in SEQ NO.4; The gene sequence of VirB12-R primer is shown in SEQ NO.5; The gene sequence of VirB12-Probe probe is shown in SEQ NO.6; The steps of droplet processing are: The reaction system is added to the first row of 8 wells of the DG8 well plate, and the droplet generation oil is added to the second row of the DG8 well plate, and the well plate containing the reaction system and the droplet generation oil is sealed by a droplet generation plate rubber pad, and the well plate containing the reaction system and the droplet generation oil is placed in a droplet generator for droplet treatment to form water-in-oil droplets; The steps of qualitative and quantitative analysis are as follows: A digital PCR droplet analyzer was used to detect the droplets in the well plate through FAM and VIC channels and record the proportion of positive droplets; Among them, the FAM channel detects the VirB8 gene sequence, and the VIC detects the VirB12 gene sequence; The PCR reaction system includes: 2×supermix reaction solution 15uL; VirB8-F primer 1.6uL; VirB8-R primer 1.6uL; VirB8-Probe probe 0.8uL; VirB12-F primer 1.6uL; VirB12-R primer 1.6uL; VirB12-Probe probe 0.8uL; VirB8 template 1uL; VirB12 DNA template 1uL; DEPC water 5uL.

Images