A drug-resistant Stenotrophomonas maltophilia phage and its composition and application

Abstract

The present invention discloses a strain of Stenotrophomonas maltophilia phage and its composition and application. The Stenotrophomonas maltophilia phage, phage CP‑p‑PMA‑23015, has a deposit number of: CCTCC NO: M20231695; the phage was deposited in the China Center for Type Culture Collection on September 13, 2023, and was classified and named as Podoviridae. CP‑p‑PMA‑23015 itself has a wide host spectrum and can lyse no less than 23 strains of drug-resistant Stenotrophomonas maltophilia. It has great potential in clinical applications and is a relatively ideal choice. It should not be replaced by others. The phage CP‑p‑PMA‑23015 is combined with one or more of the other five phages provided by the present invention to form a composition, which broadens the host spectrum and lysis ability, and has broad application potential in the clinical treatment of drug-resistant Stenotrophomonas maltophilia infections and environmental purification.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to a drug-resistant Stenotrophomonas maltophilia phage and a composition and application thereof. Background Art

[0002] Stenotrophomonas maltophilia belongs to the Xanthomonadaceae family of the order Xanthomonadales. It is an obligately aerobic, non-fermenting, Gram-negative, polar, multiflagellate bacillus that is widely found in water, soil, and animals.

[0003] Stenotrophomonas maltophilia is a common conditional pathogen in clinical practice and a major pathogen of nosocomial infection. The bacterium can cause respiratory tract, urinary tract and wound infections, as well as endocarditis, meningitis, epididymitis, arthritis, cholangitis, endophthalmitis and peritonitis. Susceptibility factors include: weakness, immunosuppression, trauma, intubation, surgery, transplantation, use of ventilator, etc. Stenotrophomonas maltophilia has a complex drug resistance mechanism, low outer membrane permeability, and is not easily permeable to a variety of antibiotics. It is naturally resistant to most commonly used antibiotics in clinical practice (such as aminoglycosides and many β-lactams). With the widespread and high-dose application of clinical antibiotics and immunosuppression, its isolation rate has shown an upward trend among non-fermenting bacteria. Because the bacterium is resistant to a variety of antibiotics, it brings great difficulties to clinical treatment.

[0004] Bacteriophage (phage) is a type of virus that uses specific microorganisms such as bacteria, fungi, actinomycetes or spirochetes as hosts. Similar to other viruses, the head of a bacteriophage is composed of a protein capsid that encapsulates genetic material. Tailed phages also have "tails" of varying lengths and shapes, which are used to specifically identify host bacteria and inject genetic material into the host. Compared with traditional antibiotics, phages have the advantages of strong bactericidal ability, high specificity, high safety, and low cost, and their bactericidal ability does not depend on the drug resistance of bacteria. Therefore, phages show great application potential in preventing and treating bacterial infections, especially drug-resistant bacterial infections.

[0005] Bacteriophages are undoubtedly a powerful weapon to control drug-resistant bacteria, and their application range is very wide. As early as more than 100 years ago, when bacteriophages were first discovered, some European countries had tried to use them to treat diseases such as dysentery. Later, due to the discovery and widespread use of antibiotics, many countries gave up phage therapy. However, with the increasing severity of bacterial resistance, phage therapy has regained attention. Many clinical cases of personalized phage treatment of drug-resistant bacterial infections have been carried out at home and abroad, demonstrating the great potential of phage therapy.

[0006] At present, phage personalized therapy has not been widely promoted, and there are no phage drugs on the market at home and abroad. Compared with traditional broad-spectrum antibiotics, phage therapy also faces the bottlenecks of strong specificity, narrow bactericidal spectrum and easy bacterial tolerance. Summary of the invention

[0007] The purpose of the present invention is to provide a strain of Stenotrophomonas maltophilia phage and its composition and application. Different natural phages have different lysis spectrum ranges, so the bottleneck of the above phage therapy can be broken through to a certain extent through phage combination, which greatly broadens the host spectrum and has broad application potential in clinical treatment of Stenotrophomonas maltophilia infection and environmental purification.

[0008] The technical solution adopted by the present invention to solve the above technical problems is as follows:

[0009] The present invention provides a Stenotrophomonas maltophilia phage, phage CP-p-PMA-23011, with a preservation number of: CCTCC NO: M20231696; the phage was deposited in the China Center for Type Culture Collection on September 13, 2023, with a preservation address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and was classified and named Podoviridae.

[0010] The present invention also provides a Stenotrophomonas maltophilia phage, phage CP-p-PMA-23015, with a preservation number of: CCTCC NO: M20231695; the phage was deposited in the China Center for Type Culture Collection on September 13, 2023, with a preservation address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named Podoviridae.

[0011] The present invention also provides a Stenotrophomonas maltophilia phage, the phage CP-p-PMA-23022, the preservation number is: CCTCC NO: M20231694; the phage was deposited in the China Center for Type Culture Collection on September 13, 2023, the preservation address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as the long-tailed virus family Siphoviridae.

[0012] The present invention also provides a Stenotrophomonas maltophilia phage, the phage CP-p-PMA-23028, the preservation number is: CGMCC NO.45676; the phage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023, the preservation address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and is classified and named as Podoviridae.

[0013] The present invention also provides a Stenotrophomonas maltophilia phage, the phage CP-p-PMA-23032, the preservation number is: CGMCC NO.45677; the phage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023, the preservation address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, and is classified and named Myoviridae.

[0014] The present invention also provides a Stenotrophomonas maltophilia phage, the phage CP-p-PMA-23036, the preservation number is: CGMCC NO.45678; the phage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023, the preservation address is: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as the long-tailed virus family Siphoviridae.

[0015] The present invention also provides a Stenotrophomonas maltophilia phage composition, which comprises any two or more combinations of phage CP-p-PMA-23015, phage CP-p-PMA-23011, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 or phage CP-p-PMA-23036.

[0016] The present invention also provides a Stenotrophomonas maltophilia phage composition, which is a combination of phage CP-p-PMA-23015 and one or more of phage CP-p-PMA-23011, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 or phage CP-p-PMA-23036.

[0017] As a preferred embodiment, bacteriophage CP-p-PMA-23011 comprises the specific nucleotide sequence shown in SEQ ID NO: 13; bacteriophage CP-p-PMA-23015 comprises the specific nucleotide sequence shown in SEQ ID NO: 14; bacteriophage CP-p-PMA-23022 comprises the specific nucleotide sequence shown in SEQ ID NO: 15; bacteriophage CP-p-PMA-23028 comprises the specific nucleotide sequence shown in SEQ ID NO: 16; bacteriophage CP-p-PMA-23032 comprises the specific nucleotide sequence shown in SEQ ID NO: 17; and bacteriophage CP-p-PMA-23036 comprises the specific nucleotide sequence shown in SEQ ID NO: 18.

[0018] The present invention also provides a preparation for preventing and controlling Stenotrophomonas maltophilia, wherein the preparation comprises the Stenotrophomonas maltophilia bacteriophage or the Stenotrophomonas maltophilia phage composition.

[0019] As a preferred embodiment, the preparation is an antimicrobial drug and / or an environmental disinfectant.

[0020] The present invention also provides a primer set for detecting Stenotrophomonas maltophilia phage for non-disease diagnosis purposes, the phage comprising any one of CP-p-PMA-23011, CP-p-PMA-23015, CP-p-PMA-23022, CP-p-PMA-23028, CP-p-PMA-23032 or CP-p-PMA-23036, wherein the primer set of CP-p-PMA-23011 is a primer pair P-PMA011-F / P-PMA011-R, the nucleotide sequence of P-PMA011-F is shown in SEQ ID NO: 1, and the nucleotide sequence of P-PMA011-R is shown in SEQ ID NO: 2. The primer set of CP-p-PMA-23015 is a primer pair P-PMA015-F / P-PMA015-R, the nucleotide sequence of P-PMA015-F is shown in SEQ ID NO: 3, and the nucleotide sequence of P-PMA015-R is shown in SEQ ID NO: 4. The primer set of CP-p-PMA-23022 is a primer pair P-PMA022-F / P-PMA022-R, the nucleotide sequence of P-PMA022-F is shown in SEQ ID NO: 5, and the nucleotide sequence of P-PMA022-R is shown in SEQ ID NO: 6; the primer set of CP-p-PMA-23028 is a primer pair P-PMA028-F / P-PMA028-R, the nucleotide sequence of P-PMA028-F is shown in SEQ ID NO: 7, and the nucleotide sequence of P-PMA028-R is shown in SEQ ID NO: 8; the primer set of CP-p-PMA-23032 is a primer pair P-PMA032-F / P-PMA032-R, the nucleotide sequence of P-PMA032-F is shown in SEQ ID NO: 9, and the nucleotide sequence of P-PMA032-R is shown in SEQ ID NO: NO: 10; the primer set of CP-p-PMA-23036 is a primer pair P-PMA036-F / P-PMA036-R, the nucleotide sequence of P-PMA036-F is shown in SEQ ID NO: 11, and the nucleotide sequence of P-PMA036-R is shown in SEQ ID NO: 12.

[0021] The present invention also provides an application of a Stenotrophomonas maltophilia phage or a Stenotrophomonas maltophilia phage composition in preventing and controlling Stenotrophomonas maltophilia contamination.

[0022] The sequence involved in the present invention is as follows:

[0023] SEQ ID NO: sequence 1 5′GTGCAGGTAATCAACTCCTGCC 3′ 2 5′TTAGTGAACGATGTAGTTGGGTCCG 3′ 3 5′TCCTGTCTGCGGTCCTGT 3′ 4 5′GGATACCCACCATGTTGTA 3′ 5 5′ACCATCATCGTCTGCGTCTC 3′ 6 5′TTCGTCAAGGGTCATCAAA 3′ 7 5′TACGAGGAGGAAGCATGACG 3′ 8 5′CACGGTGACGCATGGGAT 3′ 9 5′CGCTGAACTGGTTGATGGCAATG 3′ 10 5′TGCACAGATTGGTCGCATCGTTC 3′ 11 5′GTGGTACGACGCGATGACTC 3′ 12 5′CGAATGTCGGGTTCGTCCAC 3′

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. The present invention isolates multiple strains of Stenotrophomonas maltophilia phages (a total of 24 strains) from different environments, uses 60 clinically resistant Stenotrophomonas maltophilia from multiple hospitals in different regions of the country to analyze the lysis spectrum of the isolated 24 strains of Stenotrophomonas maltophilia phages, and finds that two of the Stenotrophomonas maltophilia phages have obvious lysis advantages over other phages. Among them, the Stenotrophomonas maltophilia phages CP-p-PMA-23011 and CP-p-PMA-23015 can lyse 21 and 23 different Stenotrophomonas maltophilia, respectively, and have great potential in clinical applications.

[0026] 2. The optimal multiplicity of infection of the Stenotrophomonas maltophilia phage CP-p-PMA-23011 provided by the present invention is 10 -6 Therefore, during the production process, only a very small amount of mother liquid or seed liquid is needed to amplify a large number of progeny phages, which has a high production efficiency; the optimal infection multiplicity of CP-p-PMA-23015 is 10 -3 The optimal infection multiplicity of CP-p-PMA-23022, CP-p-PMA-23028 and CP-p-PMA-23036 was 10 -2 ; The optimal infection multiplicity of CP-p-PMA-23032 is 10 2 The titers of phages CP-p-PMA-23011, CP-p-PMA-23015, CP-p-PMA-23022, CP-p-PMA-23028, CP-p-PMA-23032, and CP-p-PMA-23036 were all over 8×10 8 PFU / mL; the lysis period of bacteriophages CP-p-PMA-23011, CP-p-PMA-23015, CP-p-PMA-23022, CP-p-PMA-23028, CP-p-PMA-23032 and CP-p-PMA-23036 did not exceed 20 min, and these phages were able to amplify in large quantities in a short time, indicating that these phages have efficient lysis activity.

[0027] 3. The Stenotrophomonas maltophilia phage provided by the present invention can specifically kill Stenotrophomonas maltophilia, regardless of whether the bacteria contain drug-resistant genes.

[0028] 4. The Stenotrophomonas maltophilia phage composition provided by the present invention broadens the host spectrum and lysis ability, and has broad application potential in clinical treatment of Stenotrophomonas maltophilia infection and environmental purification.

[0029] 5. The present invention uses 60 clinical strains of Stenotrophomonas maltophilia isolated from sewage in different environments in different regions, and conducts phage-host interaction analysis to provide a Stenotrophomonas maltophilia phage composition. Compared with a single phage, the phage composition broadens the host spectrum that can be lysed and greatly improves the coverage rate.

[0030] 6. The phages in the Stenotrophomonas maltophilia phage composition provided by the present invention have a synergistic effect, which enhances the lysis effect of the phages on bacteria and can effectively slow down the production of phage-tolerant bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is a diagram of the phage purification results of the present invention, wherein A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036.

[0032] Figure 2 It is the transmission electron microscopy result diagram of the phage of the present invention, wherein A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036.

[0033] Figure 3 It is the electrophoresis diagram of the PCR-amplified phage-specific sequence nucleic acid of the present invention, A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036, wherein the left band in Figure AF is the Marker, and the right band is the corresponding phage band.

[0034] Figure 4This is a graph showing the optimal infection multiplicity results of the Stenotrophomonas maltophilia phage of the present invention, wherein A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036.

[0035] Figure 5 This is a one-step growth curve of the phage of the present invention, wherein A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036.

[0036] Figure 6 This is a temperature stability diagram of the bacteriophage of the present invention, wherein A is bacteriophage CP-p-PMA-23011, B is bacteriophage CP-p-PMA-23015, C is bacteriophage CP-p-PMA-23022, D is bacteriophage CP-p-PMA-23028, E is bacteriophage CP-p-PMA-23032, and F is bacteriophage CP-p-PMA-23036.

[0037] Figure 7 This is a pH stability diagram of the bacteriophage of the present invention, wherein A is bacteriophage CP-p-PMA-23011, B is bacteriophage CP-p-PMA-23015, C is bacteriophage CP-p-PMA-23022, D is bacteriophage CP-p-PMA-23028, E is bacteriophage CP-p-PMA-23032, and F is bacteriophage CP-p-PMA-23036.

[0038] Figure 8is the bactericidal curve of the bacteriophage and the bacteriophage combination CPD-PMA01 of the present invention, wherein A is the bactericidal curve of bacteriophage CP-p-PMA-23011, bacteriophage CP-p-PMA-23015, bacteriophage CP-p-PMA-23022, bacteriophage CP-p-PMA-23028, bacteriophage CP-p-PMA-23032, bacteriophage CP-p-PMA-23036 and bacteriophage combination CPD-PMA01 against Stenotrophomonas maltophilia CP-b-PMA-23001 A is the bactericidal curve of bacteriophage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032, phage CP-p-PMA-23036 and phage combination CPD-PMA01 against Stenotrophomonas maltophilia CP-b-PMA-23035; the neg-con group is the negative control group in which host bacteria were added but phages were not added. DETAILED DESCRIPTION

[0039] The technical solution of the present invention is described in detail below in conjunction with the embodiments. The reagents and biological materials used below are all commercial products unless otherwise specified.

[0040] (1) LB (Luria broth) liquid medium (1 L): peptone 10 g, yeast powder 5 g, NaCl 10 g, add ddH2O to 1 L, adjust pH to 7.0, and sterilize at 121°C for 20 min.

[0041] (2) 0.5% LB semisolid medium (1 L): peptone 10 g, yeast powder 5 g, NaCl 10 g, agar powder 5 g, add ddH2O to 1 L, adjust pH to 7.0, and sterilize at 121°C for 20 min.

[0042] (3) 1.5% LB solid medium (1 L): 10 g of peptone, 5 g of yeast powder, 10 g of NaCl, 15 g of agar powder, add ddH2O to 1 L, adjust the pH to 7.0, sterilize at 121°C for 20 min, cool to 50°C, pour into a plate, cool and solidify, and then invert for later use.

[0043] Example 1: Isolation of Stenotrophomonas maltophilia phage

[0044] The sewage sample was collected from an environmental sewage in Shanghai. 20 mL of sewage sample was centrifuged at 4 ° C and 12000 rpm for 10 min. The supernatant was filtered with a 0.22 μm filter membrane and the filtrate was set aside. Take 9 mL of supernatant filtrate, add 1 mL of 10 times LB liquid culture medium, and add 0.1 mL of phage logarithmic phase host bacteria liquid, and place it at 37 ° C for overnight culture. The next day, centrifuge at 4 ° C and 12000 rpm for 10 min, and filter the supernatant with a 0.22 μm filter membrane to sterilize, forming a stock solution containing phage, that is, phage suspension. Take different clinical drug-resistant strains and streak them on 1.5% LB solid culture medium. After culturing at 37 ° C overnight, pick a single clone and inoculate it in 5 mL LB liquid culture medium. After shaking and culturing at 37 ° C for 8 hours, it is used as a host bacteria culture for standby. Take 0.3mL of the above-mentioned spare host bacteria culture and 3mL of 0.5% LB semi-solid medium, mix them evenly, and spread them on 1.5% LB solid medium. After drying, divide the agar plate into 2 areas, take 10μL of the above-mentioned phage suspension and drop it on one area, and drop an equal amount of PBS on the other area as a control. After drying naturally, place it in a 37℃ incubator and observe whether there are plaques formed in the phage drop area. If there are plaques, it proves that phages exist.

[0045] Example 2: Purification of Stenotrophomonas maltophilia phage

[0046] The phage plaques in Example 1 were picked up and placed in a sterile EP tube containing 0.5 mL PBS, and placed at 4°C overnight to release the phages to obtain a phage extract. The phage extract was diluted 10 times in a row using the double-layer plate method, and 10 -2 , 10 -4 , 10 -6 Add 0.3 mL of logarithmic phase host bacterial solution to 0.1 mL of diluent, add 3 mL of 0.5% LB semi-solid medium at about 55°C, evenly spread on a pre-prepared solid LB plate, and invert and culture at 37°C for 5-10 hours to obtain a double-layer plate with plaques. Pick a single transparent, uniform-sized, and regular-edged plaque again and put it into a sterile EP tube filled with 0.5 mL of PBS to obtain a phage extract. Repeat the above steps 3 times to obtain a purified phage suspension for later use.

[0047] Example 3: Clustering and lysis spectrum analysis of Stenotrophomonas maltophilia phage and bacteria

[0048] According to the lysis correspondence between phage and host, we can perform cluster analysis on phage and bacteria respectively. Different objects clustered in the same cluster have great similarities, and objects in different clusters have great differences. The specific analysis process is as follows:

[0049] (1) First, 60 clinically resistant Stenotrophomonas maltophilia strains from multiple hospitals in different regions of the country and 34 Stenotrophomonas maltophilia phage strains isolated from different sewage were used for lysis spectrum analysis. The specific operation is as follows:

[0050] 1) Take 0.3 mL of the logarithmic phase bacterial solution of Stenotrophomonas maltophilia, add 3 mL of 0.5% LB semi-solid medium at about 55° C., and evenly spread it on the pre-prepared solid 1.5% LB solid medium;

[0051] 2) Then, each plate was divided into two areas, 2 μL of the reserved phage in Example 2 was dripped into one area, and an equal amount of PBS was dripped into the other area as a control, and after the droplets dried, they were inverted and cultured at 37°C for 12 hours. Phage plaques are empty plaques formed by phage lysis on the plate where bacteria grow, and are classified as present (+) or absent (blank) according to the presence or absence of phage plaques.

[0052] (2) The lysis spectrum results were statistically analyzed and classified into large and clear (LC), small and clear (SC), large and turbid (LO), small and turbid (SO), and no plaque (NP) according to the plaque morphology;

[0053] (3) Convert the symbol of the plaque transparency into a numerical value (0 means no plaque, 1 means blurred plaque, 2 means small and transparent plaque, and 3 means large and transparent plaque);

[0054] (4) Use RStudio software to load the R package functions for drawing;

[0055] (5) Analyze the generated clustering results.

[0056] Experimental results: The results are shown in Table 1, which is the lysis spectrum results of 24 strains of Stenotrophomonas maltophilia phage. According to the lysis spectrum and cluster analysis results, phage CP-p-PMA-23011 with a relatively broad host spectrum and complementary to each other was selected and combined with one or more of phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 or phage CP-p-PMA-23036.

[0057] Single phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 can lyse 21, 23, 12, 3, 4 and 16 strains of Stenotrophomonas maltophilia, respectively; among them, the "cocktail" combination of phage CP-p-PMA-23011 and one or more of the other five phages can lyse up to 52 strains of Stenotrophomonas maltophilia, and the coverage rate can reach 86.7% (52 / 60). Compared with single phage, the "cocktail" phage broadens the host spectrum that can be lysed, and the coverage rate is greatly improved.

[0058] Table 1

[0059]

[0060]

[0061]

[0062] Note: "+" represents bacteria that were lysed by phage, and a space represents bacteria that could not be lysed by phage.

[0063] Example 4: Expansion of Stenotrophomonas maltophilia phage

[0064] Experimental method: Take 40 mL of LB liquid culture medium, add 0.4 mL of logarithmic host bacterial solution, place it in a 37°C shaker at 200 rpm and culture it for 1-2 h in the logarithmic phase, then add 0.05 mL of the purified phage suspension in Example 2, continue to place it in a 37°C shaker at 200 rpm and culture until the liquid in the test tube becomes clear, and then centrifuge and filter it for use.

[0065] The double-layer plate method was used to detect the phage titer: the phage suspension was diluted 10 times in a gradient, 0.1 mL of the phage dilution in each gradient was taken and mixed with 0.3 mL of the host bacterial solution, and then spread on a double-layer agar plate. The plate was cultured at 37°C for about 5-10 h, and the plaques were counted on each agar plate. The plate with about 30-300 plaques was selected, and the initial phage concentration was calculated according to the dilution multiple, which was the phage titer (PFU / mL = dilution multiple × number of plaques × 10).

[0066] Test results: Figure 1It is a diagram of the phage purification results of the present invention, wherein A is phage CP-p-PMA-23011, B is phage CP-p-PMA-23015, C is phage CP-p-PMA-23022, D is phage CP-p-PMA-23028, E is phage CP-p-PMA-23032, and F is phage CP-p-PMA-23036.

[0067] like Figure 1 As shown in the figure, bacteriophage CP-p-PMA-23011 can form clear plaques in agar medium, surrounded by a halo, with clear and regular edges, a diameter of about 4 mm, and a titer of 3×10 9 PFU / mL, which is a typical lytic phage.

[0068] Bacteriophage CP-p-PMA-23015 can form clear plaques in agar medium, with no halo around, clear and regular edges, a diameter of about 4 mm, and a titer of 1×10 9 PFU / mL, which is a typical lytic phage.

[0069] Bacteriophage CP-p-PMA-23022 can form clear plaques in agar medium, with no halo around them, clear and regular edges, a diameter of about 2.5 mm, and a titer of 2×10 9 PFU / mL, which is a typical lytic phage.

[0070] Bacteriophage CP-p-PMA-23028 can form clear plaques in agar medium, with no halo around, clear and regular edges, a diameter of about 3 mm, and a titer of 1.5×10 9 PFU / mL, which is a typical lytic phage.

[0071] Bacteriophage CP-p-PMA-23032 can form clear plaques in agar medium, with no halo around, clear and regular edges, a diameter of about 1.5 mm, and a titer of 1x10 10 pFU / mL, which is a typical lytic phage.

[0072] Bacteriophage CP-p-PMA-23036 can form clear plaques in agar medium, with no halo around, clear and regular edges, a diameter of about 3 mm, and a titer of 2×10 9 PFU / mL, which is a typical lytic phage.

[0073] Example 5: Transmission electron microscopy observation of Stenotrophomonas maltophilia phage

[0074] Experimental method: Take the phage suspension in Example 4 for electron microscopy observation, drop 10uL of the purified phage suspension in Example 2 on a copper sheet, let it precipitate naturally for 10 minutes, absorb the excess liquid with filter paper, add a drop of 2% phosphotungstic acid (PTA, 2% w / v) for staining for 1-2 minutes, and observe using a transmission electron microscope after drying at room temperature.

[0075] Test results: Figure 2 The transmission electron microscopy results of the bacteriophages of the present invention are shown in Figure 1, wherein A is bacteriophage CP-p-PMA-23011, B is bacteriophage CP-p-PMA-23015, C is bacteriophage CP-p-PMA-23022, D is bacteriophage CP-p-PMA-23028, E is bacteriophage CP-p-PMA-23032, and F is bacteriophage CP-p-PMA-23036. The observation results are as follows: Figure 2 As shown:

[0076] Bacteriophage CP-p-PMA-23011 has a regular icosahedral head with a diameter of about 60 nm and a short, non-contractile tail of about 10 nm. According to the "Taxonomy of Viruses: The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, bacteriophage CP-p-PMA-23011 belongs to the short-tailed virus family.

[0077] The bacteriophage CP-p-PMA-23015 has a regular icosahedral head with a diameter of about 60nm and a short, non-contractible tail of about 10nm. According to the "Virus Classification - The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, the bacteriophage CP-p-PMA-23015 belongs to the Podoviridae family.

[0078] The bacteriophage CP-p-PMA-23022 has a regular icosahedral head with a diameter of about 55nm and a long and retractable tail of about 150nm. According to the "Virus Classification - The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, the bacteriophage CP-p-PMA-23022 belongs to the Siphoviridae family.

[0079] The bacteriophage CP-p-PMA-23028 has a regular icosahedral head with a diameter of about 55nm and a short, non-contractible tail with a length of about 5nm. According to the "Virus Classification - The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, the bacteriophage CP-p-PMA-23028 belongs to the Podoviridae family.

[0080] Bacteriophage CP-p-PMA-23032 has a regular icosahedral head with a diameter of about 80nm and a long and retractable tail with a length of about 120nm. According to the "Taxonomy of Viruses - The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, bacteriophage CP-p-PMA-23032 belongs to the Myoviridae family.

[0081] Bacteriophage CP-p-PMA-23036 has a regular icosahedral head with a diameter of about 55nm and a long and retractable tail with a length of about 150nm. According to the "Taxonomy of Viruses - The Eighth Report of the International Committee on Taxonomy of Viruses" published by the International Committee on Taxonomy of Viruses (ICTV) in 2015, bacteriophage CP-p-PMA-23036 belongs to the Siphoviridae family.

[0082] Example 6: Genome extraction, sequencing and specificity verification of Stenotrophomonas maltophilia phage

[0083] Experimental method: (1) Take 10 mL of each of bacteriophage CP-p-PMA-23011, bacteriophage CP-p-PMA-23015, bacteriophage CP-p-PMA-23022, bacteriophage CP-p-PMA-23028, bacteriophage CP-p-PMA-23032 and bacteriophage CP-p-PMA-23036 in Example 4, add DNase I (10 U / μg) and RNase A (10 U / μg) with a final concentration of 1 μg / mL, mix thoroughly and incubate at 37°C for 30 min;

[0084] (2) Add EDTA to a final concentration of 25 mM and incubate at 65°C for 10 min (to inactivate DNase);

[0085] (3) At the beginning of this step, nucleic acid was extracted using the M5λ phage genomic DNA rapid extraction kit;

[0086] (4) After verification by 1% agarose gel nucleic acid electrophoresis, the concentration and purity were determined by NanoDrop-300, and the product was sent to Shanghai Paisono Biotechnology Co., Ltd. for sequencing.

[0087] (5) The genome sequences of Stenotrophomonas maltophilia phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032, and phage CP-p-PMA-23036 were analyzed through the website, and specific nucleotide sequences were selected and primers were designed. The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0088] (6) Construct a PCR reaction system. Table 2 shows the PCR system for amplifying the specific sequences of Stenotrophomonas maltophilia phage CP-p-PMA-23011, phage CP-p-PMA-23015, CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036. The PCR reaction program is: 94°C pre-denaturation for 10 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 90 s (32 cycles in total), and 72°C final extension for 10 min. Take 5 μL of PCR product for 1% agarose gel nucleic acid electrophoresis and observe the results. The remaining PCR product was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing.

[0089] The results of whole genome sequencing showed that the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23011 was 43145bp; the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23015 was 43135bp; the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23022 was 62148bp; the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23028 was 43310bp; the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23032 was 159967bp; and the complete genome size of Stenotrophomonas maltophilia phage CP-p-PMA-23036 was 63011bp.

[0090] Table 2 PCR system for amplifying the specific sequence of Stenotrophomonas maltophilia phage

[0091] system Volume (μl) 2x Taq Mix 25 F 1 R 1 Template 1 Water 22 Total 50

[0092] PCR verification was performed using the primer pair 1 shown in Table 3: P-PMA011-F / P-PMA011-R, with the genome of the Stenotrophomonas maltophilia phage CP-p-PMA-23011 as a template. Figure 3 As shown in A, Figure 3 A is the electrophoresis diagram of the PCR-amplified phage-specific sequence nucleic acid of the present invention, wherein: Figure 3 The right band in A represents the amplification of the phage-specific sequence nucleic acid band using the primer pair: P-PMA011-F / P-PMA011-R, and the left band is the Marker. The primers can amplify the corresponding specific target band, and the band size is 552bp, which is consistent with the expected size, proving that the primers can specifically verify the Stenotrophomonas maltophilia phage CP-p-PMA-23011. According to the above operation, different primers were used to verify the specific sequence nucleic acid electrophoresis results of phage CP-p-PMA-23015, CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036, respectively. Figure 3 B-3E shows that all of them can obtain results consistent with the expected band size. Among them, the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23011 is shown in SEQ ID NO.13; the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23015 is shown in SEQ ID NO.14; the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23022 is shown in SEQ ID NO.15; the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23028 is shown in SEQ ID NO.16; the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23032 is shown in SEQ ID NO.17; the specific nucleotide sequence amplified by the primers of bacteriophage CP-p-PMA-23036 is shown in SEQ ID NO.18;

[0093] Table 3

[0094]

[0095]

[0096] Example 7: Determination of the optimal multiplicity of infection (MOI) of Stenotrophomonas maltophilia phage

[0097] The multiplicity of infection (MOI) is the ratio of the number of bacteriophages to the number of bacteria.

[0098] Experimental method: (1) Take the host bacterial culture prepared in Example 1 and transfer it to the logarithmic phase (OD 600 nm=0.5), and adjust the concentration to 1×10 8 CFU / mL for later use; dilute the phage culture solution in Example 4 to 1×10 9 PFU / mL, 1×10 8PFU / mL, 1×10 7 PFU / mL, 1×10 6 PFU / mL, 1×10 5 PFU / mL, 1×10 4 PFU / mL, 1×10 3 PFU / mL, 1×10 2 PFU / mL and 1×10 1 PFU / mL for standby use;

[0099] (2) According to the multiplicity of infection, 10 , 10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 100 μL of the reserved phage dilution, 100 μL of the host bacterial culture and 5 mL of LB liquid medium were mixed evenly and cultured in a shaker at 37°C and 200 rpm for 5 h;

[0100] (3) Take 1 mL of lysate and centrifuge at 8000 rpm for 10 min at 4°C. Collect the supernatant and filter through a 0.22 μm filter membrane.

[0101] (4) Take 100 μL of the filtrate in step (3) and dilute it 10 times in a series;

[0102] (5) Take 100 μL of the diluent and mix it with 300-400 μL of the bacterial suspension. After standing for 5-10 min, add it to a 0.5% semi-solid culture medium cooled to about 55°C, mix it, spread it on a double-layer plate, and invert it in a 37°C constant temperature incubator for overnight culture;

[0103] (6) Observe the plate and calculate the phage titer. Repeat the experiment three times and draw a bar graph.

[0104] Test results: The results are as follows Figure 4 As shown, Figure 4 is the optimal infection multiplicity of the Stenotrophomonas maltophilia phage of the present invention, and the optimal infection multiplicity of Stenotrophomonas maltophilia phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 are 10, respectively. -6 , 10 -3 , 10 -2 , 10 -2, 10 2 , 10 -2 , the titer can reach 3×10 9 , 6×10 8 , 8.5×10 8 , 5.2×10 8 , 8.5×10 8 , 2.5×10 9 PFU / mL.

[0105] Example 8: One-step growth curve assay of Stenotrophomonas maltophilia phage

[0106] Test method: One-step growth curve can reflect the replication characteristics of bacteriophage, including latent period and outbreak period. The specific method is as follows:

[0107] (1) Take the host bacterial culture prepared in Example 1 and transfer it to fresh culture medium at a ratio of 1:100, and add CaCl2 with a final concentration of 5 mmol / L to culture the bacteria to the logarithmic phase (OD 600 nm=0.5);

[0108] (2) Take 1 mL of the host bacteria cultured to the logarithmic growth phase, add the phage culture solution prepared in Example 4 at a ratio of MOI = 0.1, mix well, and incubate in a 37° C. incubator for 5 min (to allow the bacteria to adsorb to the phage);

[0109] (3) Centrifuge at 4°C, 10,000 rpm for 1 min and discard the supernatant (unadsorbed phage);

[0110] (4) Take 1 mL of fresh LB liquid to resuspend the precipitate (mutually adsorbed bacteria and phage particles);

[0111] (5) Repeat steps (3) and (4), resuspending and washing at least twice;

[0112] (6) Finally, resuspend the pellet with 10 mL of fresh LB medium and incubate the resuspended test tube in a shaker at 37 °C at 200 rpm for 90 min. Samples were taken every 5 min (0, 5, 10, 15, 20, 25, 30 min) for the first 30 min, and then every 10 min (40, 50, 60, 70, 80, 90 min), taking out 600 μL of the culture mixture each time.

[0113] (7) Centrifuge at 4°C, 10,000 rpm for 1 min, collect the supernatant, and filter through a 0.22 μm filter membrane;

[0114] (8) Take 100 μL of the phage filtrate from step (6) and dilute it 10 times in a series;

[0115] (9) Take 100 μL of the diluent and mix it with 300 μL-400 μL of the bacterial suspension. After standing for 5-10 min, add it to a 0.5% semi-solid culture medium cooled to about 55°C, mix it, spread it on a double-layer plate, and invert it in a 37°C constant temperature incubator for overnight culture;

[0116] (10) Observe the plate and calculate the phage titer. Repeat the experiment three times and draw a one-step growth curve.

[0117] Test results: The results are as follows Figure 5 As shown, Figure 5 This is a one-step growth curve of the phage of the present invention. The incubation periods of Stenotrophomonas maltophilia phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 infecting host bacteria are 10 min, 0 min, 0 min, 10 min, 20 min, 15 min, respectively, and one lysis cycle is 30 min, 25 min, 30 min, 40 min, 90 min, 50 min, respectively; wherein, one lysis cycle includes a latent period, an outbreak period and a plateau period; the above results indicate that these phages can be amplified in large quantities in a short period of time, indicating that these phages have efficient lysis activity.

[0118] Example 9: Determination of the temperature stability of Stenotrophomonas maltophilia phage

[0119] Test method: In order to detect the temperature stability of isolated bacteriophages, a total of 10 temperature values ​​(0℃~80℃) were set in this study. The specific method is as follows:

[0120] (1) Take 10 sterile 1.5 mL centrifuge tubes and number them as follows: 4°C, 25°C, 37°C, 40°C, 50°C, 60°C, 70°C, 80°C, 90°C, 100°C;

[0121] (2) Add 1 mL of phage stock solution to each centrifuge tube, and place the corresponding numbered phage stock solutions in 10 different temperature environments for reaction for 60 min;

[0122] (3) Take 100 μL of the phage stock solution at each temperature after treatment and perform a 10-fold gradient dilution to 10 -6 times;

[0123] (4) Select three different dilutions for plating and culture overnight on double-layer agar plates containing the corresponding host bacteria;

[0124] (5) On the second day, select a plate with an appropriate number of plaques (20 to 200 plaques) to calculate the phage titer. The above experiment was repeated 3 times.

[0125] Test results: The results are as follows Figure 6 As shown, Figure 6 The temperature stability of the phage of the present invention is that the titer of the phage CP-p-PMA-23011 and phage CP-p-PMA-23015 of Stenotrophomonas maltophilia remains stable when the temperature is less than or equal to 40°C, the titer gradually decreases when the temperature is greater than 40°C, and the phage is inactivated when the temperature rises to 70°C; the titer of phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 remains stable when the temperature is less than or equal to 50°C, the titer gradually decreases when the temperature is greater than 50°C, and the phage is inactivated when the temperature rises to 70°C. It can be seen that the phage of the present invention has good temperature stability and can withstand a certain degree of high temperature.

[0126] Example 10: Determination of acid-base stability of Stenotrophomonas maltophilia phage

[0127] Test method: In order to detect the acid-base stability of isolated phages, a total of 12 pH values ​​(pH = 2-13) were set in this study. The specific method is as follows:

[0128] (1) Prepare solutions with pH values ​​of 2 to 13 using sterile PBS buffer, sodium hydroxide, and concentrated hydrochloric acid. Dispense 0.9 mL of each solution into 1.5 mL centrifuge tubes for later use.

[0129] (2) Take 100 μL of purified and filtered phage solution (titer 1×10 9 PFU / mL) were added into 1 mL of sterile PBS buffer with different pH values ​​(pH value is 2-13), vortexed to mix, and placed in a 37°C constant temperature incubator for 1 h;

[0130] (3) After 1 hour, take out the 1.5 mL centrifuge tubes with different pH values, take 100 μL from the 1.5 mL centrifuge tubes treated with different pH values, and perform 10-fold gradient dilution to 10 -6 times;

[0131] (4) Select three different dilution multiples for the spot method and culture overnight on a double-layer agar plate containing the host bacteria;

[0132] (5) On the second day, select a plate with an appropriate number of plaques (20 to 200 plaques) to count the number of plaques at different pH values ​​and calculate the phage titer. Repeat the above experiment three times.

[0133] Test results: The results are as follows Figure 7 As shown, Figure 7 The acid-base stability of the phage of the present invention is that when the pH value is between 3-11, the titers of Stenotrophomonas maltophilia phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 remain stable; when the pH value is between 2-3 or 11-12, the titer of the phage gradually decreases; when the pH value is less than 2 or greater than 12, the phage is inactivated. It can be seen that the phage of the present invention has good acid-base stability and can tolerate a certain degree of strong acid and strong base.

[0134] Example 11: Determination of the killing curve of Stenotrophomonas maltophilia phage

[0135] Experimental method: In order to detect whether there is a synergistic interaction between the phages of each strain of Stenotrophomonas maltophilia, the present invention selects two strains of Stenotrophomonas maltophilia (CP-b-PMA-23001 and CP-b-PMA-23035) as host bacteria for detection, and detects the bactericidal effects of six phages and phage cocktails on them over time (i.e., bactericidal curves), and the specific method is as follows:

[0136] (1) Add 200 μL LB liquid culture medium to each well of a 96-well cell culture plate, and add 5 μL CP-b-PMA-23001 or CP-b-PMA-23035 host bacterial culture solution. Repeat 3 times in each group, and place in a LogPhase600 fully automatic microbial growth detector for shaking and culture until the OD 600nm =0.1-0.2;

[0137] (2) Add 1 μL of a single phage or phage cocktail to each well, and set up a negative control group without phage for 24 h;

[0138] (3) After the reaction is completed, observe the experimental results and output the sterilization curve.

[0139] Test results: The results are as follows Figure 8 As shown, Figure 8The figure is the bactericidal curve of the phage of the present invention. The phage CP-p-PMA-23011, phage CP-p-PMA-23015, phage CP-p-PMA-23022, phage CP-p-PMA-23028, phage CP-p-PMA-23032 and phage CP-p-PMA-23036 of Stenotrophomonas maltophilia all have different degrees of inhibitory effect on the growth of Stenotrophomonas maltophilia CP-b-PMA-23001 and CP-b-PMA-23035; the phage combination CPD-PMA01 has a more obvious growth inhibitory effect on Stenotrophomonas maltophilia CP-b-PMA-23001 and CP-b-PMA-23035 than a single phage, and inhibits the growth of tolerant bacteria; the neg-con group is a negative control group in which host bacteria are added but no phage is added, and the bacteria grow normally. It can be seen that the combination of the six strains of Stenotrophomonas maltophilia phages in the present invention has an obvious synergistic effect on the lysis and inhibition of host bacteria.

[0140] The above are only some preferred embodiments of the present invention, and the present invention is not limited to the contents of the embodiments. For those skilled in the art, various changes and modifications can be made within the scope of the technical solution of the present invention, and any changes and modifications made are within the protection scope of the present invention.

Claims

1. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23015 has a deposit number of CCTCC NO: M20231695; the bacteriophage was deposited in the China Center for Type Culture Collection on September 13, 2023.

2. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23011 has a deposit number of CCTCC NO: M20231696; the bacteriophage was deposited in the China Center for Type Culture Collection on September 13, 2023.

3. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23022 has a deposit number of: CCTCC NO: M20231694; the bacteriophage was deposited in the China Center for Type Culture Collection on September 13, 2023.

4. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23028 has a deposit number of CGMCC NO. 45676; the bacteriophage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023.

5. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23032 has a deposit number of CGMCC NO. 45677; the bacteriophage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023.

6. A Stenotrophomonas maltophilia phage, characterized in that: The bacteriophage CP-p-PMA-23036 has a deposit number of CGMCC NO. 45678; the bacteriophage was deposited in the China General Microbiological Culture Collection Center on September 19, 2023.

7. A Stenotrophomonas maltophilia phage composition, characterized in that: The phage composition comprises any two or more combinations of the phage CP-p-PMA-23015 of claim 1, the phage CP-p-PMA-23011 of claim 2, the phage CP-p-PMA-23022 of claim 3, the phage CP-p-PMA-23028 of claim 4, the phage CP-p-PMA-23032 of claim 5, and the phage CP-p-PMA-23036 of claim 6.

8. A Stenotrophomonas maltophilia phage composition, characterized in that: The composition is a combination of the bacteriophage CP-p-PMA-23015 described in claim 1 and one or more of the bacteriophage CP-p-PMA-23011 described in claim 2, the bacteriophage CP-p-PMA-23022 described in claim 3, the bacteriophage CP-p-PMA-23028 described in claim 4, the bacteriophage CP-p-PMA-23032 described in claim 5, and the bacteriophage CP-p-PMA-23036 described in claim 6.

9. A preparation for controlling Stenotrophomonas maltophilia, characterized in that: The preparation is an antibacterial drug or an environmental disinfectant, and the preparation comprises the Stenotrophomonas maltophilia phage according to any one of claims 1 to 6 or the Stenotrophomonas maltophilia phage composition according to claim 7 or 8.

10. Use of the Stenotrophomonas maltophilia phage according to any one of claims 1 to 6 or the Stenotrophomonas maltophilia phage composition according to claim 7 or 8 in preventing and controlling Stenotrophomonas maltophilia contamination for non-therapeutic purposes.

Images