An artificial long noncoding RNA and its application in targeted protein degradation

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to an artificial long non-coding RNA and its application in targeted protein degradation. The present invention uses lncRNA as a basis, connects the sequence of the targeted target protein and the lncRNA HOTAIR characteristic fragment that specifically binds to the ubiquitin ligase through a linker, and obtains an artificial long non-coding RNA (alncRNA), which can capture proteins including transcription factors, form a complex with the ubiquitin ligase, promote the ubiquitination of the target protein, and degrade the target protein with good specificity.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an artificial long-chain non-coding RNA and an application thereof in targeted protein degradation. Background Art

[0002] Targeted protein degradation is a method of selectively degrading pathogenic proteins using the natural protein degradation system. Among them, proteolysis-targeting chimeras (PROTACs) are one of the most representative technologies at present. PROTAC is a molecule composed of two parts, one part can bind to the target protein, and the other part can bind to the ubiquitin ligase (E3 ligase). By connecting the target protein to the ubiquitin ligase, PROTAC can cause the target protein to be ubiquitinated and eventually degraded. The emergence of PROTAC technology has greatly expanded the scope of targeted protein degradation, allowing researchers to more accurately regulate the expression of specific proteins. In addition to PROTAC, other emerging targeted protein degradation strategies have also emerged. Among them, molecular glue is a method of using small molecule compounds to bind the target protein to the ubiquitin ligase, thereby promoting its degradation. Lysosome-targeted chimeras (LYTACs) are a method of using antibodies to bind protein targets to lysosomes, thereby achieving degradation of target proteins. Antibody-based PROTAC (AbTAC) is a method that uses antibodies to bind target proteins to E3 ubiquitin ligases to achieve degradation of target proteins. These emerging strategies have greatly expanded the scope of application of targeted protein degradation, allowing researchers to more comprehensively and efficiently regulate the expression of specific proteins.

[0003] Although targeted protein degradation technology shows great potential in the field of drug development, it still faces some challenges. First, the design of suitable degradation molecules is complex and requires full consideration of the structure and function of the target protein, as well as the interaction with the ubiquitin ligase. Secondly, predicting effective target proteins is also a challenge because the structure and function of different proteins vary greatly. In addition, targeted protein degradation technology may have non-specific effects. At present, targeted protein degradation technology lacks a molecular genetic manipulation tool, such as a small nucleic acid molecule tool that can be transcribed into RNA molecules to bind to and degrade target proteins, which limits the application scope and feasibility of current targeted protein degradation technology. Summary of the invention

[0004] The purpose of the present invention is to provide an artificial long non-coding RNA and its application to make up for the deficiencies of the prior art, using lncRNA as a basis to achieve specific degradation of proteins through interaction and regulation with proteins, and provide a new strategy for protein degradation.

[0005] The present invention provides an artificial long-chain non-coding RNA, wherein the long-chain non-coding RNA comprises a sequence targeting a target protein and a characteristic fragment of the long-chain non-coding RNA HOTAIR connected in sequence;

[0006] The sequence of the target protein and the characteristic fragment of the long non-coding RNA HOTAIR are connected by a linker;

[0007] The characteristic fragment of the long noncoding RNA HOTAIR can recruit ubiquitin ligase.

[0008] Preferably, the ubiquitin ligase comprises ubiquitin ligase Dzip3 and / or ubiquitin ligase Mex3b;

[0009] The target protein includes GFP protein and / or cancer-promoting protein.

[0010] Preferably, the nucleotide sequence of the linker is TTATT;

[0011] The sequence targeting the target protein includes an RNA aptamer; the nucleotide sequence of the RNA aptamer is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the characteristic fragment of the long non-coding RNA HOTAIR is shown as SEQ ID NO.2 or SEQ ID NO.3.

[0013] The present invention also provides a recombinant vector, which comprises a basic vector and an artificial long-chain non-coding RNA inserted into the basic vector;

[0014] The artificial long-chain non-coding RNA is the artificial long-chain non-coding RNA described in the above technical solution.

[0015] The present invention also provides a recombinant cell, comprising a receptor cell and an artificial long non-coding RNA inserted into the receptor cell;

[0016] The artificial long-chain non-coding RNA is the artificial long-chain non-coding RNA described in the above technical solution.

[0017] The present invention also provides the use of the artificial long-chain non-coding RNA or recombinant vector or recombinant cell described in the above technical solution in the preparation of a product for degrading protein.

[0018] Preferably, the protein includes GFP protein and / or cancer-promoting protein.

[0019] The present invention also provides a method for degrading proteins, comprising: co-transfecting a recombinant vector containing the artificial long-chain non-coding RNA described in the above technical solution and the protein to be degraded into a receptor cell and then culturing the cell.

[0020] Preferably, the co-transfection method comprises: recombining a recombinant vector of the artificial long non-coding RNA and a coding gene of the protein to be degraded and then transfecting the recombinant vector.

[0021] Preferably, the recipient cells include HEK293T cells.

[0022] Beneficial effects:

[0023] The present invention uses lncRNA as a basis, and connects the sequence of the target protein and the lncRNA HOTAIR characteristic fragment that specifically binds to the ubiquitin ligase through a linker to obtain an artificial long-chain non-coding RNA (alncRNA) with low toxicity, which can capture proteins including transcription factors, form a complex with the ubiquitin ligase, promote the ubiquitination of the target protein, and specifically degrade the target protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0025] Figure 1 This is the principle of artificial long non-coding RNA targeted protein degradation of the present invention; wherein Anti-TF aptamers are targeted protein sequences, and LncRNA is a characteristic fragment of HOTAIR of long non-coding RNA;

[0026] Figure 2 It is a plasmid map; the left side is the map of the MS2-alncRNA-MCP-GFP recombinant plasmid; the right side is the map of the basic vector pZDonor used to construct the MS2-alncRNA-MCP-GFP recombinant plasmid;

[0027] Figure 3 This is the fluorescence microscope test result of Test Example 1;

[0028] Figure 4 The results of fluorescence flow cytometry test in test example 1;

[0029] Figure 5 The statistical results of the number of GFP-positive cells under different treatments in test example 1; ** indicates p < 0.01;

[0030] Figure 6 The immunoprecipitation and Western Blot test results of Test Example 2 are shown in Figure 2; wherein A to C are the test results of step (1); and D to F are the test results of step (2). DETAILED DESCRIPTION

[0031] The present invention provides an artificial long-chain non-coding RNA, wherein the long-chain non-coding RNA comprises a sequence targeting a target protein and a characteristic fragment of the long-chain non-coding RNA HOTAIR connected in sequence;

[0032] The sequence of the target protein and the characteristic fragment of the long non-coding RNA HOTAIR are connected by a linker;

[0033] The characteristic fragment of the long noncoding RNA HOTAIR can recruit ubiquitin ligase.

[0034] In the present invention, the target protein preferably includes GFP protein and / or cancer-promoting protein. In the embodiments of the present invention, GFP protein is taken as an example to illustrate that the artificial long-chain non-coding RNA provided by the present invention can target and degrade the target protein, but targeting GFP protein alone cannot be used as the entire protection scope of the present invention. The sequence of the target protein targeted in the present invention preferably includes an RNA aptamer; the nucleotide sequence of the RNA aptamer is preferably as shown in SEQ ID NO.1, specifically: 5'-CGTACACCATCAGGGTACG-3'. The sequence of the target protein targeted in the present invention can capture target proteins including transcription factors.

[0035] In the present invention, the characteristic fragment of the long non-coding RNA HOTAIR can recruit ubiquitin ligase; the ubiquitin ligase preferably includes ubiquitin ligase Dzip3 and / or ubiquitin ligase Mex3b, further preferably ubiquitin ligase Dzip3 or ubiquitin ligase Mex3b, and more preferably Dzip3. The nucleotide sequence of the characteristic fragment of the long non-coding RNA HOTAIR of the present invention is preferably as shown in SEQ ID NO.2 or SEQ ID NO.3, the nucleotide sequence shown in SEQ ID NO.2 can recruit ubiquitin ligase Dzip3, and the nucleotide sequence shown in SEQ ID NO.2 can recruit ubiquitin ligase Mex3b. The characteristic fragment of the long non-coding RNA HOTAIR of the present invention can promote the ubiquitination of the target protein and degrade the target protein by recruiting ubiquitin ligase and forming a complex with the ubiquitin ligase.

[0036] The sequence information of SEQ ID NO.2 and SEQ ID NO.3 is as follows:

[0037] SEQ ID NO.2: 5'-ACGGAACCCATGGACTCATAAACAATATATCTGTTGG GCGTGAGTGCACTGTCTCTCAAATAATTTTTCCATAGGCAAATGTCAGAGG GTTCTGGATTTTTAGTTGCTAAGGAAAGATCCAAATGGGACCA-3'

[0038] SEQ ID NO. 3: 5'-GCAGTGGGGAACTCTGACTCGCCTGTGCTCTGGAGCTTGATCCGAAAGCTTCCACAGTGAGGACTGCTCCGTGGGGGTAAGAGAGCACCAGGCACTGAGGCCTGGGAGTTCCACAGACCAACACCC-3'.

[0039] In the present invention, the nucleotide sequence of the linker is preferably TTATT. The present invention uses a linker to sequentially connect the sequence of the target protein and the characteristic fragment of the long non-coding RNA HOTAIR, which can ensure that there is enough space between the sequence of the target protein and the characteristic fragment of the long non-coding RNA HOTAIR, and can form secondary structures respectively without interfering with each other.

[0040] The present invention also provides a recombinant vector, comprising a basic vector and an artificial long non-coding RNA inserted into the basic vector; the artificial long non-coding RNA is the artificial long non-coding RNA described in the above technical solution. The present invention has no strict requirements on the source of the basic vector, and a conventional selection can be used, such as a eukaryotic expression vector.

[0041] The present invention also provides a recombinant cell, comprising a receptor cell and an artificial long non-coding RNA inserted into the receptor cell; the artificial long non-coding RNA is the artificial long non-coding RNA described in the above technical solution. The present invention has no strict requirements on the source of the receptor, and a conventional selection can be used, such as HEK293T cells.

[0042] The present invention uses lncRNA as a basis, and connects the sequence of the target protein and the lncRNA HOTAIR fragment that specifically binds to the ubiquitin ligase through a linker to obtain an artificial long non-coding RNA (alncRNA), which can capture proteins including transcription factors, form a complex with the ubiquitin ligase, promote the ubiquitination of the target protein, and specifically degrade the target protein. The specific principle is as follows Figure 1 shown.

[0043] In view of the artificial long non-coding RNA provided by the present invention, the use of the artificial long non-coding RNA or recombinant vector or recombinant cell in the preparation of a product for degrading protein also falls within the scope of protection of the present invention. The product of the present invention preferably includes a drug; the protein preferably includes GFP and / or a cancer-promoting protein.

[0044] The present invention also provides a method for degrading proteins, comprising: co-transfecting a recombinant vector containing the artificial long-chain non-coding RNA described in the above technical solution and the protein to be degraded into a receptor cell and then culturing the cell.

[0045] In the present invention, the co-transfection method preferably includes: recombining the recombinant vector of the artificial long-chain non-coding RNA and the coding gene of the protein to be degraded and then transfecting. The recipient cells of the present invention preferably include HEK293T cells. In the embodiments of the present invention, the recombinant vector of the artificial long-chain non-coding RNA and the coding gene of the GFP protein are preferably recombined and transfected with the aid of the MS2 / MCP system. The results show that compared with the control group that was not transfected with the artificial long-chain non-coding RNA of the present invention, the protein level of GFP in the cell can be significantly reduced, and the mRNA level of GFP is not affected, and the degradation half-life of GFP is shortened.

[0046] To further illustrate the present invention, an artificial long non-coding RNA provided by the present invention and its application in targeted protein degradation are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] An artificial long non-coding RNA (alncRNA), which is composed of an RNA aptamer and a characteristic fragment of HOTAIR of the long non-coding RNA, which are sequentially connected by a linker; wherein the characteristic fragment of the long non-coding RNA HOTAIR can recruit the ubiquitin ligase Dzip3;

[0049] The specific alncRNA sequence is shown in SEQ ID NO.4:

[0050]

[0051] Among them, the uppercase and underlined part is the RNA aptamer, the uppercase bold part is the linker sequence, and the lowercase part is the characteristic fragment of the long non-coding RNA HOTAIR.

[0052] Comparative Example 1

[0053] An artificial long non-coding RNA (alncRNA), which is composed of a nucleotide sequence that does not target any protein in the cell and a characteristic fragment of HOTAIR of the long non-coding RNA, which is connected in sequence through a linker; wherein the characteristic fragment of the long non-coding RNA HOTAIR can recruit the ubiquitin ligase Dzip3;

[0054] The specific alncRNA sequence is shown in SEQ ID NO.6:

[0055]

[0056] Among them, the uppercase and underlined parts are nucleotide sequences that do not target and bind to any protein in the cell, the uppercase bold parts are linker sequences, and the lowercase parts are characteristic fragments of the long non-coding RNA HOTAIR.

[0057] Example 2

[0058] An artificial long non-coding RNA (alncRNA), which is composed of an RNA aptamer and a characteristic fragment of HOTAIR of the long non-coding RNA, which are sequentially connected by a linker; wherein the characteristic fragment of the long non-coding RNA HOTAIR can recruit the ubiquitin ligase Mex3b;

[0059] The specific alncRNA sequence is shown in SEQ ID NO.5:

[0060]

[0061] Among them, the uppercase bold part is the linker sequence, and the lowercase part is the characteristic fragment of the long non-coding RNA HOTAIR.

[0062] Comparative Example 2

[0063] An artificial long non-coding RNA (alncRNA), which is composed of a nucleotide sequence that does not target any protein in the cell and a characteristic fragment of HOTAIR of the long non-coding RNA, which is connected in sequence through a linker; wherein the characteristic fragment of the long non-coding RNA HOTAIR can recruit the ubiquitin ligase Mex3b;

[0064] The specific alncRNA sequence is shown in SEQ ID NO.7:

[0065]

[0066] Among them, the uppercase and underlined parts are nucleotide sequences that do not target and bind to any protein in the cell, the uppercase bold parts are linker sequences, and the lowercase parts are characteristic fragments of the long non-coding RNA HOTAIR.

[0067] Comparative Example 3

[0068] An artificial long non-coding RNA (alncRNA) is composed of an RNA aptamer and a nucleotide sequence that does not target any protein in the cell and is connected in sequence through a linker. The specific alncRNA sequence is shown in SEQ ID NO.8:

[0069]

[0070] Among them, the lowercase part is the RNA aptamer, the uppercase bold part is the linker sequence, and the uppercase and underlined part is the nucleotide sequence that does not target and bind to any protein in the cell.

[0071] Test Example 1

[0072] In order to verify the practicality of the artificial long non-coding RNA provided in Examples 1 to 2 and Comparative Examples 1 to 3, alncRNA was combined with the MS2 / MCP system, and the MS2-alncRNA-MCP-GFP recombinant plasmid was constructed using pZDonor as the basic plasmid (the plasmid map is shown in Figure 2 shown);

[0073] Among them, the MS2-alncRNA-MCP-GFP recombinant plasmids constructed using the artificial long-chain non-coding RNA in Examples 1 to 2 and Comparative Examples 1 to 3 were named pZDonor-CMV-ncRNA-MS2 / Dzip3-BGH_pA-hef1a-GFP / MS2 (denoted as Dzip3-GFP), pZDonor-CMV-ncRNA MS2 / Mex3b-BGH_pA-hef1a-GFP / MS2 (denoted as Mex3b-GFP), pZDonor-CMV-ncRNA-NC / Dzip3-BGH_pA-hef1a-GFP / MS2 (denoted as Dzip3-NC), pZDonor-CMV-ncRNANC / Mex3b-BGH_pA-hef1a-GFP / MS2 (denoted as Mex3b-NC) and pZDonor-CMV-ncRNA-MS2 / NC-BGH_pA-hef1a-GFP / MS2 (denoted as NC-GFP);

[0074] The above recombinant plasmids were transfected into HEK293T cells respectively. After 48 h of culture, the number of fluorescent cells was detected using a fluorescence microscope and a fluorescence flow cytometer. The results are as follows: Figures 3 to 5 shown.

[0075] according to Figures 3 to 5 It can be seen that the artificial long non-coding RNA obtained in Examples 1 and 2 can significantly reduce the expression of GFP in cells, and the number of GFP-positive cells after treatment with artificial long non-coding RNA in Example 1 (Dzip3-GFP group) is significantly lower than that after treatment with artificial long non-coding RNA in Example 2 (Mex3b-GFP group); the cell survival rates of Examples 1 and 2 are respectively greater than 95%.

[0076] Test Example 2

[0077] (1) Based on the conclusion of Test Example 1, in order to further clarify the protein degradation mechanism of alncRNA (Dzip3-GFP) obtained in Example 1, the interaction between GFP and Dzip3 was detected by Dzip3 co-immunoprecipitation (IP) and Western Blot experiments. The results showed that after Dzip3-GFP was transfected into HEK293T cells, Dzip3 could bind to GFP ( Figure 6 After the proteasome inhibitor MG132 was added to the cells, it was found that the GFP protein level in the Dzip3-GFP transfected group decreased and then recovered ( Figure 6 B), indicating that the alncRNA obtained in Example 1 may regulate the degradation of GFP through the ubiquitin-proteasome pathway. In addition, the results of RT-qPCR experiments showed that the expression of Dzip3-GFP did not affect the mRNA level of GFP ( Figure 6 Middle C).

[0078] (2) Based on the conclusion of step (1), in order to further explore the effect of alncRNA (Dzip3-GFP) obtained in Example 1 on GFP protein degradation, the effect of alncRNA on GFP-related ubiquitination was detected by GFP immunoprecipitation and ubiquitination Western Blot. The results showed that the alncRNA obtained in Example 1 promoted the ubiquitination level of GFP ( Figure 6 In addition, the protein synthesis inhibitor glutarimide antimicrobial agent (CHX) was added to the cells to detect the stability of GFP protein by alncRNA. It was found that after CHX treatment, the degradation half-life of GFP was 4 to 8 hours. In contrast, in HEK293T cells, after alncRNA treatment, the degradation half-life of GFP was shortened to 2 to 4 hours ( Figure 6 E and F).

[0079] Combining the conclusions of step (1) and step (2), it is shown that the alncRNA obtained in Example 1 induces the degradation of GFP by promoting the interaction between GFP and E3 ubiquitin ligase Dzip3.

[0080] It can be seen from the above content that the lncRNA provided by the present invention can promote the ubiquitination of the target protein and degrade the target protein with good specificity.

[0081] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An artificial long non-coding RNA, characterized in that: The artificial long non-coding RNA is composed of a sequence targeting a target protein, a linker and a characteristic fragment of the long non-coding RNA HOTAIR connected in sequence; The sequence of the target protein and the characteristic fragment of the long non-coding RNA HOTAIR are connected by a linker; The characteristic fragment of the long non-coding RNA HOTAIR can recruit ubiquitin ligase; The nucleotide sequence of the characteristic fragment of the long non-coding RNA HOTAIR is shown in SEQ ID NO.2 or SEQ ID NO.3; The sequence targeting the target protein is an RNA aptamer.

2. The artificial long non-coding RNA according to claim 1, characterized in that The ubiquitin ligase includes ubiquitin ligase Dzip3 and / or ubiquitin ligase Mex3b; The target protein includes GFP protein and / or cancer-promoting protein.

3. The artificial long non-coding RNA according to claim 1 or 2, characterized in that The nucleotide sequence of the linker is TTATT; The nucleotide sequence of the RNA aptamer is shown in SEQ ID NO.

1.

4. A recombinant vector, characterized in that: The recombinant vector comprises a basic vector and an artificial long non-coding RNA inserted into the basic vector; The artificial long non-coding RNA is the artificial long non-coding RNA according to any one of claims 1 to 3.

5. A recombinant cell, characterized in that The recombinant cell includes a recipient cell and an artificial long non-coding RNA inserted into the recipient cell; The artificial long non-coding RNA is the artificial long non-coding RNA according to any one of claims 1 to 3.

6. Use of the artificial long non-coding RNA according to any one of claims 1 to 3, the recombinant vector according to claim 4, or the recombinant cell according to claim 5 in preparing an agent for degrading a target protein.

7. The use according to claim 6, characterized in that: The target protein includes GFP protein and / or cancer-promoting protein.

8. A method for degrading a target protein, characterized in that: include: The recombinant vector containing the artificial long non-coding RNA according to any one of claims 1 to 3 and the target protein to be degraded are co-transfected into the recipient cells and then cultured.

9. The method according to claim 8, characterized in that The co-transfection method comprises: recombining a recombinant vector of an artificial long-chain non-coding RNA and a coding gene of a target protein to be degraded and then transfecting the recombinant vector.

10. The method according to claim 8, characterized in that The recipient cells include HEK293T cells.

Images