A SNP site detection primer for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry and its application

Abstract

The present invention discloses a SNP site detection primer for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry and its application. The primer is used for quick and convenient identification of yellow peel varieties (lines) and establishment of molecular fingerprints of common yellow peel varieties (lines) in China. The purpose is to overcome the deficiencies of the prior art, provide a SNP molecular marker combination for constructing a DNA fingerprint map of yellow peel varieties and its application, so as to solve the problems of poor repeatability and low polymorphism of co-dominant molecular markers such as RAPD and ISSR used in the prior art. The present invention can effectively identify yellow peel varieties (lines) with different names or the same name but different objects, effectively protect the rights and interests of improved variety breeders and forestry growers, and improve the degree of improved variety development of yellow peel.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a SNP site detection primer for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry and an application thereof. Background Art

[0002] Clausena lansium (Lour.) Skeels is a plant of the genus Clausena in the Rutaceae family. It is a fruit unique to southern my country. Clausena fruit has an attractive appearance, unique flavor, rich nutrition, and has antioxidant and anti-aging effects. It is deeply loved by consumers and is known as the "Lingnan Fruit". In recent years, under the situation of continued low prices of major fruits such as lychees and longans, the price of Clausena has been high, bringing high economic benefits to fruit farmers, and the cultivation area has continued to expand. Clausena has a cultivation history of more than 1,500 years. In the past, people used to cultivate it sporadically in front of and behind their houses. After a long period of natural evolution and artificial selection, a rich collection of Clausena germplasm resources has been formed. However, there are still deficiencies in the protection and utilization of Clausena germplasm resources, which cannot adapt to the development trend of modern seed industry of crops and are facing new challenges. For a long time, the identification of Clausena germplasm resources has been mainly based on morphological traits. This classic and conventional identification method generally completes its identification process after the Clausena blooms and bears fruit. However, Huangpi is a perennial woody plant with unfavorable factors such as a long sexual generation cycle and highly heterozygous varieties, which leads to a long period of trait identification cycle. In addition, agronomic traits are easily affected by environmental conditions and cultivation management, which brings many inconveniences to Huangpi germplasm resources and variety identification. Accurate molecular marker methods are urgently needed to identify Huangpi germplasm resources.

[0003] Molecular markers based on DNA polymorphism, such as RFLP, RAPD, AFLP, ISSR, SSR and SNP, have been applied to the construction of DNA fingerprint databases for multiple species. However, RFLP, RAPD, AFLP and other marker technologies often have problems such as poor stability, low polymorphism, and difficulty in data integration. Therefore, the International Union for the Protection of New Varieties recommends SSR and SNP as the preferred DNA fingerprint marker technology. SNP markers will become the main marker type for genotype identification in the future because of their advantages such as full genome coverage, high throughput, site specificity, co-dominant inheritance, low false positive rate, drastically reduced development and testing costs, and easy data integration. Time-of-flight mass spectrometry ( MALDI-TOF) is a multiplex microsequencing technology for SNP detection, which has the characteristics of fast detection speed, high accuracy and large throughput, and has been widely used in forensic SNP identification and human genetic disease detection. At present, although some DNA fingerprint analysis has been carried out on yellow-peeled varieties (lines), there is still no simple and easy SNP detection system. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a SNP site detection primer for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry.

[0005] Another object of the present invention is to provide an application of the above-mentioned SNP site detection primer.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A SNP site detection primer for identifying yellow-peeled varieties based on multiplex PCR time-of-flight mass spectrometry, comprising the following primers:

[0008]

[0009] The nucleotide sequences of the above-mentioned SNP site detection primers are shown in SEQ ID NOs. 1 to 24.

[0010] The above-mentioned SNP site detection primers include a front amplification primer sequence-F and a rear amplification primer sequence-R for amplifying a sequence containing the SNP site, and an extension primer sequence-P for time-of-flight mass spectrometry identification.

[0011] A set of SNP loci used to identify yellow-skinned varieties, the locus information is as follows:

[0012]

[0013]

[0014] The reference genome sequence for identifying the SNP loci of the yellow-peeled variety is JinFeng.

[0015] The SNP sites used to identify yellow-skinned varieties above, and the reference sequences corresponding to the SNP sites in the genome are:

[0016] Chr1_41985526:

[0017] GAAAACATTATTGCTCGGGCAACTTCAAGTAAGTGTCGATTTTTCCTTTCAGCAATTCCATTTTGCTTAGGAGTAATACGACAAGTGGATTGGTGTTCAATGCCTTTTTCTTTTAAAAATTTTCCCAAACATTCATTGAAATATTCAGTTCCATTATCAGTGCGAAGAATACTTATATTTGTTTGGAACTGATTTTCAATCATAGTGTAAAAATCTTTAAACAGTTTTTCAACTTCAGATTTTTCACTCATTAGATAAATTCGACAGAGTCGAGTATGGTCATCAATAAAAGTAACAAA[C / T]CATTTTT TTCCGTTAAAGTAGTGATTTTCGAGGGACCCCAAACATCACTATGAATCAAATAAAATGGTTTTGATGCACGATAAAGGCCTTGATTTAAATGAAACTCGATGACTTTTTGATAAATGACAAACATCACAATTAAAGGAATTATAT CCAAAGTCTTAAATAAACCAGGAAATAAATGTTTTAAATACGGAAAGCTAGGATGCCCTAGTCTACAATGCCATAGCATAATTTGTTCATGAACAGGGACAGAACGAATACTACCACTCTAGCCCTGAGCTTGTTTATTGCAGAAC;

[0018] Chr2_25211297:

[0019] ACTCTCCAGATCATTCCAACTAAATGACAAAAAATGTAAAAAAAATTGGACAATGATTCCATGGGCACTTCACATATGACTGCTGATTTGAGAAAGATTACTTAGCTGTTGGATCATTTCAAAGTAATCTCATTGATTTGGTAAGGATTCTCA CCCATGCAACTTAAATTTCACTATACCCATGGTCAAAACAAATATATAGCCCCAATTTGGCTGTTCTTTTCTTCCATCCACATGAGCAATTAATGATTAAAATAATTTATTTACTATTTATATATGGGCTTGCTATTGTTATAG[T / C]TTGGCTG CTTATGATTTCTTTCTCTCTTAATCAAATTAGTCTCGAGTTTTGGTAAATTTTATAATTTTGAGTATTAACAGAATTTTAATTGTAGAATCTCAAAGTTATTGTTTGTTTGGTGTAGTGTTAGCCTTTGATTGAGGAATTATTAGCTTCCTACTCACAGACTTGTAGACAGTACATATCAATTTTGATATTTTTAAGTCAAAGAACAAGGTGCAGCTAATACAATTTCTAGTATTATTTATTTCATTTTAATATTTTTTAAAACTTGTTTAGTGGCCAACATAATTATTAAAG;

[0020] Chr2_29603143:

[0021] GAGGTAGACCTTCTAAAGGACAGTTTGACTCTACCATCAGAATACTGAGTCACATTTTGCAACTCTGTATTAGGTTCAAGTTGTTTTGGAATTACTGGTTCAGTAGCTCCATCTAAAATCCAATCTTCTGGAAGATGGACATCTTTCCATTGAATCGGTCTTGGAACAACAGTGTTTGCTCTAGACATGTCAGTCTGTAAGAGAAGAGTCTCATCCCTTTTGGACTGGAATTTATGCTGTGTATTAAATGCAGAATGCATTGCTTTATAGGATATTTTGTAAATTAATGCAACAGGAAT[C / T]GATCCTTCAATCATGTGGTAATTATGGGTCTTGATTTGGAGGATCATGCTTTTGAGAATATTTTTGTCTTTAAGGGAGACTGTAATGTTTGGATAACAGTCAAATGATATTGGACCTTTACAAAGGCTGGACTCAATACTACTAAGTAAGGAATCATCAAAAGAGATGAATCGGCCATCTCTTAGAACGGCTAGGATAGACGTATCTAAGCCTTCTTTGGTAAGAGGTTTTATTCCGACTTGGATTAAACCAATATGCACATAATTAAATTTCTTTTCTTTTAAATGCTTTAGAGAATGT;

[0022] Chr3_7346666:

[0023] AATCTAACTAAATTTCTTATATATATTGCTTTTGTAATTTTTCATTCTCTTTAATTCTGATCTGTTTTCATTTTACATTACTCCCCCTTATTTTTCAGTAACAAAATTTTCCTAAATTTCTATCACCCTCCACAGGAAAAGTGAATTTACTTTGCTTATATTTTAATTAGTAGATCTGGGATTTGCTCAATGATGTATAGGTTGGATTAGATTAAGTTAAATTTTTTGAGCCATTATTTATCTTACATAATCTAATGATAGATAGATCGATATTATAGTTAAAATAGTATTTAATAATG[T / C]CAATTCATCCACCATTAAGAGATCAGTGACTCAAAATTTATATCAAAATTTTAAATCAAAAGTTTGTGTCTAATTAGCCTGACTCATGCATTTTGAAAGTACGTATATGTAATGATTTTGTAACTATATTATGTATTCTGCACGTTAATTAGATCTCCAAAGAAGAATAATTAACTGAATCGTGACGAAAATTTTACTCGCAGCAGAAATATTCAACCCACGCTCAGGGCCAGATATGTCCACTGCTTCATCACCAAGAGCTGGTAAACGTAAACATGGTTCAGACGATGCTGATTATGT;

[0024] Chr3_11889330:

[0025] TTACTATAGTGATACTCTTTATTTGCATTAGCTAGATTTTTTATGTTATTTAGAATAAATTTAAAAATATATCTATACATTTTGTTGCTTTATTTTTTAAGTTCAAGGGCTGTGATGAGTATACTATGAATGATATTTCGTAACATTGCGATGAGTGGGCCACGTATGTTGTAAAGTTAATTGTAGCATACAATAATCAGGTAAAATTATAAGTAAATTTTTTCTTGTAAATATCGGAGAATTGATTTGTGTAGCATGCTAGCTAATTGATTCTATATGCTGCACTTGTAGGTGGGGAA[A / G]GTGAAGGGAAAGGCGAAGGTCAAGGAGTAGATGTATTTAGGATAATTGATTGATTTCTGCAAACTGTCGCTATGTTGTTTTCAAACTATATTTGGAATATTTGTTTTACTATTATATTTGTATTAATGTTTGATTCAAACTTATTTAAATTTTATTGGGAATCTTATATTTAATTGTTCAGTTTAGTAGTTCAGCTTACTTTTAATATTTTCTTTGAATAACATAATTTGATTGGCAAAACTAAAATAACGATGAAAATAATAGGGTAACATAAAAAATGCCAAAATATAAATACAACTA;

[0026] Chr3_25315156:

[0027] ATCACATAGCAAAGTGGAACAACATATCCCACTTATAATAAATCACTCAAGTGATTATACTTTTAATTTATAAGTCTAGATTGCTATACTATACACAAGTACGATTATAGCTTTATCAAGAATATATAAGCTGCAAGCTTTTTGAATTTAGTACTTCAAATACTTATTTCAAGCATTTTATCCTTCAAGGACAAGTACATAGATTCTTCAATTTAATTTTGAAACATTATAGTTCAAATTCATATTTTATTCATAAATTTTACGACTTTTGACGTATGGACTACAAGTCCAAAATTCTT[T / C]AAATTTTTTGCTAATTAATTTCACGTTCTATAACGTATGGACTTCAGGTCCGAATATTTAAGAAATTTTGGCCAATCATATAATTTGATGATCTTCACATTTTGTGATTCAGGATCCTGAAAATTTTATCATAACAATTAAATTTTATTGACAAAAATATTATGTCAATTTCAATTTTTTCTCTTGCACCAAGTACCATCATTAATTAAATATTTCTCATTTTCAATATCTATGCCCAATTGAGATATTTTGAAGCTTCTAATACATATACCTCTCCAAGGGCTAAAGATCTCTTTTTTT;

[0028] Chr6_17693038:

[0029] AGATAGCGATGTGGTAGAGCTGGTGTCACGCGATGAAGGTAGATCTCTTCTTGGTGGAGCTGCTCGCGCGACGAAGAAAGATGAAGCAAAGTCGGCCGGTCAGTTTTTGTTGGTGAATAGATCGGCAGTGATAGAGAAATTGGGTGTAG CATTTTTGCAGTTTCTTTCGATTTTTTTTTTAAGATGAACAGTACGAAACCCGTATAAACTTGACCCCTATCGTGATTATTATGCGGCTATAACCACATTATAATGGTGAAATACAATAGATGGGTTCCAAAACATAGTATA[A / G]TGTTATTAATACAATCCAAGCTTTAATACAGCCTTATGAGGGTGCCAAACACCCTTAGTATTGATTCTCTAATGTTTAATGTACAAACACTATAGAATCAGTAAATGGTGATACTTATTAAACAAGAAAATGACCCA AATGTATGTAAGTTCTAATATTTAACAAAGTTTCAAAGGCAAATGTCATTGAAGACCATTTTTCTTATAGTTACATTTTCTATATGGGATTTAAGCTTTTACTGGTGAGCCACAACTTCATAACTCCCCCTTCGATCA;

[0030] Chr7_20660263:

[0031] TCTCTTCATTGAAATCACACTCGTGCAATTCATATTTATTTTTTACATCATCTCAATAAGCCATTCTTTCAATTTCAAAGAGCAATGAAGAGATGAATGCAAATATCATTTAAATATCAAATATATCATCATGATACAGGCTACTAATTTTACT TGTATTACACTTGCTGCACATAGAGAGAAGAATACTGTATATAATTATCAAATTGAATTTAATTTACTTTAAATCTTCTAAATCTAGACCATCCACCAGGTGTGCCTAATCACTGTGTGTAAATGGTCATGTACTTTATACAA[T / C]ACTGCAGG AAATAGGAAAAGAAAAAAGAAAAAAAATAAAAATAAAAATAAAAGAATCTGATATCACTTTCTTTTTATCCACACATTTATGTACAAGTTTATTAATAGAAAAAAAAACAAATAAATTTAATAACTATCAAATATCAATCAGTTCAA TTACGCTTTCTTCTTGGCTGATTGATGTTTCTTTTTCCATATGTTCAAAGAGGCTTCCATCATAAACAGCTTTGACTGTGTCTTTATGCAGCAAACCGTTCTTGTCCTTGCAAAGAACATACAATATCTTTCATTCTGCGTAGGCAG;

[0032] The bases in square brackets are the mutation sites.

[0033] The nucleotide sequences of the above-mentioned SNP sites used to identify yellow-peeled varieties are shown in SEQ ID NOs. 25 to 32.

[0034] A method for identifying yellow peel varieties / lines based on multiplex PCR time-of-flight mass spectrometry, comprising the following steps:

[0035] (1) Extraction of yellow peel DNA;

[0036] (2) using the kumquat DNA extracted in step (1) as a template, performing multiplex PCR amplification using the amplification primers in the SNP site detection primers for identifying kumquat varieties based on multiplex PCR time-of-flight mass spectrometry to obtain an amplification product;

[0037] (3) removing excess dNTPs and primers from the amplified product to obtain a purified amplified product;

[0038] (4) using the extension primers in the SNP site detection primers for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry to extend the purified amplification products to obtain extension products;

[0039] (5) removing excess salt ions in the extension product to obtain a purified extension product;

[0040] (6) Mass spectrometry detection, software analysis of experimental results, and acquisition of typing data;

[0041] (7) Compare with the molecular fingerprint of yellow peel varieties / strains to achieve the identification of yellow peel varieties / strains.

[0042] The mass spectrometry detection described in step (5) is performed using Detection was performed by MALDI-TOF.

[0043] The molecular fingerprints of the yellow peel varieties / lines described in step (7) are shown in Table 3.

[0044] The above-mentioned SNP site detection primers for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry or the SNP sites for identifying yellow peel varieties or the method for identifying yellow peel varieties / lines based on multiplex PCR time-of-flight mass spectrometry in identifying yellow peel varieties / lines.

[0045] Compared with the prior art, the present invention has the following advantages and effects:

[0046] (1) The purpose of the present invention is to provide a set of SNP primer sets for the identification of yellow peel varieties (lines) based on time-of-flight mass spectrometry technology in order to address the shortcomings and deficiencies of existing identification methods for yellow peel varieties (lines), so as to quickly and conveniently identify yellow peel varieties (lines) and establish molecular fingerprints of common yellow peel varieties (lines) in China. The purpose is to overcome the shortcomings of the prior art, provide a combination of SNP molecular markers for constructing DNA fingerprints of yellow peel varieties and their applications, so as to solve the problems of poor repeatability and low polymorphism of co-dominant molecular markers such as RAPD and ISSR used in the prior art. The present invention can effectively identify yellow peel varieties (lines) with different names or the same name but different species, effectively protect the rights and interests of improved variety breeders and forest growers, and improve the degree of improved variety development of yellow peel.

[0047] (2) The present invention uses the smallest primer combination for the first time to effectively distinguish 63 varieties of Wampee trees. The present invention can distinguish 100% of the cultivated varieties. The detection using the single nucleotide marker site of the present invention has the advantages of being simple, rapid, and low-cost, and can be applied on a large scale in production. The method of the present invention has the advantages of high experimental efficiency, accurate detection, and convenient operation. It can provide important technical support for the rapid genetic evaluation of germplasm resources, molecular marker-assisted breeding, and the construction and identification of molecular fingerprints of Wampee in the future. At the same time, the molecular fingerprints of 63 Wampee varieties were constructed, and the above-mentioned Wampee varieties (lines) were successfully identified, which greatly reduced the workload of Wampee identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is the detection result of yellow-peeled varieties by the multiplex PCR-time-of-flight mass spectrometry detection system of 8 SNP sites.

[0049] Figure 2 This is the genetic clustering diagram of 63 yellow peel varieties (lines) based on the multiplex PCR-time-of-flight mass spectrometry detection primer set of 8 SNP loci. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0051] If no specific experimental conditions are specified in the following embodiments, conventional experimental conditions or experimental conditions recommended by the reagent company are generally followed. The materials and reagents used, unless otherwise specified, are all reagents and materials obtained from commercial sources.

[0052] Example 1

[0053] (1) DNA extraction from yellow peel materials

[0054] Young and tender leaves of Wampee varieties from major Wampee producing areas in my country were collected, and the total genomic DNA was extracted using the CTAB method. The concentration, purity and integrity of the DNA were tested, and the qualified samples were used for subsequent PCR amplification.

[0055] Table 1 Basic information of 64 yellow peel varieties (lines)

[0056]

[0057]

[0058] (2) PCR amplification

[0059] The DNA obtained in step (1) was used as a template, and the SNP primer set was used to perform multiple PCR amplification on a thermal amplification instrument to obtain amplified products; the multiple PCR amplification selected a 5 μL system and was performed in a 384-well plate, and the reaction system included: 10 μM amplification primer set, 0.5 μL; template DNA (10-30 ng / μL), 1 μL; 25 mM dNTP mix 0.1 μL; 10×HotStar Taq PCR buffer, 0.5 μL; 25 mM MgCl2 buffer, 0.4 μL; HotStar Taq (5 U / μl), 0.1 μL; ddH2O, 2.6 μL. PCR reaction conditions: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 56°C annealing for 25 s, 72°C extension for 30 s, 40 cycles; 72°C extension for 3 min; 4°C insulation.

[0060] Table 2 Primers for identifying 8 SNP loci in yellow-peeled varieties (lines)

[0061]

[0062] (3) Purification of amplified products

[0063] SAP (shrimp alikaiine phosphtase) treatment was used to remove dNTPs in the reaction. 2 μL of SAP reaction solution was added to the product of the 384-well plate after the reaction in step (2). The reaction solution contained: 10×SAP buffer, 0.17 μL; SAP Enzyme (1.7 U / μL), 0.3 μL; ddH2O, 1.53 μL. The reaction conditions were: 37°C, 40 min; 85°C; 5 min; 4°C, storage.

[0064] (4) Extension reaction

[0065] Configure iPlex (Complete Gold Genotyping Reagent Se, SEQUENOM, catalog number 10148-2) extension reaction reagent, including: 10×iPlex Buffer, 0.2μL; iPlex Termination mix, 0.2μL; iPlex enzyme (2U / μL), 0.041μL; 10uM extension primer solution, 0.804μL; ddH2O, 0.755μL; total volume 2μL. Add the above reaction solution to the product of the 384-well plate after the reaction in step (3), seal the film, centrifuge and place in the PCR instrument, and allow the following program to perform the extension reaction: 94℃ pre-denaturation for 3s; 94℃ denaturation for 5s, 52℃ annealing for 5s, 80℃ extension for 5s, 40 cycles; 72℃ extension for 3min; 4℃ insulation.

[0066] (5) Removal of salt ions

[0067] After the reaction of the 384-well plate obtained in step (4) above is completed, the plate is briefly centrifuged, 6 mg of cation exchange resin is taken and scraped to evenly cover the plate, excess resin is scraped off, and the plate is left for 20 minutes; after the 384-well plate is centrifuged at 1000 rpm for 1 minute, 25 μL of deionized water is added to each well, and the plate is inverted on the resin plate (note that it is fixed and cannot be shifted), and then the resin plate is reversed and buckled on the 384-well plate, and the resin is knocked to make the resin fall into the 384-well plate, and the film is sealed; the 384-well plate is turned over for 20 minutes with the long axis of the 384-well plate as the axis, and centrifuged at 3500 rpm for 5 minutes and then set aside.

[0068] (6) Mass spectrometry

[0069] The test sample is transferred from the 384-well reaction plate to the MassARRAY SpectroCHIP chip with a matrix on the surface. After the sample is transferred to the SpectroCHIP chip, it can be placed in the mass spectrometer for detection. Each detection point only takes 3 to 5 seconds and the analysis is fully automatic. Some results are shown in Figure 1 .

[0070] (7) Molecular fingerprints of yellow-peeled varieties (lines)

[0071] The experimental results were analyzed using TYPER software to obtain typing data and construct molecular fingerprints of yellow-pig varieties (lines) (Table 3). The genetic distances between yellow-pig varieties (lines) were calculated using PowerMarker 3.25, and the clustering diagrams between yellow-pig varieties (lines) were constructed using NTSYS-pc version 2.1 ( Figure 2 ). Figure 2Zhong 28 (Guangxi Seedless) and 24 (Guangdong Yunan Seedless) were classified as the same strain, and their test results were consistent with the actual results. When the fingerprint of the unknown yellow peel variety (strain) to be tested is consistent with the fingerprint of the corresponding yellow peel variety (strain), the name of the yellow peel variety (strain) to be tested can be determined.

[0072] (8) Detection of unknown yellow-skinned varieties (lines)

[0073] Using the above method, the genomic DNA of the yellow peel variety (line) to be tested is extracted, and multiple PCR amplification of the SNP site is performed. The amplified product is genotyped using time-of-flight mass spectrometry to obtain the SNP situation of the corresponding site of the yellow peel variety (line). If the test result is completely consistent with the SNP type in the SNP molecular fingerprint of the above yellow peel variety (line), the strain name of the unknown yellow peel variety (line) is obtained. At the same time, the above test can also be performed on multiple unknown yellow peel varieties (lines), and the relationship between the samples can be confirmed based on the typing results.

[0074] Table 3 Molecular fingerprints of 63 yellow-peeled varieties (lines)

[0075]

[0076]

[0077] *9 in the table represents missing.

[0078] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A primer set for detecting SNP sites in yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry, characterized in that It consists of the following primers:

2. A method for identifying yellow peel varieties / lines based on multiplex PCR time-of-flight mass spectrometry, characterized in that The steps include: (1) Extraction of yellow peel DNA; (2) using the kumquat DNA extracted in step (1) as a template, performing multiplex PCR amplification using the amplification primers in the SNP site detection primer set for identifying kumquat varieties based on multiplex PCR time-of-flight mass spectrometry according to claim 1 to obtain an amplification product; (3) Removing excess dNTPs and primers from the amplified product to obtain a purified amplified product; (4) using the extension primer in the SNP site detection primer set for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry according to claim 1 to perform an extension reaction on the purified amplification product to obtain an extension product; (5) Removing excess salt ions from the extension product to obtain a purified extension product; (6) Mass spectrometry detection, software analysis of experimental results, and acquisition of typing data; (7) Compare with the molecular fingerprint of yellow peel varieties / strains to achieve identification of yellow peel varieties / strains; The mass spectrometry detection described in step (5) is performed using MassARRAY® MALDI-TOF.

3. Use of the SNP site detection primer set for identifying yellow peel varieties based on multiplex PCR time-of-flight mass spectrometry according to claim 1 in identifying yellow peel varieties / lines.

4. Application of the method for identifying yellow peel varieties / lines based on multiplex PCR time-of-flight mass spectrometry as described in claim 2 in identifying yellow peel varieties / lines.

Images