New uses of ccdC gene

Abstract

The present invention discloses a new use of ccdC gene, and belongs to the technical field of microbial genetic engineering. The new use of ccdC gene disclosed by the present invention is to improve the motility of strains, reduce the wrinkling of bacterial biofilms, destroy the stability of biofilm structures, promote bacterial dispersion, promote spore formation, inhibit the growth of Nicotiana benthamiana, and inhibit the secretion of indoleacetic acid by strains; the nucleotide sequence of the ccdC gene is shown in SEQ ID NO.1. The present invention also discloses a ccdC gene mutant strain SZZ06. Compared with the wild type FZB42, the ccdC gene mutant strain SZZ06 of the present invention has reduced motility of strains, greater wrinkling of biofilms, more stable structure of biofilms, slower bacterial dispersion, less spore formation, and promotes the secretion of indoleacetic acid by strains and promotes plant growth.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial genetic engineering, and more specifically, relates to a new use of ccdC gene. Background Art

[0002] Biofilm is the main form of existence of most bacteria in nature, and it is also a key factor in the colonization of bacteria on the surface of the host. In the early stage of biofilm formation, bacteria use extracellular organelles such as flagella and outer membrane proteins to attach to the surface of the carrier, and then enhance the adhesion between the bacteria and the carrier by secreting EPS. The bacteria adhering to the surface of the carrier increase the population by dividing and promote the formation of colonies. The colony grows into a mature biofilm. However, as the biofilm continues to develop, the bacteria inside the biofilm are away from the nutrients or energy necessary for growth in the environment, and the accumulated waste and toxins threaten the safety of the bacteria themselves. At this time, a small number of bacteria in the film will actively disperse. The dispersed bacteria will re-adsorb on the surface of the carrier in the new environment to form a new biofilm. This is the complete cycle of biofilm development.

[0003] The CcdC gene is located downstream of ccdA in the genome of Bacillus varezii, immediately after ccdB. There is no functional annotation and report of the ccdC gene in the database. The homologous gene is orf160 (also known as the yneJ open reading frame) in the two open reading frames orf120 and orf160 co-transcribed with ccdA, which Torbjorn schiott discovered when studying the role of ccdA in cytochrome C synthesis in Bacillus subtilis. However, studies have shown that only ccdA is essential in the maturation of cytochrome C, while the other two genes do not play a role in this process. Orf160 is just a predicted 18-Kd hydrophobic protein, which has no relevant information in the database. Studies have shown that the loss of ccdC causes many phenotypes in Bacillus varezii, suggesting that this gene is functional and plays an important role in Bacillus varezii FZB42. Summary of the invention

[0004] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a new use of the ccdC gene for screening excellent strains; another technical problem to be solved by the present invention is to provide a ccdC gene mutant strain SZZ06 for screening excellent growth-promoting strains.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0006] A new use of the ccdC gene, the new use is to improve the motility of the strain, reduce the wrinkling of the bacterial biofilm, destroy the stability of the biofilm structure, promote bacterial dispersion, promote spore formation, inhibit the growth of Nicotiana benthamiana, and inhibit the secretion of indoleacetic acid by the strain; the nucleotide sequence of the ccdC gene is shown in SEQ ID NO.1.

[0007] Application of ccdC gene in improving the motility of strains and / or reducing the wrinkling of bacterial biofilms and / or destroying the stability of biofilm structures and / or promoting bacterial dispersion and / or promoting spore formation and / or inhibiting the growth of Nicotiana benthamiana and / or inhibiting the secretion of indoleacetic acid by strains.

[0008] The method for constructing a ccdC gene mutant strain comprises:

[0009] 1) Construction of a knockout fragment of the biofilm dispersion regulatory gene ccdC;

[0010] 2) transforming the constructed biofilm dispersion regulatory gene ccdC knockout fragment into Bacillus varezii FZB42;

[0011] 3) Cultivating and screening to obtain mutant strains of the biofilm dispersion regulating gene ccdC;

[0012] The nucleotide sequence of the biofilm dispersion regulating gene ccdC knockout fragment is shown in SEQ ID NO.2.

[0013] The method for constructing a ccdC gene mutant strain is to construct a biofilm dispersion regulating gene ccdC mutant strain.

[0014] Application of ccdC gene mutants in reducing the motility of Bacillus varezii strains.

[0015] Application of ccdC gene mutant strain in enhancing the wrinkling and maintaining structural stability of Bacillus varezii biofilm.

[0016] Application of ccdC gene mutant strain in inhibiting the dispersal of Bacillus varezii.

[0017] Application of ccdC gene mutant strain in inhibiting spore formation of Bacillus varezii.

[0018] The application of the ccdC gene mutant in promoting the growth of Nicotiana benthamiana is characterized in that the promotion of Nicotiana benthamiana growth is to promote the increase of Nicotiana benthamiana plant height, root length, fresh weight and dry weight, and to promote the thickening and greening of Nicotiana benthamiana leaves.

[0019] Application of ccdC gene mutants in secretion of indoleacetic acid.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] 1) Compared with the wild type FZB42, the ccdC gene mutant strain SZZ06 of the present invention has reduced motility, more wrinkled biofilm, more stable biofilm structure, slower bacterial dispersion, and less spore formation.

[0022] 2) In the present invention, ddH2O was used as a control and SZZ06mut bacterial solution was used at 1×10 7 CFU / g soil were used to irrigate the roots of Nicotiana benthamiana. The plant height, root length, fresh weight and dry weight of Nicotiana benthamiana treated with SZZ06mut increased by 497.16%, 59.74%, 4225.16% and 2268.42%.

[0023] Using LB medium as the control, the height of Nicotiana benthamiana treated with SZZ06mut increased by 73.51%, the root length increased by 5.16%, the fresh weight increased by 201.95%, and the dry weight increased by 209.08%.

[0024] Moreover, the root system of Nicotiana benthamiana treated with SZZ06mut was more developed than that of Nicotiana benthamiana treated with FB01mut, LB, and ddH2O, and the leaves were wider, thicker, and darker green.

[0025] 3) Within 0-24 hours, the IAA concentration / OD600 value in the culture fluid of SZZ06 of the present invention is greater than that of FZB42. The results show that the same amount of ccdC mutant strain SZZ06 can secrete more IAA. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the growth curve of FZB42 and SZZ06;

[0027] Figure 2 The movement of FZB42 and SZZ06 on LB semi-solid medium (A is the comparison of the movement ability of FZB42 and SZZ06; B is the comparison of the movement distance of FZB42 and SZZ06 at 12+7h (P<0.01));

[0028] Figure 3 The diagrams are of biofilm formation of FZB42 and SZZ06 (A is the biofilm formation of FZB42 and SZZ06 at the gas-solid and gas-liquid contact surfaces; B is the dry weight of biofilm of FZB42 and SZZ06 at 0-120h; C is the biofilm growth of FZB42 and SZZ06 at 0-120h);

[0029] Figure 4The diagrams are for the biofilm dispersion of FZB42 and SZZ06 (A is the downward dispersion of FZB42 and SZZ06 in LBGM medium; B is the upward dispersion of FZB42 and SZZ06; C is the change of OD value of the bottom solution of FZB42 and SZZ06 biofilm from 0 to 120 hours);

[0030] Figure 5 The spore formation of FZB42 and SZZ06 is shown in Figure 1 (A is the morphological observation of FZB42 and SZZ06 on LB plate, DSM medium and under optical microscope; B is the spore formation rate of FZB42 and SZZ06 at 12h, 24h and 36h; C is the spore formation rate of FZB42 and SZZ06 after treatment with high temperature, chloroform, lysozyme and ultraviolet light);

[0031] Figure 6 Figure 1 is a graph showing the biological function of the ccdC gene (A is the PCR result of the ccdC mutant strain SZZ18: 1, 2, and 3 represent different transformants, and M1 represents a 2000bp Marker; B is the PCR result of the ccdC complement strain SZZ15: 1-7 represent different transformants, and M2 represents a 5000bp Marker; C is the biofilm and dispersion of FZB42, SZZ06, SZZ15, and SZZ18 at the final stage; D is the OD of the bottom solution of the biofilm of FZB42, SZZ06, SZZ15, and SZZ18 600 value);

[0032] Figure 7 This is a validation diagram of the GFP-tagged SZZ06 strain;

[0033] Figure 8 This is a diagram showing the colonization of the gfp-labeled strain in the roots of Nicotiana benthamiana;

[0034] Fig. 9 This is a graph showing the number of bacteria on the second day of colonization of the gfp-labeled strain in the roots of Nicotiana benthamiana;

[0035] Fig.10 This is a graph showing the growth promotion of Nicotiana benthamiana by FB01mut and SZZ06mut;

[0036] Fig.11 This is a graph showing changes in IAA concentrations of FZB42 and SZZ06 in LB culture medium. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.

[0038] The pFB01 vector, pFB103 vector, pSZZ11 vector, pSZZ13 vector and pSZZ17 vector described in the present invention are all stored in the Molecular Pathology Laboratory of the Forestry College of Nanjing Forestry University.

[0039] Main reagent: QuickCut TM Cla I(1608,Takara),QuickCut TM Kpn I (1618, Takara), Nru I (1168A, Takara), KH2PO4 (7778-77-0, Sangon Biotech), trisodium citrate (6132-04-3, Sangon Biotech).

[0040] LB medium: Tryptone 10g / L, Yeast extract 5g / L, Nacl 5g / L, solid culture medium needs to add Agar 15g / L.

[0041] LBGM medium: Tryptone 10 g / L, Yeast extract 5 g / L, NaCl 5 g / L, 50% glycerol 20 mL, 0.1 M MnSO4 1 mL, Agar 15 g / L.

[0042] DSM medium; peptone 10 g / L, beef extract powder 3 g / L, Nacl 5 g / L, KCl 1 g / L, MgSO4·7H2O 0.12 g / L, 1M Ca(NO3)2 1 mL, 1M MnCl2 10 μL, 0.01M FeSO4 100 μL).

[0043] MC buffer solution: phosphate buffer solution 100 mM, trisodium citrate 3 mM, glucose 2%, cheese hydrolyzate 0.1%, ammonium ferric citrate 22 μg / mL.

[0044] 0.5M FeCl3 solution: Accurately weigh 1.35g FeCl3·6H2O, dissolve it in 10mL distilled water, and store it at room temperature for later use.

[0045] Salkowsi reagent: Accurately measure 25 mL of 70% HClO4 and add it to 25 mL of distilled water. After cooling to room temperature, add 1 mL of 0.5 M FeCl3 solution to obtain the Salkowsi reagent. Keep away from light.

[0046] Example 1

[0047] 1. The E. coli-Bacillus shuttle plasmid pMarA was transformed into FZB42 by electroporation, and the correctly verified transformant was named FBS239.

[0048] The FBS239 plate stored in a -80℃ refrigerator was streaked, cultured overnight in a 30℃ constant temperature incubator, and a single colony was picked and inoculated into LB liquid medium (Kan, Em), cultured at 30℃, 200rpm for 12h, and the bacterial solution was diluted 105-107 times and applied to Kan screening medium, placed in an oven at 50℃ for 12h, and then transferred to a constant temperature incubator at 30℃ for 12h; the grown single colonies were picked and streaked and inoculated on Kan and Em screening medium one by one. The colony that can grow on Kan screening medium but not on Em screening medium is a correct transposon, and 5000 transposons were picked to form the FZB42 transposon mutation library.

[0049] 5000 transformants were inoculated into 96-well plates filled with LBGM liquid culture medium and cultured at 30°C for 96 h. A mutant strain SZZ06 was screened based on the biofilm non-dispersion phenotype.

[0050] 2. Effect of ccdC gene on the growth of Bacillus varezii FZB42

[0051] FZB42 and ccdC mutant SZZ06 were streaked on LB plates and cultured in a 37°C constant temperature incubator overnight. Fresh single colonies were picked and inoculated into LB medium and pre-cultured at 37°C until OD 600 =0.6. 1 / 100 of the sample was transferred to 50 mL LB medium and cultured at 37°C, 200 rpm for 48 h. Samples were taken every 2 h, and the LB medium was used as a blank control. The OD was measured using a UV spectrophotometer. 600 value and record it; with time as the horizontal axis, logOD 600 The growth curve was drawn as the ordinate. The growth of FZB42 and ccdC mutant SZZ06 from 0 to 48 h was measured by turbidimetry, and the growth curve was drawn.

[0052] The results are as follows Figure 1 As shown in the figure, both FZB42 and SZZ06 entered the plateau phase at 24h. However, before entering the plateau phase, the bacterial count of SZZ06 increased more slowly than that of FZB42 in the same period of time. After entering the plateau phase, SZZ06 died at a faster rate. At 48h, the OD value of SZZ06 was almost close to 0.

[0053] The growth of FZB42 and SZZ06 on LB solid plates was observed.

[0054] The results are as follows Figure 5As shown in the figure, after overnight culture at 37°C, the bacterial morphology of SZZ06 was smaller than that of FZB42 and appeared moist. After that, after continued growth at room temperature for 5 days, SZZ06 showed a certain degree of lysis. As the culture time at room temperature increased, the degree of lysis of SZZ06 gradually deepened and finally became translucent, while FZB42 maintained a milky white dry colony morphology. The results showed that the ccdC gene inhibited cell division.

[0055] 3. Effect of ccdC gene on motility of Bacillus varezii FZB42

[0056] After taking out the LB semi-solid medium containing 0.7% agar from the high-pressure steam sterilizer, it was immediately dispensed with a pipette in the clean bench to ensure that each culture dish contained 30mL of culture medium. In the clean bench, the culture dish was completely opened and blown for 20 minutes before use. FZB42 and ccdC mutant strain SZZ06 were inoculated on LB solid culture medium by plate streaking method and cultured at 37℃ overnight. Pick a single colony with good growth and inoculate it in 10mL LB liquid culture medium, and pre-culture at 37℃ to OD=2. Take 1μL of culture solution and inoculate it on the surface of LB semi-solid culture medium, open the culture dish completely and blow for 10min, and then culture it at 25℃ for 12h. After taking out the culture dish, continue to culture it at room temperature, observe the movement of bacteria and take pictures.

[0057] The results are as follows Figure 2 As shown, the plate inoculated with the corresponding bacteria was first cultured in a 25°C incubator for 12 hours and then transferred to room temperature for further culture for 7 hours. At this time, it can be observed that the movement range of FZB42 is significantly larger than that of SZZ06 ( Figure 2 A). The movement distance of the two was measured by vernier caliper, and the results of GraphPad software significance analysis showed that there was a significant difference between the two (P < 0.01) ( Figure 2 B). After that, when the culture was continued at room temperature for 24 hours, the colonies of FZB42 and SZZ06 had spread to the edge of the plate. The results showed that the deletion of ccdC gene would reduce the motility of the strain.

[0058] 4. Effect of ccdC gene on biofilm formation ability of Bacillus varezii FZB42

[0059] 1) Qualitative analysis of biofilm at air-solid interface

[0060] Pick a fresh single colony and inoculate it into LB medium, and pre-culture at 37℃ until OD 600 =2. Take 1 μL of the culture solution and carefully place it on the LBGM medium. After drying, place it upside down in a 25°C incubator for culture. Observe the phenotype of bacterial biofilm formation every 12 hours.

[0061] 2) Qualitative and quantitative analysis of biofilm at the air-liquid interface

[0062] Pick a fresh single colony and inoculate it into LB liquid culture medium, and pre-culture at 37℃ until OD=2. Transfer to LBGM liquid culture medium at 1 / 100. Transfer 2mL of bacterial solution to each well in a 24-well plate and culture at 25℃ for 120h. Observe the phenotype of bacteria forming pellicles every 12h. At the same time, take out the culture plate every 12h, carefully remove the culture solution at the bottom of the biofilm, and use 2mL of methanol to elute the biofilm attached to the wall of the plate and transfer it to a 2mL centrifuge tube. Centrifuge at 12000rpm for 1min, remove the supernatant, open the centrifuge tube and place it in an oven to dry for more than 12h. Weigh and record the data.

[0063] 3) The results are as follows Figure 3 As shown, both FZB42 and SZZ06 can form dense biofilms. From the appearance of the biofilm, there are obvious differences between the two. The FZB42 biofilm has an obvious circular area in the center, which is a ring-shaped bulge. There are obvious irregular dot-like bulges inside the circular area, and the outside of the circular area presents a "ridge"-like bulge; the SZZ06 biofilm has no obvious regional divisions and is wrinkled as a whole. The LBGM liquid culture medium with FZB42 and SZZ06 was divided into 5mL culture medium per test tube and cultured at 25°C to observe the difference in the formation of floating biofilms (pellicles) between the two. The results showed that after 7 days of culture in the test tube, SZZ06 showed a thicker and more wrinkled biofilm than FZB42 ( Figure 3 A).

[0064] In order to better compare the differences between FZB42 and SZZ06 in pellicle formation, the culture medium containing FZB42 and SZZ06 was dispensed into 24-well plates at 2 mL per grid, and the biofilm phenotypes of the two were observed from 0 to 120 h. At the same time, the dry weight of the biofilms of FZB42 and SZZ06 was measured every 12 h to quantitatively compare the differences in pellicles between the two. From the experimental results, in the initial stage of biofilm formation, FZB42 gathered at the air-liquid surface earlier than SZZ06. With the increase of culture time, the SZZ06 biofilm showed stronger wrinkling, and the dry weight of the SZZ06 biofilm was heavier than that of FZB42. After that, although FZB42 and SZZ06 still maintained a relatively complete biofilm morphology, the dry weight showed a downward trend ( Figure 3 B, C). The FZB42 and SZZ06 biofilms were cultured until the 10th day. During this period, the FZB42 biofilm gradually disintegrated, while the SZZ06 biofilm still maintained a relatively intact morphology on the 10th day ( Figure 6 C). The experimental results show that the loss of ccdC gene enhances the wrinkling of bacterial biofilm and maintains the stability of the structure.

[0065] 5. Effect of ccdC gene on biofilm dispersion ability of Bacillus varezii FZB42

[0066] 1) Method 1: Inoculate a fresh single colony into 10 mL LB liquid culture medium and pre-culture at 37°C until OD = 2. Transfer to LBGM liquid culture medium at 1 / 100. Transfer 2 mL of the bacterial solution to each well in a 24-well plate and culture at 25°C for 120 hours. Observe the turbidity of the solution at the bottom of the biofilm at the air-liquid interface. At the same time, aspirate the culture solution at the bottom of the biofilm at the air-liquid interface every 12 hours, use the uninoculated culture solution as a blank control, and measure the OD using a UV spectrophotometer. 600 The value is recorded. With time as the horizontal axis, OD 600 The biofilm dispersion curve is plotted as the ordinate.

[0067] The results are as follows Figure 4 As shown, at the end of biofilm growth, when the number of bacteria participating in dispersion reaches a certain level, they will be actively released from the cracks in the biofilm wall or colony by swimming or other means into the external environment. Therefore, observing the turbidity of the solution at the bottom of the biofilm can reflect the dispersion ability of bacteria to a certain extent. The experiment cultured test tubes containing FZB42 and SZZ06 culture solutions at 25°C. The results showed that on the 15th day, the solution at the bottom of the FZB42 biofilm was slightly turbid, while the solution at the bottom of the SZZ06 biofilm was brown and clear. Taking into account the delayed motility of SZZ06, the test tubes were placed at 25°C for continued culture. As the culture time increased, the turbidity of the solution at the bottom of the FZB42 biofilm gradually increased, while the solution at the bottom of the SZZ06 biofilm remained clear. This phenomenon did not change until the SZZ06 biofilm collapsed ( Figure 4 A).

[0068] At the same time, the experiment was conducted by monitoring the OD of the solution at the bottom of the biofilm in a 24-well plate. 600 The results showed that from 72h onwards, the OD value of the bottom solution of the FZB42 biofilm was 600 The OD value of the solution at the bottom of the SZZ06 biofilm gradually increased with time, while the OD value of the solution at the bottom of the SZZ06 biofilm remained relatively stable between 0 and 120 h ( Figure 4 C).

[0069] 2) Considering that the downward movement of bacteria in the biofilm may be affected by factors such as gravity, resulting in inactive movement, another experimental method was used to exclude this possibility.

[0070] Method 2: Pick a fresh single colony and inoculate it in 10mL LB liquid culture medium, and pre-culture it at 37℃ until OD=2. Add 1mL LBGM culture medium containing 2% agar to the bottom of a 10×1.5cm glass test tube. Take 1μL of culture medium and inoculate it on the surface of the solidified culture medium, and incubate it at 25℃ for about 140h to form a biofilm at the air-solid interface. Slowly add 3mL LBGM liquid culture medium along the wall of the test tube, incubate it at 25℃, and observe the formation of the biofilm at the air-liquid interface in the test tube every half an hour. Carefully remove the culture medium between the air-solid biofilm and the air-liquid biofilm, and invert it in an oven for about 10min to fix the biofilm at the air-liquid interface on the wall of the test tube. Use a pipette to add crystal violet dye along the wall of the tube so that the biofilm and crystal violet are fully in contact, and let it stand for 5min. Pour out the crystal violet dye, carefully rinse the test tube with distilled water, and wash off the excess dye. Place the cleaned test tube in an oven to dry thoroughly, so that the solid culture medium at the bottom falls off. Take photos and record.

[0071] result( Figure 4 B) shows that FZB42 has an obvious "purple ring" at the air-liquid interface, while SZZ06 has almost none, which indicates that bacteria in the SZZ06 biofilm can hardly be freed in an active way. In general, the experimental results show that the loss of the ccdC gene inhibits the occurrence of bacterial dispersion.

[0072] 6. Effect of ccdC gene on spore formation ability of Bacillus varezii FZB42

[0073] 1) Inoculate the bacteria on LB solid medium by the plate streak method and culture at 37℃ for 5 days. Pick a small amount of bacteria and mix it with sterile water added to the center of the slide. Let it stand for the water to evaporate, cover the bacteria with ammonium oxalate crystal violet solution, and stain for 1 minute. Pour out the stain and rinse with distilled water. Use absorbent paper to absorb excess water, observe the bacterial spore formation under an optical microscope with a 100x oil lens, and take pictures. After the experiment, tidy up and clean the microscope.

[0074] 2) Pick a fresh single colony and inoculate it into 10 mL LB liquid medium, and pre-cultivate at 37°C 200 rpm until OD 600 =0.6. At 1 / 100, the bacteria were transferred to 50 mL of DSM medium and cultured at 37°C and 200 rpm for 36 h. Samples were taken at 12 h, 24 h, and 36 h, respectively, and heated at 85°C for 20 min to determine the effect of high temperature on bacterial spores. In addition, the bacteria grown in DSM medium for 36 h were treated with chloroform, lysozyme, and ultraviolet irradiation for 15 min to determine the bacterial spore formation rate.

[0075] 3) The results are as follows Figure 5As shown in Figure 2, crystal violet was used to stain FZB42 and SZZ06 bacteria grown on LB plates for 5 days. Microscopic observations showed that nearly 100% of the FZB42 population had bright endospores, while there were almost no bright endospores in the SZZ06 population ( Figure 5 A). At the same time, FZB42 and SZZ06 were inoculated into DSM medium that promotes spore formation, cultured at 37°C for 36 hours, and samples were taken at 12 hours, 24 hours, and 36 hours, respectively, and the spore formation efficiency of FZB42 and SZZ06 was determined by heat killing experiments. The results showed that after 12 hours of growth in DSM medium, nearly 50% of the heat-resistant spores had been produced in the FZB42 population. As the culture time increased, the heat-resistant spore production rate in the FZB42 population gradually increased. When the culture continued to grow for 36 hours, nearly 90% of the heat-resistant spores had been produced in the FZB42 population. Under the same culture conditions, spores in the SZZ06 population were synthesized at a very low efficiency or basically not formed ( Figure 5 B). The DSM medium inoculated with FZB42 and SZZ06 was kept at 37°C for 48 hours. At this time, the FZB42 culture fluid was milky and turbid, while SZZ06 was lysed to a certain extent and the culture fluid was clear. This also happened on the LB plate ( Figure 5 A).

[0076] In addition to being resistant to high temperatures, spores are also highly resistant to ultraviolet rays and toxic chemicals. Therefore, this experiment also used lysozyme, chloroform and ultraviolet rays to treat FZB42 and SZZ06 grown in DSM medium for 36 hours. The results showed that FZB42 showed a relatively high tolerance, while SZZ06 still maintained a low survival rate, which is consistent with the results of the heat killing experiment ( Figure 5 C). In general, the experimental results show that the deletion of ccdC gene makes the strain lose the ability to form spores.

[0077] Example 2

[0078] 1. Construction of ccdC mutant strain SZZ18

[0079] 1) Extract DNA of FZB42.

[0080] 2) Construction of pSZZ11 plasmid

[0081] (1) PCR amplification of FZB42 DNA was performed using primers szz38 (5'-ATCGGTCTTGCGTTTGCAG-3') and szz39 (5'-TGTCCGGTCATATCAGTCAT-3'). The PCR reaction system was: 4 μL Genomic DNA, 2 μL szz38, 2 μL szz39, Max DNA Polymerase 25μL, ddH2O up to 50μL. PCR reaction conditions: 98℃10s; 98℃10s, 55℃5s, 72℃60s, 30 cycles; 72℃120s; 10℃60s.

[0082] After the PCR reaction was completed, 2 μL of PCR stock solution was mixed with 0.5 μL of loading buffer (containing dye), and the results were compared in 1% agarose gel electrophoresis.

[0083] (2) Purify the DNA product according to the instructions of TIANquick Midi Purification Kit.

[0084] (3) Add A-tailing according to the instructions of Takara DNA A-Tailing Kit. The A-tailing reaction system is: Genome DNA 30μL, 10×A-Tailing Buffer 5μL, dNTP Mixture 4μL, A-Tailing Enzyme 0.5μL, ddH2O up to 50μL. Reaction conditions are: 72℃20min; stand on ice for 1-2min.

[0085] (4) Perform agarose gel recovery according to the instructions of TIANgel Midi Purification Kit.

[0086] (5) Prepare E. coli Top10 competent cells according to the Molecular Cloning Experiment Guide.

[0087] (6) According to the instruction manual of Takara T-Vector pMD-19, the reaction solution was connected to pMD-19. The specific steps are as follows:

[0088] Prepare the reaction solution in a centrifuge tube (1μL of T-Vector pMD19 (Simple), 1μL of PCR reaction solution, 3μL of ddH2O, and 5μL of DNA Ligation Kit. Reaction conditions: 16℃ for 30min.); add the reaction solution to 100μL of Top10 competent cells, pipette and mix, and place on ice for 30min; incubate in a 42℃ water bath for 45sec, then quickly place on ice for 1min; add 890μL of LB medium to the centrifuge tube, shake and culture at 37℃ for 60min; take 100μL of the transformed solution and spread it on LB medium with X-Gal, IPTG, and Amp, and culture at 37℃. Select white colonies for PCR verification.

[0089] (7) Colony PCR was performed on the white colonies using primers szz01 (5'-AAGCATCTAAAGTGCTGGAG-3') and szz02 (5'-CAGATTGATCTTACTCCTTATC-3'). The specific steps are as follows:

[0090] Take freshly cultured bacteria, pick up a small amount of bacteria with a sterilized toothpick, mix evenly with 20μL ddH2O; place in a 95℃ metal bath for 10min, place in an ice bath or -20℃ refrigerator for 2-3min, centrifuge at 13000rpm for 30sec, and perform PCR. Select positive clones and name the plasmid pSZZ11.

[0091] 3) Construction of pSZZ17 plasmid

[0092] (1) Extract the DNA of pSZZ11 plasmid using the SDS alkaline lysis method according to the Molecular Cloning Experiment Guide;

[0093] (2) The pSZZ11 plasmid was digested with NruI. The digestion reaction system was: pSZZ11 20 μL, NruI enzyme 2 μL, 10×NruI cut buffer 5 μL, ddH2O up to 50 μL. The reaction conditions were: 37°C for 1.5 h.

[0094] (3) Purify the DNA product according to the instructions of TIANquick Midi Purification Kit to obtain the purified product;

[0095] (4) Dephosphorylation was performed using Takara Alkaline Phosphatase (E. coli C75). The reaction system was: 30 μL of purified product, 1 μL of Alkaline Phosphatase (E. coli C75), 6 μL of 10X Alkaline Phosphatase Buffer, and 60 μL of ddH2O. The reaction conditions were: 37°C for 30 min.

[0096] (5) Recover the plasmid by agarose gel according to the instructions of TIANgel Midi Purification Kit;

[0097] (6) Using primers szz46+Nru I

[0098] (5'-GTCTCGCGAGCATATGATCAGATCTTAAGGCC-3') and szz47+Nru I (5'-GTCTCGCGATTGAAGCATGCAAATGTCACT-3') were used to amplify the spe fragment. The PCR reaction system was: 4 μL of pFB103 DNA, 2 μL of szz46+Nru I, 2 μL of szz47+Nru I, Max DNA Polymerase 25μL, ddH2O upto 50μL. PCR reaction conditions are: 98℃10s; 98℃10s, 55℃5s, 72℃30s, 30 cycles; 72℃60s; 10℃60s.

[0099] (7) Purify the DNA product according to the instructions of TIANquick Midi Purification Kit;

[0100] (8) The purified product was digested with Nru I. The digestion reaction system was: 30 μL pSZZ11, 2 μL Nru I enzyme, 5 μL 10× Nru I cut buffer, and 50 μL ddH2O. The reaction conditions were: 37°C for 1.5 h.

[0101] (9) Recover the spe fragment by agarose gel according to the instructions of TIANgel Midi Purification Kit;

[0102] (10) The products of step (5) and step (9) were subjected to enzyme ligation reaction according to n plasmid: n fragment = 1:3. The ligation system was: DNA fragment 4 μL, T4 DNA Ligase 0.5 μL, 10×T4 DNA Ligase Buffer 2.5 μL, ddH2O up to 25 μL. The reaction conditions were: 16°C overnight to obtain the enzyme ligation product.

[0103] (11) The enzyme-linked product was transferred into ER2925 and spread on a plate containing spe antibiotics. Positive clones were screened using primers szz01 and szz02, and the plasmid was named pSZZ17.

[0104] 4) Construction of ccdC mutant strain SZZ18

[0105] (1) Preparation of FZB42 competent cells, the specific steps are as follows:

[0106] FZB42 was inoculated into 10 mL LB medium and cultured at 37°C 200 rpm overnight; 1% was transferred into 100 mL LB liquid medium and cultured at 37°C 200 rpm until the OD 600 =0.4-0.6; take out the bacterial solution and dispense it into sterilized 50mL centrifuge tubes, and place them in an ice bath for 10-15min; centrifuge at 4℃, 6000rpm for 5min to collect the precipitated cell mass, resuspend it with 5-10mL ice-cold sterile 10% glycerol aqueous solution, and wash it twice; resuspend it with 1mL ice-cold sterile 10% glycerol aqueous solution, dispense 100μL of each into centrifuge tubes, and freeze at -80℃.

[0107] (2) Extract pSZZ17 plasmid according to the instructions of TIANprep Rapid Mini Plasmid Kit;

[0108] (3) The pSZZ17 plasmid was transformed into FZB42 by electroporation. The specific steps are as follows: thaw the FZB42 competent cells on ice, add 5-10 μL pSZZ17 plasmid, and gently pipette to mix; transfer it to a pre-cooled electroporation cup after there are no bubbles, ice bath for 5 minutes, wipe the surface of the electroporation cup dry, and electroporate. The electroporation parameters are 2050v 200Ω25uF, and the time is 4.0ms-10ms; after the electroporation, add 1mL LB liquid culture medium to the electroporation cup and transfer it to a 2mL centrifuge tube, shake and culture at 37℃700rpm for 1h; spread it on a LB solid plate containing spe resistance and culture it at 37℃ overnight; use primers szz01 and szz02 for colony PCR verification. The reaction conditions and system are shown in Tables 1 and 2. The obtained positive transformants were stored in a -80℃ refrigerator.

[0109] Table 1 Sequences of primers szz01 and szz02

[0110] Primer name Sequence (5'-3') szz01 AAGCATCTAAAGTGCTGGAG szz02 CAGATTGATCTTACTCCTTATC

[0111] Table 2 PCR reaction system

[0112]

[0113]

[0114] The results are as follows Figure 6 As shown in A, the size of the transformant PCR amplification band is about 2000bp, and the size of the negative control PCR amplification band is about 750bp. Since the size of the spe antibiotic fragment is 1204bp, the size of the amplification bands of these mutants is consistent with the size of the fragment after spe is inserted into the ccdC gene. Several samples were selected and sent to Jie Li Company for sequencing. The sequencing results showed that the ccdC mutant SZZ18 was successfully constructed.

[0115] 2. Construction of complement strain SZZ15

[0116] 1) Extract DNA of FZB42.

[0117] 2) Construction of pSZZ13 plasmid

[0118] (1) Using primers szz44+Kpn I

[0119] (5'-CGGGGTACCATGATGATTATAATTTCATCCG-3') and szz45+Cla I (5'-CCCATCGATATTCATCTGAATATCAGCGG-3') were used to amplify FZB42 DNA. The PCR reaction system and conditions were as follows: Genomic DNA 4 μL, Primer-F 2 μL, Primer-R 2 μL, Max DNA Polymerase 25μL, ddH2O upto 50μL. PCR reaction conditions: 98℃10s; 98℃10s, 55℃15s, 72℃30s, 30 cycles; 72℃60s; 10℃60s.

[0120] (2) Purify the DNA product according to the instructions of TIANquick Midi Purification Kit;

[0121] (3) Extract plasmid pFB01 according to the instructions of TIANprep Rapid Mini Plasmid Kit;

[0122] (4) Use Cla I to digest pFB01 and the purified DNA product in (2). The reaction system is as follows: DNA fragment 30μL, QuickTM Cla I enzyme 2μL, 10×Cla I cut buffer 5μL, ddH2O up to 50μL. Reaction conditions: 37℃ for 1.5h.

[0123] (5) Purify the DNA product according to the instructions of TIANquick Midi Purification Kit to obtain the purified product;

[0124] (6) Kpn I was used to digest pFB01 and the purified DNA product in (5). The reaction system was as follows: DNA fragment 30 μL, Kpn I enzyme 2 μL, 10×Kpn I cut buffer 5 μL, ddH2O up to 50 μL. Reaction conditions: 37°C for 1.5 h.

[0125] (7) Perform agarose gel recovery according to the instructions of TIANgel Midi Purification Kit;

[0126] (8) The digested product of plasmid pFB01 and the purified product were ligated by enzyme according to the ratio of n plasmid: n fragment = 1:3. The ligation system was as follows: DNA fragment 4 μL, T4 DNA Ligase 0.5 μL, 10×T4 DNA Ligase Buffer 2.5 μL, ddH2O up to 25 μL. The reaction conditions were: 16°C overnight to obtain the enzyme ligation product.

[0127] (9) The enzyme-linked product was transferred into ER2925 and spread on a plate containing Amp antibiotic. Positive clones were screened using primers FBO550 (5'-GTTTGTCTGCCGTGATGT-3') and FBO16 (5'-TGGGTCAATCGAGAATATCGTC-3'), and the plasmid was named pSZZ13.

[0128] 3) Construction of ccdC complementation strain

[0129] (1) Extract plasmid pSZZ13 according to the instructions of TIANprep Rapid Mini Plasmid Kit;

[0130] (2) pSZZ13 was transformed into SZZ06 using the chemical transformation method. The specific steps are as follows: pick a single colony and add it to 1 mL MC medium containing 3 μL MgSO4, and shake it at 37°C and 200 rpm for 3-4 h; add 10 μL of plasmid and continue to shake it at 37°C and 750 rpm for 2 h; spread it on a plate containing Em antibiotics and perform colony PCR using primers FBO550 and FBO16. The correct transformant was stored at -80°C, which is the ccdC complemented strain.

[0131] The results are as follows Figure 6 As shown in B, the transformant band size is about 1500bp, and the negative control band size is about 1000bp. Since the ccdC gene band size is 483bp, the amplified band sizes of these complemented strains are consistent with expectations. Several samples were selected and sent to Jie Li Company for sequencing. The sequencing results showed that the ccdC complemented strain SZZ15 was successfully constructed.

[0132] 3. Determine the biofilm phenotype and dispersion of the ccdC complemented strain SZZ15 and the ccdC mutant strain SZZ18 at the final stage of the biofilm life cycle.

[0133] The results are as follows Figure 6As shown in C, on the 10th day, the biofilm of FZB42 had disintegrated, while the biofilm structures of SZZ06 and SZZ18 were still relatively intact, and the biofilm of SZZ15 was close to disintegration. At the same time, the bottom solutions of SZZ06 and SZZ18 were brown and clear, while the bottom solutions of FZB42 and SZZ18 were turbid. Comparison of the OD values ​​of the bottom solutions of the biofilms of the four strains 600 The results showed that there was no significant difference between SZZ06 and SZZ18, and the OD of SZZ15 600 Value between FZB42 and SZZ06 ( Figure 6 D) The experimental results show that the ccdC gene plays an important role in dispersion, and the loss of the ccdC gene will inhibit the occurrence of bacterial dispersion.

[0134] Example 3

[0135] 1. Construction of SZZ06 fluorescently labeled strain

[0136] The strain FB01mut (FZB42 amyE::Emr-gfp+) (Fan B, 2011)) was prepared into competent cells using MC medium. According to the principle of homologous recombination, SZZ06 DNA was transformed into FB01mut. The strain was screened using Kan antibiotic plates and primers szz01 and szz02, and the GFP expression of the strain was observed using a gel imaging system.

[0137] The results are as follows Figure 7 As shown, the SZZ06 fluorescent-labeled strain was successfully constructed and named SZZ06mut (SZZ06amyE::Emr-gfp+).

[0138] 2. Effect of ccdC gene on root colonization of Bacillus varezii FZB42

[0139] The growth of FB01mut and SZZ06mut colonized in the roots of Nicotiana benthamiana for two days was observed using a Zeiss fluorescence microscope.

[0140] The results are as follows Figure 8 As shown, the labeled strains were observed in many places in the roots of Nicotiana benthamiana and were mostly distributed in clusters, indicating that both FB01mut and SZZ06mut can effectively colonize the roots of plants.

[0141] The number of labeled strains colonizing the roots of Nicotiana benthamiana on the second day of treatment was compared by plate counting method and the significance was analyzed by t-test.

[0142] The results are as follows Fig. 9 As shown in the figure, there is no significant difference in the number of colonization between the two. In general, the deletion of the ccdC gene does not affect the colonization of bacteria in the roots of Nicotiana benthamiana.

[0143] 3. Effect of ccdC gene on growth promotion of Bacillus varezii FZB42

[0144] Sterile water and LB medium were used as controls. FB01mut and SZZ06mut bacterial suspensions were used at a concentration of 1×10 7 The roots of Nicotiana benthamiana were irrigated with 100 CFU / g soil, and the growth of Nicotiana benthamiana on the 30th day was compared.

[0145] The results are as follows Fig.10 As shown, LB medium, FB01mut, and SZZ06mut all have significant growth-promoting effects on Nicotiana benthamiana. Taking ddH2O as the control, the plant height of Nicotiana benthamiana treated with LB medium, FB01mut, and SZZ06mut increased by 244.17%, 306.13%, and 497.16%, respectively; the root length increased by 51.90%, 17.55%, and 59.74%, respectively; the fresh weight increased by 1399.30%, 2370.03%, and 4225.16%, respectively; and the dry weight increased by 733.92%, 1233.51%, and 2268.42%, respectively. Taking LB medium as control, the height of N. benthamiana treated with FB01mut increased by 18.00%, the root length decreased by 22.62%, the fresh weight increased by 69.37%, and the dry weight increased by 68.07%; the height of N. benthamiana treated with SZZ06mut increased by 73.51%, the root length increased by 5.16%, the fresh weight increased by 201.95%, and the dry weight increased by 209.08%. Taking N. benthamiana treated with FB01mut as control, the height of N. benthamiana treated with SZZ06mut increased by 47.04%, the root length increased by 35.90%, the fresh weight increased by 75.11%, and the dry weight increased by 77.61%. In addition, the root system of N. benthamiana treated with SZZ06mut was more developed than that of N. benthamiana treated with FB01mut, LB, and ddH2O, and the leaves were wider and thicker and the leaf color was darker green. In general, the ccdC mutant showed a stronger growth-promoting ability.

[0146] 4. IAA production capacity of Bacillus varezii FZB42 and ccdC mutant SZZ06

[0147] Firstly, a standard curve of indoleacetic acid (IAA) concentration was constructed (y=0.1709x-0.0046R2=0.9979). The IAA concentration in the culture medium of FZB42 and SZZ06 grown for 6h, 12h, 18h and 24h in liquid culture was determined using Salkowski reagent to construct the rhizosphere IAA concentration change curve.

[0148] The results are as follows Fig.11As shown in the figure, within 0-24h, the IAA concentration in the culture medium of FZB42 and SZZ06 gradually increased with the increase of culture time. After 12h, the IAA concentration in the culture medium of SZZ06 was higher than that in the culture medium of FZB42. Since the ccdC gene affects the number of cells, the experiment also compared the ratio of IAA concentration and bacterial growth in the culture medium of FZB42 and SZZ06 at different time periods. The results showed that the IAA concentration / OD600 value in the culture medium of SZZ06 was greater than that of FZB42. The results show that the same number of ccdC mutant strains SZZ06 can secrete more IAA.

Claims

1. ccdC The use of a gene for reducing the motility of a Varese Bacillus strain, characterized in that: Build ccdC Gene mutant strains, ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.

2.

2. ccdC The invention discloses a gene for enhancing the wrinkling property and maintaining the stability of the structure of a biofilm of Bacillus varezii, characterized in that: Build ccdC Gene mutant strains, ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.

2.

3. ccdC Use of a gene in inhibiting the spread of Bacillus varezii, characterized in that: Build ccdC Gene mutant strains, ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.

2.

4. ccdC Use of a gene in inhibiting spore formation of Bacillus varezii, characterized in that: Build ccdC Gene mutant strains, ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.

2.

5. ccdC The application of a gene mutant strain in promoting the growth of Nicotiana benthamiana is characterized in that: The method of promoting the growth of Nicotiana benthamiana is to increase the plant height, root length, fresh weight and dry weight of Nicotiana benthamiana, and to increase the thickness and greenness of Nicotiana benthamiana leaves. ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.

2.

6. ccdC Application of gene mutant strain in secreting indoleacetic acid, the ccdC The method for constructing a gene mutant strain is as follows: 1) Construction of biofilm dispersion regulatory genes ccdC Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm ccdC The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes on LB plates containing spe resistance ccdC Mutant strains; Biofilm dispersion regulatory genes ccdC The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.2.

Images