A method and application of one-tube nucleic acid detection for Chlamydia psittaci

Abstract

The present invention relates to the field of chlamydia detection technology, and in particular to a method and application of one-tube nucleic acid detection of psittacosis chlamydia. The present invention provides a psittacosis chlamydia RAA primer pair as shown in SEQ ID NO.1-2 and a crRNA molecule as shown in SEQ ID NO.3 based on RAA and CRISPR / CAS technology, and constructs a one-tube RAA-CRISPR-Cas12a reaction system to perform on-site visual detection or fluorescence detection of psittacosis chlamydia genes without power supply, and the result can be determined by naked eye within 20 minutes. The method provided by the present invention has few detection equipment used, low cost, can realize visual detection, and the whole process of sealing tube operation, and no aerosol pollution will be generated. Its application may help control the pandemic of psittacosis chlamydia.

Description

Technical Field

[0001] The present invention relates to the technical field of Chlamydia detection, and in particular to a method and application of one-tube nucleic acid detection of Chlamydia psittaci. Background Art

[0002] Psittacosis is a zoonotic infectious disease caused by Chlamydophila Psittaci. Sporadic cases have been reported in countries around the world, and cluster outbreaks have occasionally occurred. The causative pathogen, Chlamydophila Psittaci, is a prokaryotic intracellular bacterium. It is named because it was first isolated from parrots and is the most common host. It can cause potential infections in birds, poultry, and mammals. Humans are mostly infected through contact or inhalation of the shedding of infected animals, and human-to-human transmission is rare. The clinical manifestations of psittacosis pneumonia are diverse but non-specific, with varying degrees of severity, ranging from asymptomatic infection to rapid progression to severe respiratory failure, and are difficult to distinguish from other community-acquired pneumonia. Currently, serological tests, pathogen isolation and culture, and molecular tests can assist in diagnosis. However, the diagnosis of the disease requires etiological evidence, given that traditional microbiological examinations and routine tests are difficult to confirm the diagnosis of psittacosis.

[0003] However, the culture of Chlamydia psittaci must be carried out in a biosafety laboratory at level II or above, which takes several days of culture time. The equipment and reagents are expensive and there are great risks. The disadvantages of Chlamydia psittaci antigen detection technology are poor repeatability; it is easily interfered by autoantibodies, heterophilic antibodies, etc., and false positives are prone to occur. PCR detection technology requires endpoint detection and requires opening the lid for gel electrophoresis, which is very easy to form aerosol contamination, affecting the subsequent detection time. The operation is cumbersome and the total detection time is close to 3 hours; and there is non-specific amplification. When the non-specific band is the same size as the target band, it cannot be distinguished. The disadvantages of loop-mediated isothermal amplification technology are: the requirements for primers are particularly high, and the amplified product cannot be used for cloning and sequencing; due to its high sensitivity, it forms aerosols, causing false positives that affect the test results, and because the amplified product fragments are large, it is difficult to remove aerosol contamination after forming.

[0004] Recombinase-mediated strand replacement nucleic acid amplification (RAA) is a constant temperature rapid nucleic acid amplification technology that uses recombinases obtained from bacteria or fungi. At room temperature, the recombinase can bind tightly to the primer DNA to form a polymer of enzyme and primer. When the primer searches for a complementary sequence that completely matches it on the template DNA, it opens the double-stranded structure of the template DNA with the help of single-stranded binding proteins, and forms a new complementary DNA chain under the action of DNA polymerase, and the amplified product grows exponentially.

[0005] The CRISPR / Cas system is derived from the adaptive immune system of bacteria and archaea. Under the guidance of CRISPR RNA (crRNA) or guide RNA (single-guide RNA, sgRNA), some Cas proteins have trans-splicing activity that can be activated by the target in addition to the cis-splicing activity that recognizes and splices specific targets. That is, after these Cas proteins and crRNA specifically recognize the target, they can be activated to perform trans-splicing activity against ssDNA or ssRNA. Therefore, the CRISPR / Cas system has the potential to detect nucleic acids.

[0006] In the existing technology, the detection of Chlamydia psittaci based on RAA and CRISPR / Cas technology has not yet been achieved. Summary of the invention

[0007] The present invention provides a method and application of one-tube nucleic acid detection of Chlamydia psittaci. Specifically, the present invention detects Chlamydia psittaci based on RAA and CRISPR / CAS technology.

[0008] In a first aspect, the present invention provides a Chlamydia psittaci RAA primer pair, the sequence of which is shown in SEQ ID NO.1-2.

[0009] In a second aspect, the present invention provides a crRNA molecule for detecting Chlamydia psittaci based on CRISPR / CAS technology, and the sequence of the crRNA molecule is shown in SEQ ID NO.3.

[0010] In a third aspect, the present invention provides a Chlamydia psittaci RAA-CRISPR / CAS reaction system, comprising: the Chlamydia psittaci RAA primer pair and the crRNA molecule; and also comprising: ssDNA and Cas12a protein, wherein the ssDNA is FAM-TTTTTTTTTT-BHQ1.

[0011] In the Chlamydia psittaci RAA-CRISPR / CAS reaction system provided by the present invention, in terms of concentration, the ratio of the final concentration of Cas12a protein to the final concentration of crRNA is (15-55): (50-250).

[0012] Preferably, the ratio of the final concentration of Cas12a protein to the final concentration of crRNA is 25:50.

[0013] In the psittacosis RAA-CRISPR / CAS reaction system provided by the present invention, the components of the psittacosis RAA-CRISPR / CAS reaction system include: 2-10 mmol / L dNTP, 0.2-1.0 μmol / L single-stranded binding protein, 1.0-2.0 μmol / L recombinase protein, 0.2-1.0 U / μL DNA polymerase, 10-50 mmol / L TrisHCl, 40-80 mmol / L NaCl, 6-10 mmol / L dithiothreitol, 1.0-5.0 μmol / L psittacosis RAA upstream and downstream primers, 0.2-1 μmol / L crRNA, 0.1-0.5 μmol / L LbCas12a, 0.1-1 U / μL Exo exonuclease, 0.1-0.5 nmol / L ssDNA and 0.4-1.0 U / μL RNase Inhibitor;

[0014] The sequences of the upstream and downstream primers of Chlamydia psittaci RAA are shown in SEQ ID NO.1-2, and the sequence of crRNA is shown in SEQ ID NO.3.

[0015] The psittacosis RAA-CRISPR / CAS reaction system provided by the present invention can be prepared as a detection reagent or a kit. More specifically, for ease of use, the psittacosis RAA-CRISPR / CAS reaction system provided by the present invention can be prepared into a psittacosis one-tube nucleic acid detection lyophilized liquid, lyophilized powder or lyophilized tube.

[0016] When preparing a psittacosis Chlamydia one-tube nucleic acid detection freeze-dried liquid, freeze-dried powder or freeze-dried tube, the freeze-dried liquid, freeze-dried powder or freeze-dried tube also includes: a freeze-dried protective agent, which contains 10-15mmol / L trehalose, 20-25mmol / L mannitol and 5-20% bovine serum albumin.

[0017] Therefore, in a fourth aspect, the present invention provides the use of the above-mentioned Chlamydia psittaci RAA-CRISPR / CAS reaction system in the preparation of a psittaci Chlamydia psittaci one-tube nucleic acid detection freeze-dried liquid, freeze-dried powder or freeze-dried tube.

[0018] In a fifth aspect, the present invention provides a one-tube freeze-dried tube for detecting Chlamydia psittaci, in which a reaction system for detecting Chlamydia psittaci is fixed by freeze-drying, and the reaction system for detecting Chlamydia psittaci contains the above-mentioned Chlamydia psittaci RAA-CRISPR / CAS reaction system.

[0019] In a sixth aspect, the present invention provides a method for preparing the above-mentioned one-tube freeze-drying tube, wherein the freeze-drying conditions include: freezing the one-tube freeze-drying tube containing the psittacosis Chlamydia RAA-CRISPR / CAS reaction system at -80°C for 1 to 1.5 hours and then performing equipment freeze-drying; the equipment freeze-drying includes: a pre-freezing stage, equipment vacuuming, freeze drying and analytical drying stages; the conditions of the analytical drying stage are: raising the partition temperature to -20 to -25°C and maintaining it for 12 to 16 hours, then raising the partition temperature to 5 to 8°C and maintaining it for 0.5 to 1 hour, and finally raising the partition temperature to 20 to 25°C and maintaining it for 3 to 5 hours.

[0020] In a seventh aspect, the present invention provides a psittacosis chlamydia detection kit, which contains the psittacosis chlamydia RAA primer pair or the crRNA molecule or the psittacosis chlamydia RAA-CRISPR / CAS reaction system or the one-tube lyophilization tube.

[0021] In an eighth aspect, the present invention provides a method for detecting Chlamydia psittaci for non-disease diagnosis and treatment purposes, wherein the nucleic acid of a sample to be tested is used as a template, and the nucleic acid to be tested is amplified using the above-mentioned Chlamydia psittaci RAA primer pair to obtain an amplified product; the amplified product is detected by agarose gel electrophoresis, and if a band appears, it means that the sample to be tested is positive for Chlamydia psittaci;

[0022] Alternatively, the nucleic acid of the sample to be tested is used as a template, and the above-mentioned Chlamydia psittaci detection kit is used to perform real-time PCR on the nucleic acid to be tested, and the amplification process of the real-time PCR is monitored. The appearance of an amplification curve during the amplification process indicates that the sample to be tested is positive for Chlamydia psittaci;

[0023] Alternatively, the nucleic acid of the sample to be tested is used as a template, and the above-mentioned Chlamydia psittaci detection kit is used to perform PCR detection on the nucleic acid to obtain an amplification product; if the amplification product appears as white light under ultraviolet light, it means that the sample to be tested is positive for Chlamydia psittaci; if the amplification product appears colorless and transparent under ultraviolet light, it means that the sample to be tested is negative for Chlamydia psittaci.

[0024] The beneficial effects of the present invention are:

[0025] (1) The present invention provides isothermal amplification. The RAA-CRISPR-Cas12a system can be performed at room temperature, with an optimum temperature of 37 to 42°C. It does not require expensive temperature cycling equipment, thus reducing costs.

[0026] (2) The detection method provided by the present invention is time-saving. The entire reaction process can be completed within 10 to 20 minutes, and no denaturation is required, thereby achieving rapid detection of Chlamydia psittaci.

[0027] (3) The detection method provided by the present invention has high sensitivity, and the minimum detection limit reaches 125 copies / mL. The RAA-CRISPR-Cas12a system maintains high sensitivity in a short reaction time, and can obtain about 10 copies / mL from a single template molecule. 12 Order of magnitude amplification product.

[0028] (4) The detection method provided by the present invention has high specificity. The RAA-CRISPR-Cas12a system only recognizes and cuts the target sequence and does not react to non-target sequences.

[0029] (5) The one-tube nucleic acid detection reagent prepared by the present invention can be stored at room temperature. 2+ In addition, the remaining system components are stored in the reaction tube in a dry powder state, which is stable and easy to store and transport, easy to operate, and reduces the possibility of contamination in the closed reaction system.

[0030] (6) The detection method provided by the present invention has diversified reading results. The results of the RAA-CRISPR-Cas12a system can be detected by agarose gel electrophoresis, the amplification process can be monitored in real time by real-time PCR, and can also be visualized under ultraviolet light.

[0031] The present invention uses the RAA-CRISPR-Cas12a reaction system to construct a method for fluorescence detection and power-free on-site visual detection of psittacosis Chlamydia genes. By combining the sample processing method and RAA technology with Cas12a-based detection, the results can be determined by fluorescence detection or by the naked eye within 20 minutes. With few detection equipment, low cost, visual detection, and full-pipe sealing operation, no aerosol pollution will be generated, and its application may help control the pandemic of psittacosis Chlamydia. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 This is the detection result of Chlamydia psittaci nucleic acid by RAA-CRISPR-Cas12a. In the figure, 1 is Chlamydia psittaci nucleic acid and 2 is the negative control.

[0034] Figure 2This is the result of stimulating the RPA-CRISPR-CAS12a product under 302nM ultraviolet light. In the figure, 1 is the nucleic acid of Chlamydia psittaci and 2 is the negative control.

[0035] Figure 3 This is the specific detection result of Chlamydia psittaci RAA-CRISPR-Cas12a for detecting Chlamydia psittaci genes. In the figure, 1 is Chlamydia psittaci; 2 is Mycoplasma gallisepticum; 3 is Mycoplasma synoviae; 4 is Mycoplasma hyopneumoniae; 5 is Mycoplasma hyorhinis; 6 is Escherichia coli; 7 is Shigella dysenteriae; and 8 is Salmonella.

[0036] Figure 4 This is the result of the RPA-CRISPR-CAS12a ultraviolet light specific test for psittacosis. In the figure, 1 is Chlamydia psittaci; 2 is Mycoplasma gallisepticum; 3 is Mycoplasma synoviae; 4 is Mycoplasma hyopneumoniae; 5 is Mycoplasma hyorhinis; 6 is Escherichia coli; 7 is Shigella dysenteriae; and 8 is Salmonella.

[0037] Figure 5 This is the sensitivity test result of Chlamydia psittaci RAA-CRISPR-Cas12a. In the figure, 1 is 1×10 7 copies / mL; 2 is 1×10 6 copies / mL; 3 is 1×10 5 copies / mL; 4 is 1×10 4 copies / mL; 5 is 1×10 3 copies / mL; 6 is 500 copies / mL; 7 is 250 copies / mL; 8 is 125 copies / mL; 9 is 62.5 copies / mL; 10 is nuclease-free water.

[0038] Figure 6 This is the sensitivity test result of RPA-CRISPR-CAS12a under ultraviolet light. In the figure, 1 is 1×10 7 copies / mL; 2 is 1×10 6 copies / mL; 3 is 1×10 5 copies / mL; 4 is 1×10 4 copies / mL; 5 is 1×10 3 copies / mL; 6 is 500 copies / mL; 7 is 250 copies / mL; 8 is 125 copies / mL; 9 is 62.5 copies / mL; 10 is nuclease-free water.

[0039] Figure 7This is the intra-batch reproducibility result of Chlamydia psittaci RAA-CRISPR / CAS. In the figure, 1-3 are the concentrations of 1×10 7 copies / mL of Chlamydia psittaci plasmid, and 4 is nuclease-free water.

[0040] Figure 8 Chlamydia psittaci RAA-CRISPR / CAS under UV light 1×10 7 The positive plasmid test results are 1×10 7 copies / mL of positive plasmid, and 4 is nuclease-free water.

[0041] Fig. 9 This is the reproducibility result of RAA-CRISPR / CAS for Chlamydia psittaci. In the figure, 1-3 are three batches tested at a concentration of 1×10 7 copies / mL of Chlamydia psittaci plasmid, and 4 is nuclease-free water.

[0042] Fig.10 Chlamydia psittaci RAA-CRISPR / CAS under UV light 1×10 7 The positive plasmid test results of 1×10 7 copies / mL of positive plasmid, and 4 is nuclease-free water.

[0043] Fig.11 These are the test results of 9 different subgenotypes of Chlamydia psittaci detected by RAA-CRISPR-Cas12a. In the figure, 1 is Chlamydia psittaci genotype A; 2 is Chlamydia psittaci genotype B; 3 is Chlamydia psittaci genotype C; 4 is Chlamydia psittaci genotype D; 5 is Chlamydia psittaci genotype E; 6 is Chlamydia psittaci genotype F; 7 is Chlamydia psittaci genotype E / B; 8 is Chlamydia psittaci genotype M56; 9 is Chlamydia psittaci genotype WC; 10 is nuclease-free water.

[0044] Fig.12 These are the test results of 9 different subgenotypes of Chlamydia psittaci under ultraviolet light using RAA-CRISPR-Cas12a. In the figure, 1 is Chlamydia psittaci genotype A; 2 is Chlamydia psittaci genotype B; 3 is Chlamydia psittaci genotype C; 4 is Chlamydia psittaci genotype D; 5 is Chlamydia psittaci genotype E; 6 is Chlamydia psittaci genotype F; 7 is Chlamydia psittaci genotype E / B; 8 is Chlamydia psittaci genotype M56; 9 is Chlamydia psittaci genotype WC; and 10 is nuclease-free water.

[0045] Fig.13This is the screening result of RAA primers for Chlamydia psittaci. In the figure, 1 is the positive plasmid detected by the CPS-F and CPS-R primer pair; 2 is the nuclease-free water detected by the CPS-F and CPS-R primer pair; 3 is the positive plasmid detected by the CPS-F1 and CPS-R1 primer pair; 4 is the nuclease-free water detected by the CPS-F1 and CPS-R1 primer pair; 5 is the positive plasmid detected by the CPS-F2 and CPS-R2 primer pair; 6 is the nuclease-free water detected by the CPS-F2 and CPS-R2 primer pair.

[0046] Fig.14 This is the result of crRNA screening for Chlamydia psittaci. In the figure, 1 is a positive plasmid detected by CPS-crR; 2 is a positive plasmid detected by CPS-crR1; 3 is a positive plasmid detected by CPS-crR2; 4 is nuclease-free water detected by CPS-crR; 5 is nuclease-free water detected by CPS-crR1; and 6 is nuclease-free water detected by CPS-crR2.

[0047] Fig.15 This is the test result of Chlamydia psittaci crRNA screening under ultraviolet light. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] The freeze-dried liquid components of the psittacosis RAA-CRISPR / CAS reaction system of the present invention are as follows: 2-5 mmol / L dNTP, 0.2-1.0 μmol / L single-stranded binding protein, 1.0-2.0 μmol / L recombinase protein, 0.2-1.0 U / μL DNA polymerase, 10-50 mmol / L TrisHCl, 40-80 mmol / L NaCl, 6-10 mmol / L dithiothreitol, 1.0-5.0 μmol / L psittacosis RAA upstream and downstream primers, 0.2-1 μmol / L crRNA, 0.1-0.5 μmol / L LbCas12a, 0.1-1 U / μL Exo exonuclease, 0.1-0.5 nmol / L ssDNA, 0.4-1.0 U / μL RNase Inhibitor, 10-15mmol / L trehalose, 20-25mmol / L mannitol, 5-20% bovine serum albumin.

[0050] After the lyophilized liquid is freeze-dried, it is reconstituted with 44.5 μL of premixed buffer A (the ingredients are as follows: 20-50% polyethylene glycol); 2.5 μL of premixed buffer B (Buffer B contains magnesium acetate at a final concentration of 250-320 mmol / L and magnesium chloride at a final concentration of 80-120 mmol / L) and 3 μL of template, and the total reaction system is 50 μL.

[0051] The term "include" or "comprising" in the present invention is an open description containing the specified components or steps described, and other specified components or steps that will not be substantially affected.

[0052] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0053] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0054] Example 1 Chlamydia psittaci RAA-CRISPR / CAS Primer Design

[0055] According to U68422.1 of Chlamydia psittaci registered in Genbank, RAA primers, crRNA primers, and ssDNA primers were designed. The designed primer sequences are shown in Table 1 and were synthesized by a gene synthesis company.

[0056] Table 1

[0057]

[0058] Example 2 Establishment of a Chlamydia psittaci RAA-CRISPR / CAS Detection Method

[0059] This embodiment provides a method for detecting Chlamydia psittaci RAA-CRISPR / CAS, the method comprising:

[0060] (1) Preparation of freeze-dried powder for nucleic acid detection in one tube:

[0061] The one-tube Chlamydia psittaci RAA-CRISPR CAS12a freeze-dried reaction solution (nucleic acid detection freeze-dried solution) is 4mmol / L dNTP, 0.8μmol / L single-stranded binding protein, 1.2μmol / L recombinase protein, 0.5U / μL DNA polymerase, 30mmol / L TrisHCl, 50mmol / L NaCl, 8mmol / L dithiothreitol, 3.8μmol / L Chlamydia psittaci RAA upstream and downstream primers, 0.5μmol / L crRNA, 0.25μmol / L LbCas12a, 0.5U / μL Exo exonuclease, 0.25nmol / LssDNA, 0.6U / μL RNase Inhibitor, 12mmol / L trehalose, 22mmol / L mannitol, 10% bovine serum albumin and nuclease-free water supplemented to 50μL to obtain a one-tube nucleic acid detection freeze-dried solution for Chlamydia psittaci. The lyophilized solution was placed in eight 0.2 mL PCR tubes in a row for lyophilization.

[0062] The lyophilized liquid was first frozen at -80°C for 1 hour and then entered the pre-freezing stage. The freeze-drying condition of the equipment was that the partition temperature dropped to -55°C and the pre-freezing holding time was 0.5 hour. Then the equipment was evacuated and freeze-dried for 1 hour. After the pre-freezing stage, analytical drying was carried out, the partition temperature was raised to -25°C and maintained for 15 hours, and then the partition temperature was raised to 5°C and maintained for 0.5 hours, and finally the partition was raised to 25°C and maintained for 5 hours. A tube of psittacosis RAA-CRISPR CAS12a lyophilized tube containing psittacosis RAA-CRISPR CAS12a lyophilized powder was obtained.

[0063] (2) Genome extraction:

[0064] Extracting nucleic acid from the sample to be tested using a commercial nucleic acid extraction kit to obtain the nucleic acid to be tested;

[0065] (3) RAA-CRISPR-Cas12a amplification

[0066] To a psittacosis RAA-CRISPR CAS12a freeze-dried tube, add 44.5 μL of premixed solution Buffer A (30% polyethylene glycol) to reconstitute, then add 3 μL of the nucleic acid to be tested, and then add 2.5 μL of Buffer B (Buffer B contains a final concentration of 300 mmol / L magnesium acetate and 100 mmol / L magnesium chloride) solution on the tube cap. After covering the tube cap of the reaction tube, simply rotate and centrifuge Buffer B to the bottom of the freeze-dried tube, a total of 50 μL system, mix evenly, and perform amplification reaction. The amplification program is: 38°C, 60s preheating; 38°C, 30s amplification, 40 cycles, to obtain nucleic acid amplification products.

[0067] RAA-CRISPR-Cas12a amplification results:

[0068] The results of the one-tube Chlamydia psittaci RAA-CRISPR CAS12a nucleic acid test are shown in Figure 1 , the nucleic acid of Chlamydia psittaci has an amplification curve, while the negative control has no amplification curve, indicating that the method provided by the present invention can detect whether Chlamydia psittaci exists in the sample.

[0069] The RAA-CRISPR-Cas12a amplification reaction was excited by a gel imager at 302nM UV light, and the results were read and photographed by naked eyes. Figure 2 As shown, the reaction tubes containing the nucleic acid product of Chlamydia psittaci appear white light, while the other negative control reaction tubes appear colorless.

[0070] Example 3 Specificity test of Chlamydia psittaci RAA-CRISPR / CAS detection method

[0071] This example verifies the specificity of the provided Chlamydia psittaci RAA-CRISPR / CAS detection method.

[0072] In this example, DNA / RNA of Chlamydia psittaci, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Escherichia coli, Shigella dysenteriae, and Salmonella strains were extracted as nucleic acids to be tested, and RAA-CRISPR-Cas12a amplification detection was performed.

[0073] The reaction system is as follows: add 44.5 μL Buffer A and 3 μL nucleic acid to be tested to a tube of Chlamydia psittaci RAA-CRISPR CAS12a freeze-dried tube, then add 2.5 μL Buffer B solution to the tube cap, cover the freeze-dried tube cap, and simply rotate Buffer B to the bottom of the freeze-dried tube, a total of 50 μL system, mix evenly, and use it as a reaction tube for amplification reaction. Amplification program: 38°C, 100s preheating; 40°C, 30s amplification, 40 cycles; in the reaction tube, a nucleic acid amplification product is obtained.

[0074] The amplification results of each reaction tube are shown in Figure 3 ,Depend on Figure 3 As can be seen from the results, only the fluorescence intensity signal was obtained in the reaction tube of Chlamydia psittaci, while the reaction tubes of other pathogens (Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Escherichia coli, Shigella dysenteriae, and Salmonella strains) had no amplification curves. This indicates that the RPA-CRISPR-CAS12a detection method provided in this example has a better detection specificity for Chlamydia psittaci.

[0075] The results of the UV-specific test for RPA-CRISPR-CAS12a for psittacosis are shown in Figure 4 ,Depend on Figure 4 It can be seen that the detection method of RAA-CRISPR / Cas12a can only detect psittacosis Chlamydia as white light, but no amplification is found for other types of pathogens (Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Escherichia coli, Shigella dysenteriae, and Salmonella strains), and it appears colorless and transparent under ultraviolet light, indicating that nonspecific amplification cannot occur. The detection method has good specificity for the detection of psittacosis Chlamydia.

[0076] Example 4 Sensitivity test of Chlamydia psittaci RAA-CRISPR / CAS detection method

[0077] In this example, the concentration is 1×10 7 Make a 10-fold gradient dilution of the Chlamydia psittaci plasmid at 10 copies / mL. 3 The plasmid with 1×10 copies / mL was diluted 2-fold. 7 copies / mL~10 3 The sensitivity of the RAA-CRISPR-Cas12a reagent was tested using the plasmid of Chlamydia psittaci at various gradient concentrations of copies / mL, 500 copies / mL, 250 copies / mL, 125 copies / mL, and 62.5 copies / mL as templates and nuclease-free water as a negative control. The reaction conditions and reaction system were the same as in Example 2.

[0078] Figure 5 The sensitivity test results of Chlamydia psittaci RAA-CRISPR-Cas12a were obtained by Figure 5 It can be seen that the RAA-CRISPR / Cas12a detection method can detect Chlamydia psittaci with a minimum detection limit of 125 copies / mL, and the detection method has the characteristic of high sensitivity.

[0079] Figure 6 This is the sensitivity test result of RPA-CRISPR-CAS12a under ultraviolet light for psittacosis. Figure 6 It can be seen that the detection method of RAA-CRISPR / Cas12a can detect white light for samples with a concentration of 125 copies / mL or more of Chlamydia psittaci, but cannot detect white light at 62.5 copies / mL, indicating that the minimum detection limit of the present invention is 125 copies / mL. The detection method provided by the present invention has the characteristic of high sensitivity.

[0080] Example 5 Repeatability test of Chlamydia psittaci RAA-CRISPR / CAS detection method

[0081] This example provides a repeatability analysis of the Chlamydia psittaci RAA-CRISPR / CAS detection method, the steps are as follows:

[0082] Select a known positive sample and perform intra-batch repeat detection and inter-batch repeat detection respectively. Intra-batch repeat detection: perform 3 repeats of a known positive sample in the same batch of experiments. Inter-batch repeat experiment: perform 3 batches of a known positive sample. The reaction conditions and reaction system are the same as in Example 2.

[0083] Figure 7 The results of intra-batch reproducibility of Chlamydia psittaci RAA-CRISPR / CAS were obtained by Figure 7 It can be seen that the detection method of RAA-CRISPR / Cas12a is effective for 1×10 7 The amplification curves of Chlamydia psittaci with 100 copies / mL were all obtained, and the fluorescence signals and CT values ​​within the batch were basically consistent. The detection method had good intra-batch repeatability.

[0084] Figure 8 For Chlamydia psittaci RAA-CRISPR / CAS, 1×10 7 copies / mL of positive plasmid detection results.

[0085] Depend on Figure 8 It can be seen that the same batch of Chlamydia psittaci RAA-CRISPR / CAS positive plasmid 1×10 7 White light can be detected for all copies / mL, indicating that the detection method has good intra-batch repeatability.

[0086] Fig. 9 The results of the inter-batch reproducibility of Chlamydia psittaci RAA-CRISPR / CAS were obtained by Fig. 9 It can be seen that the detection method of RAA-CRISPR / Cas12a is effective for 1×10 7 The fluorescence intensity signals of Chlamydia psittaci with 100 copies / mL were obtained, and the fluorescence signals and CT values ​​between batches were basically consistent. The detection method has the characteristics of strong batch repeatability.

[0087] Fig.10 For Chlamydia psittaci RAA-CRISPR / CAS, 1×10 7 copies / mL of positive plasmid detection results. Fig.10 It can be seen that 3 batches of Chlamydia psittaci RAA-CRISPR / CAS positive plasmid 1×10 7 White light can be detected for all copies / mL, indicating that the detection method has good inter-batch repeatability.

[0088] The above results show that the RAA-CRISPR / CAS detection method for Chlamydia psittaci provided by the present invention has good repeatability within and between batches.

[0089] Example 6 Detection Effect of Different Types of Chlamydia psittaci

[0090] From the perspective of serotype, Chlamydia psittaci is divided into at least 9 genotypes (AF, E / B, M56 and WC). As a pathogenic microorganism, its parasitic hosts are very complex, including primates, mammals, birds, amphibians, etc. including humans. Genotype A of Chlamydia psittaci was found in all human samples and related birds. Genotypes AF and E / B are associated with birds, WC and M56 are found in cattle and muskrats, respectively. Genotype A is associated with parrots, B with pigeons, C with ducks and geese, D with turkeys, E with pigeons and ratites, F with parrots and turkeys, and genotype E / B is mainly associated with ducks, turkeys and pigeons.

[0091] The 16sRNA and 23sRNA gene synthetic plasmids of Chlamydia psittaci genotype A, genotype BF, genotype WC and genotype M56 were detected using the RAA-CRISPR / CAS detection method provided by the present invention. The results are shown in Fig.11 ; The RAA-CRISPR-Cas12a amplification reaction was excited by a gel imager at 302nM UV light, and the results were interpreted by naked eyes and photographed. Fig.12 The results showed that the RAA-CRISPR / CAS detection method for Chlamydia psittaci provided by the present invention can detect 16sRNA and 23sRNA genes of 9 genotypes (AF, E / B, M56 and WC).

[0092] Comparative Example 1 Optimal RAA Primer Screening

[0093] Using the psittacosis plasmid as a template, the three pairs of designed RAA primers (Table 2) were added to the amplification system respectively. The specific reaction system is shown in Table 3 below. The target sequence for the primer probe design is shown in SEQ ID NO.10. 2.5 μL of magnesium acetate with a final concentration of 300 mmol / L and 100 mmol / L of magnesium chloride reagent were added to the tube cap, all the reaction reagents were mixed and centrifuged, and immediately placed in a 37°C metal bath after centrifugation and incubated for 30 minutes. After the incubation, a 2% gel was used for electrophoresis experiment. The gel results were excited by ultraviolet light at 302 nM, and the results were judged by naked eyes and photographed. The results are shown in Fig.13 The results showed that RAA primers CPS-F and CPS-R had target bands at around 177 bp and had the best specificity. RAA primers CPS-F1 and CPS-R1, and RAA primers CPS-F2 and CPS-R2 all had non-specific bands.

[0094] Table 2 RAA primer list

[0095] Primer name Primer sequence (5'-3') CPS-F CATGAAGTCGGAATTGCTAGTAATGGCGTG(SEQ ID NO.1) CPS-R TACGACTTCATCCCAGTCATCAGCCTCACC(SEQ ID NO.2) CPS-F1 CATGAAGTCGGAATTGCTAGTAATGGCGTGTC(SEQ ID NO.4) CPS-R1 GTTACGACTTCATCCCAGTCATCAGCCTCACC(SEQ ID NO.5) CPS-F2 CATGAAGTCGGAATTGCTAGTAATGGCG(SEQ ID NO.6) CPS-R2 TACGACTTCATCCCAGTCATCAGCCTCACCTT(SEQ ID NO.7)

[0096] Table 3 RAA system configuration table

[0097]

[0098]

[0099] Comparative Example 2 Optimal crRNA Screening

[0100] Using the psittacine plasmid as a template and nuclease-free water as a negative control, RAA upstream and downstream primers were combined with ssDNA probes, and CPS-crR, CPS-crR1 and CPS-crR2 (Table 4) were used for RAA-CRISPR / CAS fluorescence detection. The specific reaction system is shown in Table 5. 2.5 μL of magnesium acetate with a final concentration of 300 mmol / L and 100 mmol / L of magnesium chloride reagent were added to the tube cap, and all reaction reagents were mixed to form the CRISPR / Cas12a initial detection system for centrifugation. After centrifugation, fluorescence amplification detection was performed immediately, and the FAM channel was selected. The amplification program: 38°C, 100s preheating; 40°C, 30s amplification, 40 cycles; after the end, the data was saved for fluorescence signal analysis. The results are shown in the following table. Fig.14 shown.

[0101] The RAA-CRISPR-Cas12a amplification reaction was excited by a gel imager at 302nM UV light, and the results were interpreted by naked eyes and photographed. Fig.15 The best crRNA was screened as CPS-crR by comparing the Ct value and fluorescence intensity.

[0102] Table 4 crRNA sequence table

[0103]

[0104] Table 5 RAA-CRISPR CAS12a system preparation table

[0105]

[0106]

[0107] Comparative Example 3 Selection of Optimal Concentrations of crRNA and CAS12a Protein

[0108] Using psittacosis plasmid as template, nuclease-free water as negative control, optimal RAA upstream and downstream primers, and optimal crRNA combined with ssDNA probe for RAA-CRISPR / CAS fluorescence detection. The specific reaction system is shown in Table 6, where the final concentration of crRNA is X and the final concentration of Cas12a is Y as variables. The volume of LbCas12a protein and crRNA required to be added at different concentrations needs to be calculated based on a system with a total reaction volume of 50 μL, and the final concentrations of other components remain unchanged.

[0109] The selected LbCas12a protein concentrations were 0.15μM, 0.25μM, 0.35μM, 0.45μM, and 0.55μM, respectively; the selected crRNA concentrations were 0.5μM, 1.0μM, 1.5μM, 2.0μM, and 2.5μM for cross-reaction. 2.5μL of magnesium acetate with a final concentration of 300mmol / L and 100mmol / L of magnesium chloride reagent were added to the tube cap, mixed evenly, centrifuged, and immediately amplified. The reporter molecule selected was a fluorescent reporter molecule, and the amplification program was 38°C, 60s preheating for 1 cycle; 38°C, 30s amplification, 40 cycles. The nucleic acid amplification product was obtained, and the Ct value data after the reaction was completed was saved and analyzed. The results are shown in Table 7. The experimental results were analyzed and the final concentration of Cas12a protein in the optimal reaction system was determined to be 0.25μM, and the final concentration of crRNA was 0.5μM.

[0110] Table 6 RAA-CRISPR CAS12a system preparation table

[0111]

[0112] Table 7 Screening results of the ratio of Cas12a to crRNA

[0113]

[0114]

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A combination of a Chlamydia psittaci RAA primer pair and a crRNA molecule, characterized in that: The sequence of the Chlamydia psittaci RAA primer pair is shown in SEQ ID NO.1-2, and the sequence of the crRNA molecule is shown in SEQ ID NO.

3.

2. Chlamydia psittaci RAA-CRISPR / CAS reaction system, characterized in that: include: The Chlamydia psittaci RAA primer pair and crRNA molecule combination of claim 1; further comprising: ssDNA and Cas12a protein, wherein the ssDNA is FAM-TTTTTTTTTT-BHQ1.

3. The Chlamydia psittaci RAA-CRISPR / CAS reaction system according to claim 2, characterized in that: In the Chlamydia psittaci RAA-CRISPR / CAS reaction system, in terms of concentration, the ratio of the final concentration of Cas12a protein to the final concentration of crRNA is (15-55): (50-250).

4. The Chlamydia psittaci RAA-CRISPR / CAS reaction system according to claim 3, characterized in that: The components of the psittacosis RAA-CRISPR / CAS reaction system include: 2~10 mmol / L dNTP, 0.2~1.0 μmol / L single-stranded binding protein, 1.0~2.0 μmol / L recombinase protein, 0.2~1.0 U / μL DNA polymerase, 10~50 mmol / LTrisHCl, 40~80 mmol / L NaCl, 6~10 mmol / L dithiothreitol, 1.0~5.0 μmol / L psittacosis RAA upstream and downstream primers, 0.2~1 μmol / L crRNA, 0.1~0.5 μmol / L LbCas12a, 0.1~1U / μL Exo exonuclease, 0.1~0.5 nmol / L ssDNA and 0.4~1.0U / μL RNase Inhibitor.

5. Use of the Chlamydia psittaci RAA-CRISPR / CAS reaction system according to any one of claims 2 to 4 in the preparation of a lyophilized liquid, lyophilized powder or lyophilized tube for a tube-type nucleic acid detection of Chlamydia psittaci.

6. A one-tube freeze-dried tube for detecting Chlamydia psittaci, characterized in that: The reaction system for detecting Chlamydia psittaci is fixed in the one-tube freeze-drying tube by freeze-drying, and the reaction system for detecting Chlamydia psittaci contains the Chlamydia psittaci RAA-CRISPR / CAS reaction system according to any one of claims 2 to 4.

7. The method for preparing a tubular freeze-drying tube according to claim 6, characterized in that: The freeze-drying conditions include: freezing a tubular freeze-drying tube containing the psittacosis RAA-CRISPR / CAS reaction system at -80°C for 1 to 1.5 hours and then performing equipment freeze-drying; the equipment freeze-drying includes: a pre-freezing stage, equipment vacuuming, freeze drying and analytical drying stages; the conditions of the analytical drying stage are: raising the partition temperature to -20 to -25°C and maintaining it for 12 to 16 hours, then raising the partition temperature to 5 to 8°C and maintaining it for 0.5 to 1 hour, and finally raising the partition temperature to 20 to 25°C and maintaining it for 3 to 5 hours.

8. A Chlamydia psittaci detection kit, characterized in that: The Chlamydia psittaci detection kit contains the Chlamydia psittaci RAA primer pair and crRNA molecule combination described in claim 1 or the Chlamydia psittaci RAA-CRISPR / CAS reaction system described in any one of claims 2 to 4 or the one-tube lyophilized tube described in claim 6.

9. A method for detecting Chlamydia psittaci for non-disease diagnosis and treatment purposes, characterized in that: Using the nucleic acid of the sample to be tested as a template, amplifying the nucleic acid to be tested using the Chlamydia psittaci RAA primer pair and crRNA molecule combination described in claim 1 to obtain an amplification product; The amplified product is detected by agarose gel electrophoresis. If a band appears, it means that the sample to be tested is positive for Chlamydia psittaci; Alternatively, using the nucleic acid of the sample to be tested as a template, the psittacosis detection kit of claim 8 is used to perform real-time PCR on the nucleic acid to be tested, and the amplification process of the real-time PCR is monitored. The appearance of an amplification curve during the amplification process indicates that the sample to be tested is positive for psittacosis; Alternatively, using the nucleic acid of the sample to be tested as a template, the psittacosis chlamydia detection kit according to claim 8 is used to perform PCR detection on the nucleic acid to obtain an amplification product; if the amplification product appears as white light under ultraviolet light, it means that the sample to be tested is positive for psittacosis chlamydia; if the amplification product appears as colorless and transparent under ultraviolet light, it means that the sample to be tested is negative for psittacosis chlamydia.

Images