Application of rice NAT protein and its encoding gene in regulating plant disease resistance

Abstract

The present invention discloses the application of rice NAT protein and its encoding gene in regulating plant disease resistance, belonging to the field of biotechnology. In the study of rice immune response, the present invention identified a gene NAT whose translation was induced by rice blast fungus; through experimental verification, it was found that overexpression of NAT gene in rice can significantly improve rice disease resistance. It shows that NAT gene positively regulates plant disease resistance, and the present invention can be used as a target gene for molecular breeding to improve rice or other plant disease resistance, laying a theoretical foundation for plant disease resistance research.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to the application of rice NAT protein and its encoding gene in regulating plant disease resistance. Background Art

[0002] Fungal diseases such as rice blast cause large-scale crop yield reductions, so breeding disease-resistant crops is one of the main goals of the planting industry. Many genes related to plant disease resistance have been reported, including effector molecule genes and regulatory genes, which come from crops such as rice, wheat, corn, soybeans, and model plants such as Arabidopsis. Some of them have been used as target genes in crop disease resistance genetic engineering, and disease-resistant rice, wheat, corn, soybeans, etc. have been successfully bred. However, due to differences in genetic background, some genes have been blocked in application, so new related genes are still needed to meet the needs of breeding.

[0003] As one of the most important food crops, improving rice's disease resistance has important theoretical and practical significance.

[0004] N-terminal acetyltransferases (NATs) play an important role in plant development, so previous studies on NATs have focused on their involvement in plant development. However, there are currently no reports on the application of NAT genes in plant disease resistance. Summary of the invention

[0005] The purpose of the present invention is to provide the application of rice NAT protein and its encoding gene in regulating plant disease resistance to solve the problems existing in the above-mentioned prior art. NAT positively regulates rice disease resistance, and rice disease resistance can be improved by overexpressing NAT in rice.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the use of NAT protein in any of the following:

[0008] (1) Application in regulating plant disease resistance;

[0009] (2) Application in the preparation of products for regulating plant disease resistance;

[0010] (3) Application in breeding disease-resistant plant varieties;

[0011] (4) Application in the preparation of products for breeding disease-resistant plant varieties;

[0012] The amino acid sequence of the NAT protein is as shown in SEQ ID NO: 2 or a protein sequence containing the amino acid sequence as shown in SEQ ID NO: 2. The amino acid sequence of the NAT protein can also be a derived protein obtained by replacing and / or deleting and / or adding one or more amino acid residues in the sequence of SEQ ID NO: 2 and having the same function, or a protein having more than 80% identity with the sequence of SEQ ID NO: 2 and having the same function. It can also be a fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of the above-mentioned protein.

[0013] The above identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences for calculation, the identity value (%) can then be obtained.

[0014] The above 80% or more identity may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0015] The protein tag is a polypeptide or protein that is fused and expressed with a target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a GFP tag, a Flag tag, a His tag, an MBP tag, a HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0016] The present invention also provides the use of the gene encoding the NAT protein in any of the following:

[0017] (1) Application in regulating plant disease resistance;

[0018] (2) Application in the preparation of products for regulating plant disease resistance;

[0019] (3) Application in breeding disease-resistant plant varieties;

[0020] (4) Application in the preparation of products for breeding disease-resistant plant varieties;

[0021] The amino acid sequence of the NAT protein is a protein sequence as shown in SEQ ID NO: 2 or comprises the amino acid sequence as shown in SEQ ID NO: 2; the nucleotide sequence of the encoding gene is a gene sequence as shown in SEQ ID NO: 1 or comprises the nucleotide sequence as shown in SEQ ID NO: 1.

[0022] The present invention also provides the use of a recombinant vector comprising a gene encoding a NAT protein in any of the following:

[0023] (1) Application in regulating plant disease resistance;

[0024] (2) Application in the preparation of products for regulating plant disease resistance;

[0025] (3) Application in breeding disease-resistant plant varieties;

[0026] (4) Application in the preparation of products for breeding disease-resistant plant varieties;

[0027] The amino acid sequence of the NAT protein is a protein sequence as shown in SEQ ID NO: 2 or comprises the amino acid sequence as shown in SEQ ID NO: 2; the nucleotide sequence of the encoding gene is a gene sequence as shown in SEQ ID NO: 1 or comprises the nucleotide sequence as shown in SEQ ID NO: 1.

[0028] The present invention also provides the use of a host bacterium comprising a recombinant vector in any of the following:

[0029] (1) Application in regulating plant disease resistance;

[0030] (2) Application in the preparation of products for regulating plant disease resistance;

[0031] (3) Application in breeding disease-resistant plant varieties;

[0032] (4) Application in the preparation of products for breeding disease-resistant plant varieties;

[0033] The recombinant vector is an expression vector integrated with the NAT gene, and the nucleotide sequence of the NAT gene is a gene sequence as shown in SEQ ID NO: 1 or includes the nucleotide sequence as shown in SEQ ID NO: 1.

[0034] Preferably, the method of regulating plant disease resistance includes:

[0035] The disease resistance of the plant is improved by overexpressing the NAT gene in the plant; or the disease resistance of the plant is reduced by knocking out the NAT gene in the plant, thereby improving the disease susceptibility.

[0036] Preferably, the plant comprises a plant of the family Poaceae.

[0037] The present invention also provides a method for regulating plant disease resistance, comprising any one of the following methods:

[0038] (1) Improving the disease resistance of a plant by overexpressing a NAT gene in the plant;

[0039] (2) knocking out the NAT gene in the plant to reduce the disease resistance of the plant and increase the susceptibility to disease;

[0040] The nucleotide sequence of the NAT gene is as shown in SEQ ID NO: 1 or a gene sequence comprising the nucleotide sequence as shown in SEQ ID NO: 1.

[0041] Preferably, the plant comprises a plant of the family Poaceae.

[0042] The present invention also provides a method for cultivating highly disease-resistant transgenic plants, comprising the following steps: overexpressing the NAT gene in the plant to increase the expression level of the NAT gene and obtain the highly disease-resistant transgenic plant.

[0043] Preferably, the nucleotide sequence of the NAT gene is as shown in SEQ ID NO: 1 or comprises a gene sequence of the nucleotide sequence as shown in SEQ ID NO: 1;

[0044] The plants include plants of the family Poaceae.

[0045] The present invention discloses the following technical effects:

[0046] The inventors of the present invention identified a gene induced by rice blast fungus in the study of rice immune response, named NAT, and analyzed that it belongs to the N-terminal acetyltransferase family. The present invention proves through experiments that overexpressing the NAT gene and increasing the protein expression have the function of significantly improving the disease resistance of rice. It shows that the NAT gene positively regulates the disease resistance of plants, and the NAT protein and its encoding gene are of great significance for breeding disease-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0048] Figure 1 The leaves of three-week-old ZH11 plants were sampled at different time points after being inoculated with rice blast fungus to detect the relative expression of NAT;

[0049] Figure 2 Schematic diagram for analyzing the protein domain of NAT, the conserved acetyl-CoA binding pocket motif, and the knockout target (Target);

[0050] Figure 3 This is a schematic diagram of the NAT knockout vector structure;

[0051] Figure 4 The knockout target sequencing results of the two knockout strains NAT-KO1 and NAT-KO2;

[0052] Figure 5 This is a schematic diagram of the NAT overexpression vector structure;

[0053] Figure 6 The expression level detection results of NAT in wild-type ZH11 (WT) and overexpression strains NAT-OE1 and NAT-OE2;

[0054] Figure 7 The phenotypes of NAT knockout strains inoculated with rice blast fungus; A: The results of puncture inoculation of wild-type ZH11 (WT) and knockout strains NAT-KO1 and NAT-KO2; B: The results of spray inoculation of wild-type ZH11 (WT) and knockout strains NAT-KO1 and NAT-KO2; The scale bar is 1 cm, and the asterisk above the bar graph indicates a significant difference (P<0.01);

[0055] Figure 8 The phenotypes of NAT overexpression strains inoculated with rice blast fungus; A: the results of puncture inoculation of wild type ZH11 (WT) and overexpression strains NAT-OE1 and NAT-OE2; B: the results of spray inoculation of wild type ZH11 (WT) and overexpression strains NAT-OE1 and NAT-OE2; the scale bar is 1 cm, and the asterisks above the bar graphs indicate significant differences (P<0.01). DETAILED DESCRIPTION

[0056] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0057] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0058] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0059] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0060] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0061] Some experimental materials and reagents involved in the following examples:

[0062] (1) The rice variety Zhonghua 11 (O. Sativa L. spp. japonica, var. zhonghua11, AA genome, ZH11) belongs to the japonica subspecies, as recorded in the following literature: Ni Yuchong, A New Rice Variety Cultivated by Flower Culture—Zhonghua 11, Agricultural Science and Technology Newsletter, 1989, 07, 35; provided by Professor Chen Xuewei, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0063] (2) NAT overexpression transgenic rice was produced by Boyuan Biotechnology Company.

[0064] (3) Plant binary expression vector pTCRISPR was provided by Associate Professor Tang Yongyan from the National Key Laboratory of Sichuan Agricultural University.

[0065] The plant binary expression vector pCAMBIA2300 was provided by Professor Wu Xianjun from the Rice Research Institute of Sichuan Agricultural University.

[0066] (4) Total RNA extraction kit: TRIzol purchased from Invitrogen, USA, catalog number 15596026.

[0067] Reverse transcription kit: HiScript III RT SuperMix for qPCR (+gDNAwiper) purchased from Vanzyme, China, with the catalog number R323-01.

[0068] Fluorescence quantitative kit: AceQ qPCR SYBR Green MasterMix purchased from Vanzyme, China, with the catalog number Q111-02.

[0069] Homologous recombination kit: ClonExpress II One Step Cloning Kit purchased from Vanzyme, China, with the catalog number C112-01.

[0070] Example 1 Gene NAT Induced in Rice Immune Response and Its Cloning

[0071] In the process of studying the immune response of rice, it was found that the expression of NAT was induced by rice blast fungus. The polymerase chain reaction was used to verify the expression of NAT at different time points after rice blast infection. Three-week-old ZH11 plants were used as research materials. Rice blast fungus was inoculated on the leaves of ZH11 plants. The specific groups were:

[0072] Experimental group (M. oryzae): 5×10 5 pc·mL -1 A solution of rice blast fungus spores (physiological species 10-8-14) and 0.1% Tween20;

[0073] Control group (Mock): spray 0.1% Tween20 solution;

[0074] Rice leaves were collected at 0 hours (0H), 1 hour (1H), 3 hours (3H), 6 hours (6H) and 12 hours (12H). Total RNA was extracted using Trizol and reverse transcribed into cDNA to detect the relative expression of NAT; the designed primers were:

[0075] NAT_qPCRF: 5'-CGAACGTCGTCCTGAAAAGC-3';

[0076] NAT_qPCRR: 5'-ATATGCTTCCAGCCGCTTCA-3'.

[0077] The cDNA of the experimental group and the control group obtained above was used as a template, and the expression level of the gene was determined by fluorescence quantitative PCR. Figure 1 As shown, there was no significant difference in the relative expression of NAT at 0H, 1H, and 3H, but when detected at 6H and 12H after inoculation, it was found that the relative expression of NAT in the experimental group was significantly increased compared with the control treatment.

[0078] Sequencing analysis showed that the gene encodes N-terminal acetyltransferase. Primers were designed based on the reference gene sequence of the rice genome:

[0079] NATF: 5'-ATGAGGAAGAAGGTGGACGA-3';

[0080] NATR: 5'-TCAAGACCTCTTCTTCTTAGACT-3'.

[0081] Using ZH11 total cDNA as a template, the above primers amplified a DNA band of about 3.7 Kb. After sequencing, it was confirmed that it was a NAT gene belonging to the NATs family. The LOC_Os12g07300 sequence in the rice genome reference sequence and the clone sequence amplified from ZH11 total cDNA were aligned, indicating that the clone sequence obtained from ZH11 was identical to the LOC_Os12g07300 sequence. The amino acid sequence of the NAT protein is shown in SEQ ID NO: 2, and its structural analysis is shown in Figure 2 The CDS sequence of the coding strand of the gene NAT encoding the NAT protein is a DNA molecule shown in SEQ ID NO: 1.

[0082] SEQ ID NO: 1 is as follows:

[0083]

[0084] SEQ ID NO: 2 is as follows:

[0085]

[0086] Example 2 Construction of NAT plant knockout vector

[0087] (1) NAT overexpression vector pTCRISPR-sgRNA NAT Construction

[0088] Using the genome of rice ZH11 as a template, the knockout target sequence was designed as: AACGTGTTTTCCAAGTCTCTCAGG.

[0089] The following primers were synthesized:

[0090] F: 5'-TGTGAACGTGTTTCCAAGTCTCTCG-3';

[0091] R: 5'-AAAACGAGAGACTTGGAAACACGTT-3'.

[0092] After denaturation at 95°C, anneal to form a double strand. The pTCRISPR vector was digested with BsaI to recover the linearized vector. The above DNA double strand and linearized vector were mixed according to the system shown in Table 1, and T4 DNA ligase ligation reaction was performed and incubated at room temperature for 30 minutes.

[0093] Table 1

[0094]

[0095] After ligation, pTCRISPR-sgRNA was obtained NAT Knockout vector (see Figure 3 ).

[0096] (2) Conversion

[0097] The knockout vector constructed above was transformed into DH5α competent medium. After kanamycin selection, single clones were picked for colony PCR identification. Plasmids were extracted from positive colonies and sequenced to confirm that pCAMBIA2300-NAT was correct, and genetic transformation could be carried out.

[0098] (3) Construction of knockout transgenic rice

[0099] NAT knockout transgenic rice was produced by Boyuan Biotechnology Company.

[0100] The NAT knockout strains NAT-KO1 and NAT-KO2 with a ZH11 background and genetic stability were selected and sequenced. Comparison with the wild-type strain sequence revealed that base insertions or mutations occurred in the target sequence of the knockout strains. The results are as follows Figure 4 shown.

[0101] Example 3 NAT plant expression vector construction

[0102] (1) Construction of NAT overexpression vector pCAMBIA2300-NAT

[0103] The cDNA obtained by reverse transcription of total RNA of rice ZH11 was used as template, and the cloning primers were:

[0104] F: 5'- GGACAGGGTACCCGGGGATCC ATGAGGAAGAAGGTGGACGA-3′;

[0105] R: 5'- GGTACTAGTGTCGACTCTAGA AGACCTCTTCTTCTTAGACT-3'.

[0106] The full-length NAT cDNA was obtained by PCR amplification, and the pCAMBIA2300-35S-eGFP-OCS vector was double-digested with BamHI and XbaI to recover the linearized vector. The full-length NAT cDNA recovered by PCR and the linearized vector were mixed according to the system shown in Table 2 below for homologous recombination.

[0107] Table 2

[0108]

[0109] The pCAMBIA2300-NAT recombinant vector was obtained by homologous recombination (see Figure 5 ).

[0110] (2) Conversion

[0111] After transformation to DH5α competent state and selection by kanamycin, single clones were picked for colony PCR identification. After plasmids were extracted from positive colonies and sequenced correctly, it was confirmed that pCAMBIA2300-NAT was correct and genetic transformation could be carried out.

[0112] (3) Construction of overexpression transgenic rice

[0113] NAT overexpression transgenic rice was completed by Boyuan Biotechnology Company. The NAT overexpression strains NAT-EO1 and NAT-EO2 with ZH11 background and genetic stability were selected and sequenced. Comparison with the wild-type strain sequence showed that the relative expression of NAT in the overexpression strains increased significantly. Figure 6 .

[0114] Example 4 Detection of NAT-regulated disease resistance in plants

[0115] The applicant first discovered that NATs protein NAT is involved in regulating the synthesis of jasmonic acid in rice and is a regulatory factor in the jasmonic acid pathway. Jasmonic acid is known as a defense hormone and plays an important role in regulating plant disease resistance. Therefore, the effect of NAT on rice disease resistance was tested.

[0116] Wounding and inoculation treatment at the seedling stage: The test materials were ZH11, NAT knockout strains NAT-KO1 and NAT-KO2 with ZH11 background and genetic stability, and NAT overexpression strains NAT-EO1 and NAT-EO2 with ZH11 background and genetic stability. Select seeds with full grains, put them in a conical bottle filled with tap water, and place them in a dark incubator at 37°C for germination, and change the water every day. After 2 days, select white seeds and put them in a 96-well seedling plate. Put the 96-well seedling plate on a float and grow it in Hoagland nutrient solution. After 21 days, select the second to last rice leaf with the same growth and size, and inoculate 5μL of a concentration of 5×10 5 pc·mL -1 The 10-8-14 rice blast fungus spores were inoculated and the length and number of lesions were observed and counted after 5 days.

[0117] Seedling spray treatment: As in the above “seeding wound inoculation treatment”, the penultimate rice leaf with the same growth and size was selected for spraying after 21 days, with a concentration of 5×10 5 pc·mL -1 Spray the leaves with Zhong10-8-14 rice blast fungus spore solution, observe and count the length and number of lesions after 5 days.

[0118] The results showed that under hydroponic conditions, there was no significant difference in the growth of ZH11, NAT-KO1, NAT-KO2, NAT-EO1 and NAT-EO2. The experiment was repeated three times. Each time, 20 plants were planted. Statistics showed that after puncture inoculation, the length of lesions of NAT-KO1 and NAT-KO2 plants under the background of ZH11 was significantly increased compared with ZH11, and they were more sensitive to pathogens (see Figure 7 ). However, when NAT was overexpressed in ZH11, the lesion length was significantly reduced and the disease resistance of the plant was significantly increased (see Figure 8 ). This indicates that NAT positively regulates the disease resistance of plants, and its encoding gene NAT can be used as a target gene in molecular breeding to improve plant disease resistance.

[0119] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of NAT protein in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the preparation of products for regulating rice resistance to rice blast; (3) Application in breeding rice varieties resistant to rice blast; (4) Application in the preparation of products for breeding rice varieties resistant to rice blast; The amino acid sequence of the NAT protein is shown in SEQ ID NO:

2.

2. Use of the gene encoding NAT protein in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the preparation of products for regulating rice resistance to rice blast; (3) Application in breeding rice varieties resistant to rice blast; (4) Application in the preparation of products for breeding rice varieties resistant to rice blast; The amino acid sequence of the NAT protein is shown in SEQ ID NO: 2; the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

1.

3. Use of a recombinant vector comprising a gene encoding a NAT protein in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the preparation of products for regulating rice resistance to rice blast; (3) Application in breeding rice varieties resistant to rice blast; (4) Application in the preparation of products for breeding rice varieties resistant to rice blast; The amino acid sequence of the NAT protein is shown in SEQ ID NO: 2; the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

1.

4. Use of a host bacterium containing a recombinant vector in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the preparation of products for regulating rice resistance to rice blast; (3) Application in breeding rice varieties resistant to rice blast; (4) Application in the preparation of products for breeding rice varieties resistant to rice blast; The recombinant vector is an expression vector integrated with the NAT gene, and the nucleotide sequence of the NAT gene is shown in SEQ ID NO:

1.

5. The use according to any one of claims 1 to 4, characterized in that: The method for regulating rice resistance to rice blast comprises: The rice resistance to rice blast is improved by overexpressing the NAT gene in the rice; or the rice sensitivity to rice blast is improved by knocking out the NAT gene in the rice.

6. A method for regulating rice resistance to rice blast, characterized in that: This includes any of the following methods: (1) Improving the rice blast resistance of rice by overexpressing NAT gene in rice; (2) Increasing the sensitivity of rice to rice blast fungus by knocking out the NAT gene in rice; The nucleotide sequence of the NAT gene is shown in SEQ ID NO:

1.

7. A method for cultivating highly resistant rice blast transgenic rice, characterized in that: The following steps are involved: By overexpressing the NAT gene in rice, the expression level of the NAT gene is increased to obtain transgenic rice with high resistance to rice blast; The nucleotide sequence of the NAT gene is shown in SEQ ID NO:1.

Images