A LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, a detection method and application thereof

Abstract

The present invention discloses a LAMP nucleic acid combination, a detection method and an application thereof for detecting Radish Bipartite Virus 1 in Codonopsis pilosula, and relates to the technical field of detection of Chinese medicinal material pathogens. The nucleic acid combination can be used for RT-qLAMP, PAE-RT-qLAMP or PAE-RT-LAMP amplification reaction, and LAMP amplification recognizes 8 sequences of the RdRp gene of the RsPV1 virus through 6 primers including F3, B3, FIP, BIP, LF and LB, and has the technical advantages of strong specificity and high accuracy. In addition, the present invention also provides a nucleic acid combination for detecting Codonopsis pilosula RsPV1 virus, which can be used for both conventional PCR detection and qPCR detection, and has high detection specificity and accuracy.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of pathogens in traditional Chinese medicines, and in particular to a LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, a detection method and application thereof. Background Art

[0002] Gansu Province is one of the important production areas of Chinese medicinal materials in my country. It is rich in germplasm resources and has a long history of planting authentic medicinal materials such as Codonopsis pilosula. In the past five years, the average planting area has accounted for more than 90% of the country. With the continuous expansion of the scale and area of ​​artificial planting and continuous planting, the source of Codonopsis pilosula has degraded, the quality of seeds has declined, and the origin of diseases has occurred frequently, especially the root rot caused by continuous cropping obstacles. The diseases continue to occur and become more serious, the yield of medicinal materials has decreased, the quality has declined, and the farmers have suffered serious economic losses. It has become an important bottleneck restricting the current high-quality development of Chinese medicinal materials.

[0003] At present, the research on Codonopsis pilosula diseases mainly focuses on fungal and bacterial pathogens such as root rot and soft rot, and viral diseases are rarely reported. In fact, viral diseases are also a very serious plant disease that is difficult to prevent and control. Once infected, the plant will be retarded, and the growth, photosynthetic physiology and biochemistry, and primary and secondary metabolic processes will be inhibited. The plant's species will decline, its resistance will weaken, and its immunity will be reduced, making it more susceptible to bacteria, fungi and other pathogens. In severe cases, it may even fail to produce a harvest.

[0004] The inventor team conducted a systematic investigation, detection and analysis of viral diseases in the main codonopsis production areas of Weiyuan County, Zhang County, Min County, Lintao County, Yongdeng County, and Yuzhong County in Gansu Province from 2021 to 2023. Among the 61 field samples from different geographical regions that showed suspected viral disease symptoms such as yellowing, mottled, and mosaic, 41 samples were detected with viral infection, with a positive rate of 67.2%. Raphanus sativus partitivirus 1 (RsPV1) was identified in some samples using small RNA sequencing (sRNA-seq), which is the first time that RsPV1 viral pathogen infection has been found in codonopsis. Through reverse transcription polymerase chain reaction (RT-PCR) analysis of field positive samples and observation of plant morphology and growth, it was found that after Codonopsis pilosula was infected with the RsPV1 virus, the leaves showed viral disease symptoms and were often co-infected with other viruses. It is speculated that the RsPV1 virus may be a harmful pathogen of Codonopsis pilosula, affecting its growth, development, metabolism and quality formation. It is urgent to develop corresponding detection, diagnosis and prevention and control technologies.

[0005] Currently, there are no reports on the Codonopsis pilosula RsPV1 virus pathogen and its gene sequence, and it is impossible to obtain specific antibodies and primer sequences required for nucleic acid amplification. Commonly used immunological and molecular biological detection technologies for the detection and diagnosis of known pathogens, such as enzyme-linked immunosorbent assay (ELISA) and RT-PCR, cannot be applied to Codonopsis pilosula virus pathogens. In addition, common technologies such as ELISA and immune capture IC-RT-PCR rely on specific antibodies, have high detection costs, and require experienced personnel with professional operating skills to complete. Therefore, the scope of use is subject to certain limitations and cannot meet the actual needs of grassroots and agricultural technology promotion departments to popularize disease detection, diagnosis and prevention.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The purpose of the present invention is to provide a LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, a detection method and application thereof to solve the above technical problems.

[0008] The existing ELISA and its derivative technologies rely on antibodies and are prone to false negative results due to limited sensitivity. RT-PCR and its derivative nucleic acid amplification technologies require the extraction of high-quality RNA, which makes detection difficult and time-consuming. They also require professional technicians with laboratory work experience to operate, and their promotion and application are subject to certain restrictions. There is an urgent need to develop simple, sensitive and rapid new pathogen detection technologies and methods.

[0009] The inventors have improved the physical adsorption enrichment (PAE) method for pathogens. First, the virus particles in the sample to be tested are enriched, and then the enriched virus particles are combined with RT-fluorescence quantitative DNA loop-mediated isothermal LAMP technology (Quantitative loop-mediated isothermal amplification, qLAMP) for quantitative amplification detection. The entire process does not rely on antibodies and does not require the extraction of viral nucleic acid RNA, which can achieve the purpose of rapid, simple and quantitative detection of pathogens. The specific method is to first concentrate and purify the virus particles in the sample to be tested through a pre-treatment device to increase the virus load per unit volume, and then physically adsorb and enrich the virus particles in the sample to be tested through the wall of the reaction container (such as a PCR tube), and then use the enriched virus particles and the selected target gene-specific reverse primers to reverse transcribe RT to synthesize the first chain of cDNA, and then use qLAMP for nucleic acid amplification. The amplification product is monitored in real time according to the quantitative peak time to accurately determine the virus infection in the sample. In this way, the PAE-RT-qLAMP technology and method for specific detection of the newly emerging RsPV1 virus pathogen of Codonopsis pilosula without the need for antibodies or extraction of nucleic acid RNA have been successfully established. In addition, qPCR and PCR methods and kits for detecting the newly emerging pathogen of Codonopsis pilosula, Radish Bipartite Virus 1, have also been developed.

[0010] The present invention is achieved in that:

[0011] Radish bipartite virus 1 belongs to the genus Alphapartitivirus of the family Bipartite virus. Generally, bipartite viruses contain two genomes, one encoding the gene for the virus particle coat protein and the other encoding the gene for the viral replicase, and the size of both is between 1.4kbp and 3.0kbp. Like monopartite viruses, bipartite viruses have a wide host range. A large number of bipartite viruses have been found in various fungi, monocotyledons, dicotyledons and algae. In addition, bipartite viruses have been found to infect protozoa such as Cryptosporidium parvum, flatworms, cysts, and Ascaris suum, insects such as whiteflies, arctic springtails and twisted winged insects, and even higher animals such as cod. Among them, the reported bipartite viruses are mainly isolated from plants and fungi.

[0012] The bipartite viruses that have been found to infect plants are spherical in shape, with a diameter of 30-40nm, and are spread through pollen and seeds. The genome structure is similar to that of bipartite viruses that infect fungi. They have been reported in plants such as beets, broad beans, Italian ryegrass, alfalfa, carnations, oxtail grass, clover, red clover, white clover, spinach, carrots, and Brassica. Under sterile plant tissue culture conditions, bipartite viruses can exist for several years, and heat treatment cannot eliminate them. In 2023-2024, the inventor conducted germination culture and RT-PCR detection and analysis of the RsPV1 virus on commercial seeds of Codonopsis pilosula produced in different geographical regions across the country. The results showed that only 12 out of 19 batches of seeds germinated, and among the 12 batches of germinated samples, 11 batches of samples were detected with RsPV1 virus, and the RsPV1 infection rate reached 91.7%. Based on the transmission characteristics of binomial viruses, it is speculated that RsPV1 is a seed-transmitted virus of Codonopsis pilosula, which may be transmitted, spread and survive over long distances through Codonopsis pilosula seeds, posing a high risk of harm and should be highly valued and concerned by seed quality supervision and testing departments.

[0013] Most of the bipartite viruses reported so far are composed of two segments of equal size, one encoding the viral replicase, which plays a core role in the replication and transcription of the viral genome; the other encoding the protein that encapsulates the viral genome and constitutes the outer shell of the virus particle. RNA-dependent RNA polymerase (RdRp) is the core component of the viral replicase system. Together with some proteins encoded by the virus and host cell factors, it constitutes the viral replicase system and is responsible for the replication of the viral genome. Studying the structure and function of RdRp is of great significance for clarifying the replication and regulatory mechanisms of positive-strand RNA viruses. There are few reports on the gene cloning, prokaryotic expression and antibody preparation of RsPV1 RNA-dependent RNA polymerase at home and abroad.

[0014] In the first aspect, the present invention provides a LAMP nucleic acid combination for detecting Raphanus sativuspartitivirus1 in Codonopsis pilosula, which includes: LAMP forward outer primer F3 shown in SEQ ID NO.2, LAMP reverse outer primer B3 shown in SEQ ID NO.3, LAMP forward inner primer FIP shown in SEQ ID NO.4, LAMP reverse inner primer BIP shown in SEQ ID NO.5, LAMP forward loop primer LF shown in SEQ ID NO.6 and LAMP reverse loop primer LB shown in SEQ ID NO.7.

[0015] The specific primer sequences are as follows:

[0016] SEQ ID NO.1:

[0017] Reverse transcription primer: 5'-CGCAACATGGCTAGCAACTG-3'

[0018] SEQ ID NO.2: F3: 5'-TTTACTATCTAGAGGTTCACAATC-3';

[0019] SEQ ID NO.3: B3: 5'-AATATCATTGAGTGAATGTCTCT-3';

[0020] SEQ ID NO.4: FIP:

[0021] 5'-AGCCCAGTTGTAAAGGCGTGGCCAATGTTATGGGGCTA-3';

[0022] SEQ ID NO.5: BIP:

[0023] 5'-AGCTGCCTAAATTTGCATCAGTGATAACAGTGTGTCTTGCGT-3';

[0024] SEQ ID NO.6: LF: 5'-CCATCCTCCAGTTGTGGTTTCG-3';

[0025] SEQ ID NO. 7: LB: 5'-CCTTGACTGGAGCCGCTTC-3'.

[0026] After a long period of extensive primer screening and optimization, the inventors finally obtained the above nucleic acid combination, which can detect the Codonopsis pilosula RsPV1 virus pathogen in the target sample with high specificity and sensitivity.

[0027] In an optional embodiment, the LAMP nucleic acid combination further includes a reverse transcription primer;

[0028] In an optional embodiment, the reverse transcription primer is shown as SEQ ID NO.1.

[0029] In a second aspect, the present invention further provides a nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, comprising: an upstream primer shown in SEQ ID NO.8 and a downstream primer shown in SEQ ID NO.9.

[0030] The upstream and downstream primers of the nucleic acid combination are qPCR detection primers. In other embodiments, the upstream and downstream primers can also be used as conventional PCR detection primers.

[0031] SEQ ID NO.8: GCAGGTTACCACCCCACATATCAG;

[0032] SEQ ID NO.9: AGCATTCGTCCATCAGGCAACAG.

[0033] In an alternative embodiment, the nucleic acid combination further comprises a reverse transcription primer;

[0034] In an optional embodiment, the reverse transcription primer is shown as SEQ ID NO.1.

[0035] In a third aspect, the present invention further provides a nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, comprising: an upstream primer shown in SEQ ID NO.10 and a downstream primer shown in SEQ ID NO.11.

[0036] The upstream and downstream primers of the nucleic acid combination are common PCR detection primers.

[0037] SEQ ID NO.10: GCTCATGGCTCATCCCTTGA;

[0038] SEQ ID NO. 11: CGCAACATGGCTAGCAACTG.

[0039] In an alternative embodiment, the nucleic acid combination further comprises a reverse transcription primer;

[0040] In an optional embodiment, the reverse transcription primer is shown as SEQ ID NO.1.

[0041] In a fourth aspect, the present invention further provides a product for detecting Radish Bipartite Virus 1 in Codonopsis pilosula, the product being a reagent, a kit or a chip, and the product comprising at least one of the following nucleic acid combinations:

[0042] A LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula and the above-mentioned nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula.

[0043] Chips include but are not limited to microfluidic chips.

[0044] When the kit includes the above three nucleic acid combinations at the same time, the kit can simultaneously have the functions of LAMP amplification, qPCR detection and PCR detection; when the kit only includes the LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, the kit has the function of LAMP amplification (including RT-qLAMP and RT-LAMP amplification); when the kit only includes the nucleic acid combination for qPCR detection of radish bipartite virus 1 in Codonopsis pilosula, the kit has the function of RT-qPCR detection; when the kit only includes the nucleic acid combination for PCR detection of radish bipartite virus 1 in Codonopsis pilosula, the kit has the function of RT-PCR detection.

[0045] In a preferred embodiment of the present invention, the above product further comprises: a reverse transcription reagent, which comprises a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mixture and water.

[0046] The reverse transcriptase includes but is not limited to AMV reverse transcriptase or M-MLV reverse transcriptase and mutants and conjugates of the above reverse transcriptases.

[0047] The RNase inhibitor can be DEPC, guanidine isothiocyanate or vanadyl ribonucleoside complex.

[0048] In a preferred embodiment of the present invention, when the product is used for LAMP amplification, the product further comprises: a LAMP amplification reagent, and the LAMP amplification reagent comprises: a dNTP mixture, a ThermoPol reaction buffer, Mg ions, a DNA polymerase, a LAMP fluorescent dye and water.

[0049] The DNA polymerase is for example selected from Bst DNA polymerase. In addition, in other embodiments, the type of the DNA polymerase can be selected as needed.

[0050] LAMP fluorescent dyes include but are not limited to SYBR series dyes and Dye. SYBR series dyes include but are not limited to: SYBRGreen I, SYBR Green II, SYBR Gold and SYBR Safe.

[0051] In an optional embodiment, when the product is used for fluorescent quantitative qPCR reaction, the product also includes: qPCR fluorescent dye and fluorescent quantitative PCR reaction premix; qPCR fluorescent dye includes but is not limited to SYBR series dyes, ROX, EvaGreen. SYBR series dyes include but are not limited to: SYBR Green I, SYBR Green II, SYBR Gold and SYBRSafe.

[0052] In an optional embodiment, when the product is used for a PCR reaction, the product further comprises: a PCR reaction premix;

[0053] In an optional embodiment, the PCR reaction premix further includes: DNA polymerase, PCR buffer, dNTP mixture and water.

[0054] In an optional embodiment, the product further comprises: a positive control and a negative control;

[0055] In an optional embodiment, the positive control is the Codonopsis pilosula radish bipartite virus 1 RdRp gene, and the negative control is water.

[0056] The sequence of the Codonopsis pilosula RsPV1 RdRp gene for the positive control is as follows:

[0057] GCTCATGGCTCATCCCTTGAACCTCACATGGTCGATAGACGTATGACGATAGGATC

[0058] TCTACAATGAGATGTTTTTCATCAATCGACTTAACATTCACCTTATTAAAGATGGATGGA

[0059] TAACCAATAAACACGGACACGATCTTAGATATTGGCATACAGCTCATGCTCGACAGCAT

[0060] TTAGTTGAAGCTAATGAAGAAGACAAAGTTCGACTTGTTTTTGGCGCACCTTCCACCC

[0061] TTTTGATGGCTGAGCTCATGTTCATTTGGCCGATACAATCTAGTTTACTATCTAGAGGTT

[0062] CACAATCGCCAATGTTATGGGGCTACGAAACCACAACTGGAGGATGGTCACGCCTTTA

[0063] CAACTGGGCTGCCAAAGAGCTGCCTAAATTTGCATCAGTTGCGACCCTTGACTGGAGC

[0064] CGCTTCGACAAAGACGCAAGACACACTGTTATCAGAGACATTCACTCAATGATATTGA

[0065] GGCCTATGTTTGATTTCACTGCAGGTTACCACCCCACATATCAGAATCCCAGGACTACT

[0066] CCTGACCCCCAAAGGCTTGAAAACCTATGGAATTGGATGACTGACGCCATACTGACAA

[0067] CACCGCTGCTGTTGCCTGATGGACGAATGCTAAGGTTCACTCACTCAGGAATCTACTC

[0068] TGGCTATTTTCAGACCCAGATTCTAGATTCGATCTACAACTGCGTGATGATTTTCACCAT

[0069] TCTATCAAGAATGGGAATCGACTTAAATACAATCGCGTTGAAAGTACAGGGAGATGAC

[0070] TCTATTATTTTGTTATCTCACAATTTTACTTTACTGCGCAAATCATTTCTACAGATGTTTG

[0071] CAGAGCTGGCCAACACCTATTTTGGATCAACTCTCAACACAAAGAAGAGCGAACTTC

[0072] TCCCCTCATTAGAAGGAGCAGAAGTACTGCGATATCGTAATCAGGCACTATGCCATACA

[0073] GAGACGAATTACAGTTGCTAGCCATGTTGCG.

[0074] In a preferred embodiment of the present invention, the product further comprises: a physical adsorption enrichment device (PAE) for tissue separation of a sample to be tested, the physical adsorption enrichment device comprising a filter and an ultrafiltration tube; the filter is provided with a hydrophilic filter membrane.

[0075] When used, the tissue (root, stem, leaf or seed) of Codonopsis pilosula is first ground in PBS buffer, and then the grinding liquid is centrifuged to take the supernatant as the crude tissue extract; the crude tissue extract is then filtered to remove cell debris and other large particle aggregates to achieve the purpose of clarification; and then further concentrated by ultrafiltration tube to increase the viral load per unit volume to obtain the diseased tissue concentrate; after incubating the diseased tissue concentrate, the diseased tissue concentrate is discarded, and after washing, the sample to be tested is obtained. In a preferred embodiment of the present invention, the washed sample to be tested is initially denatured and then used for reverse transcription reaction.

[0076] The invention combines physical adsorption enrichment with the nucleic acid combination for detecting radish bipartite virus 1. The method does not rely on virus-specific antibodies and does not require RNA extraction, and can achieve rapid and accurate detection of radish bipartite virus 1 in Codonopsis pilosula. The detection product has strong specificity, high sensitivity, and low cost. The corresponding detection method is simple and easy to operate. The detection result can be analyzed by computer and analysis software in an integrated manner without nucleic acid gel electrophoresis, which saves detection time, improves detection efficiency, and improves detection sensitivity. It is suitable for rapid screening and real-time monitoring of pathogens, and provides technical support for quality monitoring of Codonopsis pilosula seeds, tissue culture detoxification of viral pathogens, field management, and comprehensive prevention and control.

[0077] In a fifth aspect, the present invention also provides a method for detecting radish bipartite virus 1 in Codonopsis pilosula, comprising the following steps:

[0078] The sample to be tested is subjected to reverse transcription reaction using the above-mentioned LAMP nucleic acid combination or the reverse transcription primer in the above-mentioned product to obtain cDNA, and then the cDNA is subjected to LAMP reaction using the above-mentioned LAMP nucleic acid combination under the following reaction conditions: 56-70°C, 30-100min; 80°C, 5-10min.

[0079] Under the above reaction conditions, efficient amplification of the RdRp gene of Codonopsis pilosula RsPV1 can be achieved. The conditions of the LAMP reaction are, for example: 56°C, 57°C, 58°C, 59°C, 60°C, 61°C, 62°C, 62.5°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C or 70°C for 30-100 min; 80°C for 5-10 min.

[0080] In an optional embodiment, the LAMP reaction is carried out under the following conditions: 60-64°C, 30-100 min; 80°C, 5-10 min. The amplification time during the LAMP reaction is any one of 30-60 min, 40-80 min, 55-90 min, 65-80 min, and 70-100 min.

[0081] The LAMP reaction can be performed using equipment such as a real-time fluorescence quantitative PCR thermal cycler for qLAMP amplification. When this equipment is not available, a water bath, a constant temperature incubator, a common PCR thermal cycler or other constant temperature device can also be used to perform a common LAMP display reaction.

[0082] In an optional embodiment, the LAMP reaction system includes: LAMP reverse outer primer B3 with a final concentration of 0.2-0.4 μM, LAMP forward outer primer F3 with a final concentration of 0.2-0.4 μM, LAMP forward inner primer FIP with a final concentration of 1.5-1.7 μM, LAMP reverse inner primer BIP with a final concentration of 1.5-1.7 μM, LAMP forward loop primer LF with a final concentration of 0.3-0.5 μM and LAMP forward loop primer LB with a final concentration of 0.3-0.5 μM.

[0083] In an optional embodiment, the LAMP reaction system includes: Mg ions with a final concentration of 8.0-12.5 mM, dNTPs with a final concentration of 1.4-2.8 mM, and DNA polymerase with a final concentration of 0.32-0.64 U;

[0084] In an optional embodiment, before the reverse transcription reaction is carried out, the preparation of the sample to be tested is also included, which includes: using tissue extract to perform rough sample extraction of the Codonopsis pilosula material to be tested, filtering through a filter, and transferring the collected filtrate to an ultrafiltration tube for concentration; and then incubating and washing to obtain the product.

[0085] In an optional embodiment, the washed sample is subjected to initial denaturation and then used for reverse transcription reaction. The conditions for initial denaturation are: 85-95° C., 1-5 min; ice bath.

[0086] The product comprising physical adsorption enrichment and detection of the radish bipartite virus 1 nucleic acid combination in Codonopsis pilosula overcomes the technical defects of the prior art that pathogen detection either requires the preparation or purchase of expensive antibodies in advance, or requires the extraction of high-quality nucleic acid RNA for detection, which is costly, time-consuming and labor-intensive, and the detection personnel need strict training to complete the detection. The present invention first uses a filtering and concentration device to filter and concentrate the crude extract of the sample to be tested, so as to purify the virus, and then uses a physical adsorption method to enrich the virus particles, and uses the screened RsPV1 RdRp gene specific primers to perform reverse transcription RT reaction to synthesize the first chain of cDNA, and then uses the high sensitivity technical advantage of fluorescence quantification to perform qLAMP amplification, and the amplified product is directly analyzed by a computer and analysis software. The entire detection process does not rely on virus-specific antibodies, and does not require cumbersome RNA extraction, which reduces the detection threshold and difficulty. The qLAMP amplification does not require the addition of any reagents, which reduces the risk of contamination, increases the application value, and has a very broad prospect.

[0087] When using LAMP nucleic acid combination to detect radish bipartite virus 1 in Codonopsis pilosula, it can be qualitative or quantitative.

[0088] If an obvious fluorescent signal is detected in the sample PCR tube, it means positive, indicating that the sample contains Codonopsis RsPV1 virus;

[0089] If no obvious fluorescent signal is detected in the sample PCR tube, it means negative, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus;

[0090] Optionally, if the content of RsPV1 virus in the positive sample is to be determined, the number of copies of RsPV1 virus in the positive sample needs to be quantitatively obtained based on the amplification Ct value of the positive sample and the standard curve;

[0091] Optionally, for a common LAMP amplification reaction, after the above LAMP reaction is completed, the PCR tube is centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye coloring solution on the inner wall of the PCR tube cover with the LAMP amplification product, and the mixture is mixed upside down, and the color change of the mixed solution in the PCR tube is observed with the naked eye under natural light:

[0092] If the color of the mixed solution turns green, it means that the SYBR Green I dye binds to the double-stranded DNA, which is a positive reaction, indicating that the sample tested contains the Codonopsis RsPV1 virus;

[0093] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus.

[0094] In a sixth aspect, the present invention further provides a method for detecting radish bipartite virus 1 in Codonopsis pilosula, the method being any one of the following methods:

[0095] (1) using the above-mentioned nucleic acid combination or the reverse transcription primer in the above-mentioned product to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then using the upstream primer and downstream primer in the above-mentioned nucleic acid combination to perform qPCR amplification on the cDNA; and detecting the amplified product;

[0096] (2) Using the above-mentioned nucleic acid combination or the reverse transcription primer in the above-mentioned product to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then using the upstream primer and downstream primer in the above-mentioned nucleic acid combination to perform PCR amplification on the cDNA.

[0097] The above method (1) is a fluorescence quantitative PCR detection, and the method (2) is a common PCR detection.

[0098] In an optional embodiment, the qPCR reaction conditions are: 95°C, 30s; 95°C 5s, 60°C 34s, and cycle amplification 30-40 times;

[0099] In an optional embodiment, the qPCR reaction system includes an upstream primer with a final concentration of 0.2-0.7 μM and a downstream primer with a final concentration of 0.2-0.7 μM;

[0100] In an optional embodiment, the PCR reaction conditions are: 95°C, 3-5min; 95°C 5s, 54°C 30s, 70-72°C 45s, and cycle amplification 30-40 times;

[0101] In an optional embodiment, the PCR reaction system includes 0.2-1.0 μM upstream primer and 0.2-1.0 μM downstream primer.

[0102] Method (1) After the fluorescence quantitative qPCR reaction is completed, the fluorescence signal detected on the real-time fluorescence PCR instrument is observed. If an obvious fluorescence signal is detected in the sample reaction tube, it represents a positive result, indicating that the sample contains Codonopsis pilosula RsPV1 virus;

[0103] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus.

[0104] When performing quantitative analysis, it is necessary to quantify the copy number of RsPV1 virus in the positive sample based on the amplification Ct value of the positive sample and the standard curve.

[0105] After the conventional PCR amplification reaction is completed, the amplified product is loaded and subjected to gel electrophoresis, and the presence of the RsPV1 virus in Codonopsis pilosula is determined based on the size of the product band and the presence or absence of the band. In other embodiments, the amplified product can also be directly sequenced, and the presence of the RsPV1 virus in the sample can be determined by sequencing comparison.

[0106] In a seventh aspect, the present invention also provides a LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, the use of the above nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula, or the above product in detecting radish bipartite virus 1 in Codonopsis pilosula.

[0107] The above-mentioned application methods include but are not limited to: directly adding the above-mentioned nucleic acid combination or using the above-mentioned product to detect Radish Bipartite Virus 1 in Codonopsis pilosula, or using the above-mentioned nucleic acid combination or product to construct a gene library. Application scenarios include but are not limited to: customs entry and exit quarantine, and detection of diseases of Chinese medicinal materials in farmland.

[0108] The present invention has the following beneficial effects:

[0109] (1) The present invention provides a LAMP nucleic acid combination for detecting Codonopsis pilosula RsPV1 virus, which can be used for RT-qLAMP, PAE-RT-qLAMP or PAE-RT-LAMP amplification reactions. LAMP amplification uses a total of 6 primers, F3, B3, FIP, BIP, LF and LB, to identify 8 sequences of the RdRp gene of the RsPV1 virus, and has the technical advantages of strong specificity and high accuracy.

[0110] (2) The present invention also provides a nucleic acid combination for detecting Codonopsis pilosula RsPV1 virus, which can be used for both conventional PCR detection and qPCR detection, and has high detection specificity and accuracy.

[0111] (3) The RT-qLAMP rapid quantitative detection kit for the Codonopsis pilosula RsPV1 virus pathogen provided by the present invention has the technical advantages of simple operation, fast speed, low cost, etc. The detection primer composition can achieve sensitive and reliable detection of the Codonopsis pilosula RsPV1 virus in the target sample. In particular, the PAE-RT-qLAMP kit has the advantages of low cost, no need for nucleic acid extraction, and simple detection steps.

[0112] The present invention performs RT-qLAMP amplification with high specificity and sensitivity, improves the specificity of detection, and reduces the occurrence of false positives.

[0113] (4) The present invention provides a new technical idea for the detection of new pathogens of Codonopsis pilosula and other crops. It can be used for accurate quantification of RsPV1 virus in Codonopsis pilosula and for routine qualitative analysis, providing technical support for monitoring the occurrence, spread, interspecies transmission of RsPV1 virus, as well as biosafety and comprehensive prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0115] Figure 1 This is a schematic plan view of the structure of a physical adsorption enrichment PAE purification device for detecting Codonopsis pilosula RsPV1 virus pathogens using PAE-qRT-LAMP in an embodiment of the present invention;

[0116] Figure 2 This is a schematic plan view of the structure of a PAE concentration device for physical adsorption enrichment of Codonopsis pilosula RsPV1 virus pathogens detected by PAE-qRT-LAMP in an embodiment of the present invention;

[0117] Figure 3 This is a graph of electrophoresis analysis of PCR amplification of the RdRp gene of the RsPV1-positive leaf sample of Codonopsis pilosula in the embodiment of the present invention: In the figure: lanes 1-2 correspond to positive amplification of the RdRp gene of Codonopsis pilosula RsPV1; lane CK: negative control;

[0118] Figure 4This is a fluorescence quantitative detection diagram of the primer screening for detecting the RsPV1 viral pathogen of Codonopsis pilosula by PAE-RT-qLAMP in the embodiment of the present invention; in the figure: curve CK: negative control; curve RsPV1-1: RsPV1-LAMP1 primer set; curve RsPV1-2: RsPV1-LAMP2 primer set; curve RsPV1-3: RsPV1-LAMP3 primer set; curve RsPV1-4: RsPV1-LAMP4 primer set;

[0119] Figure 5 This is a common color LAMP naked eye observation diagram of the reaction temperature of PAE-RT-qLAMP for detecting the pathogen of Codonopsis pilosula RsPV1 virus in the embodiment of the present invention; in the figure: reaction tube CK: negative control; reaction tube 56℃-70℃ respectively corresponds to: 56℃; 58℃; 60℃; 62℃; 64℃; 66℃; 68℃; 70℃;

[0120] Figure 6 This is a common color LAMP naked eye observation experiment diagram of the reaction time of PAE-RT-qLAMP for detecting Codonopsis pilosula RsPV1 virus pathogens in an embodiment of the present invention; in the figure: reaction tube CK: negative control; reaction tube 20min-100min corresponds to: 20min; 30min; 40min; 50min; 60min; 70min; 80min; 90min; 100min;

[0121] Figure 7 This is a fluorescence quantitative detection diagram of the specificity of the PAE-RT-qLAMP detection of Codonopsis pilosula RsPV1 virus pathogen in an embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve ALSV: Angelica sinensis infected with apple latent spherical virus ALSV tissue; curve LycMoV: Angelica sinensis infected with autumn vine mottle virus LycMoV tissue; curve LSV: lily infected with lily latent virus LSV tissue; curve CMV: lily infected with cucumber mosaic virus CMV tissue; curve LMoV: lily infected with lily mottle virus LMoV tissue; curve KoMV: Angelica sinensis infected with konjac mosaic virus KoMV tissue; curve RsPV1: RsPV1 Codonopsis pilosula infected tissue;

[0122] Figure 8This is a naked eye observation diagram of common color LAMP specific for detecting RsPV1 virus pathogen of Codonopsis pilosula by PAE-RT-qLAMP in an embodiment of the present invention; in the figure: reaction tube NC: negative control; reaction tube HC: healthy Codonopsis pilosula control; reaction tube ALSV: tissue infected with apple latent spherical virus ALSV by Angelica sinensis; reaction tube LycMoV: tissue infected with LycMoV by Angelica sinensis; reaction tube LSV: tissue infected with lily latent virus LSV by lily; reaction tube CMV: tissue infected with cucumber mosaic virus CMV by lily; reaction tube LMoV: tissue infected with lily mottle virus LMoV by lily; reaction tube KoMV: tissue infected with konjac mosaic virus KoMV by Angelica sinensis; reaction tube RsPV1: tissue infected with RsPV1 Codonopsis pilosula;

[0123] Fig. 9 This is a fluorescence quantitative detection diagram of the sensitivity of PAE-RT-qLAMP in detecting the viral pathogen of Codonopsis pilosula RsPV1 in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula RsPV1 positive cDNA; curve 10 -1 :Dilution 10 1 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -2 :Dilution 10 2 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -3 :Dilution 10 3 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -4 :Dilution 10 4 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -5 :Dilution 10 5 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -6 :Dilution 10 6 times the positive cDNA of Codonopsis pilosula RsPV1;

[0124] Fig.10 This is a fluorescence quantitative detection diagram of the sensitivity of PAE-RT-qPCR to detect the pathogen of Codonopsis pilosula RsPV1 virus in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula RsPV1 positive cDNA; curve 10 -1 :Dilution 10 1 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -2 :Dilution 10 2 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -3 :Dilution 10 3 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -4 :Dilution 10 4times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -5 :Dilution 10 5 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -6 :Dilution 10 6 times the positive cDNA of Codonopsis pilosula RsPV1;

[0125] Fig.11 This is a fluorescence quantitative dissolution curve diagram of the PAE-RT-qPCR detection of Codonopsis pilosula RsPV1 virus pathogen in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula RsPV1 positive cDNA; curve 10 -1 :Dilution 10 1 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -2 :Dilution 10 2 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -3 :Dilution 10 3 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -4 :Dilution 10 4 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -5 :Dilution 10 5 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -6 :Dilution 10 6 times the positive cDNA of Codonopsis pilosula RsPV1;

[0126] Fig.12 This is an electrophoresis analysis diagram of the sensitivity of PAE-RT-PCR in detecting the viral pathogen of Codonopsis pilosula RsPV1 in the embodiment of the present invention; Lane 1: Codonopsis pilosula RsPV1 positive cDNA; Lane 10 -1 :Dilution 10 1 times the positive cDNA of Codonopsis pilosula RsPV1; Lane 10 -2 :Dilution 10 2 times the positive cDNA of Codonopsis pilosula RsPV1; Lane 10 -3 :Dilution 10 3 times the positive cDNA of Codonopsis pilosula RsPV1; Lane 10 -4 :Dilution 10 4 times the positive cDNA of Codonopsis pilosula RsPV1; Lane CK: negative control;

[0127] Fig.13 This is a fluorescence quantitative dissolution curve diagram of the PAE-RT-qLAMP detection of Codonopsis pilosula RsPV1 virus pathogen in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula RsPV1 positive cDNA; curve 10-1 :Dilution 10 1 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -2 :Dilution 10 2 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -3 :Dilution 10 3 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -4 :Dilution 10 4 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -5 :Dilution 10 5 times the positive cDNA of Codonopsis pilosula RsPV1; Curve 10 -6 :Dilution 10 6 times the positive cDNA of Codonopsis pilosula RsPV1;

[0128] Fig.14 This is a standard curve diagram of the detection of Codonopsis pilosula RsPV1 virus pathogen by PAE-RT-qLAMP in the embodiment of the present invention; in the figure, the starting concentration of the RdRp gene positive standard of Codonopsis pilosula RsPV1 is 2.49x10 10 The concentrations of the six 10-fold dilutions were 2.49x10 9 copies / μL; 2.49x10 8 copies / μL; 2.49x10 7 copies / μL; 2.49x10 6 copies / μL; 2.49x10 5 copies / μL; 2.49x10 4 copies / μL. DETAILED DESCRIPTION

[0129] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0130] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0131] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0132] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0133] Example 1

[0134] This embodiment provides a PAE-RT-qLAMP kit for rapid quantitative detection of Codonopsis pilosula emerging viral pathogen RsPV1.

[0135] The PAE-RT-qLAMP kit consists of four parts: Figure 1 and Figure 2 The purification (i.e., filter) and concentration device (i.e., ultrafiltration tube) of Codonopsis pilosula RsPV1 virus pathogen, RT-qLAMP specific primer combination, reverse transcription RT synthesis reagent and qLAMP amplification reaction reagent shown;

[0136] In addition, the PAE-RT-qLAMP kit also includes phosphate buffer PBS, phosphate wash buffer PBST, negative control and positive control;

[0137] The RT-qLAMP specific primer composition includes the RT reverse primer RsPV1-R (i.e., reverse transcription primer) as shown in SEQ ID NO.1, the qLAMP forward outer primer F3 as shown in SEQ ID NO.2, the qLAMP reverse outer primer B3 as shown in SEQ ID NO.3, the qLAMP forward inner primer FIP as shown in SEQ ID NO.4, the qLAMP reverse inner primer BIP as shown in SEQ ID NO.5, the qLAMP forward loop primer LF as shown in SEQ ID NO.6, and the qLAMP reverse loop primer LB as shown in SEQ ID NO.7.

[0138] The specific primer sequences are as follows:

[0139] RsPV1-R: 5'-CGCAACATGGCTAGCAACTG-3'

[0140] F3: 5'-TTTACTATCTAGAGGTTCACAATC-3';

[0141] B3: 5'-AATATCATTGAGTGAATGTCTCT-3';

[0142] FIP:

[0143] 5'-AGCCCAGTTGTAAAGGCGTGGCCAATGTTATGGGGCTA-3';

[0144] BIP:

[0145] 5'-AGCTGCCTAAATTTGCATCAGTGATAACAGTGTGTCTTGCGT-3';

[0146] LF: 5'-CCATCCTCCAGTTGTGGTTTCG-3';

[0147] LB: 5'-CCTTGACTGGAGCCGCTTC-3'.

[0148] The RT synthesis reagent consisted of 10 mM dNTP mixture, 5×M-MLV reaction buffer, 30 U / μL RNase inhibitor, 200 U / μL M-MLV reverse transcriptase and RNA-free H 2 O composition;

[0149] The qLAMP amplification reaction reagents consisted of 10 mM dNTP mixture, 10× Thermpopol reaction buffer, 100 mM MgSO 4 , 8U / μL Bst DNA polymerase, 50×LAMP fluorescent dye Dye and nuclease-free H 2 O composition;

[0150] The concentration of phosphate buffer PBS and phosphate wash buffer PBST was 0.02 M, and the pH value was 7.4;

[0151] The negative control was nuclease-free H 2 O;

[0152] The positive control was the positive standard of Codonopsis pilosula RsPV1 RdRp gene.

[0153] This example also provides a method for preparing a positive standard of Codonopsis pilosula RsPV1 RdRp gene. The specific preparation method is as follows:

[0154] 1. Extraction of total RNA from Codonopsis pilosula leaves:

[0155] 50-100 mg of RsPV1-infected Codonopsis pilosula leaves were ground in liquid nitrogen, and total RNA from infected Codonopsis pilosula leaf tissues was extracted using a plant total RNA extraction kit;

[0156] 2. Primer design and synthesis

[0157] Based on the contigs of Codonopsis pilosula RsPV1 obtained by small RNA sequencing, a pair of RdRp gene-specific forward (RsPV1-F1) and reverse primers (RsPV1-R1) were designed and synthesized; the primer sequences are as follows:

[0158] RsPV1-F1: 5'-GCTCATGGCTCATCCCTTGA-3'

[0159] RsPV1-R1: 5'-CGCAACATGGCTAGCAACTG-3';

[0160] 3. Preparation of positive control:

[0161] 1) RT reaction

[0162] The above RsPV1 reverse primer RsPV1-R1 and M-MLV reverse transcriptase were used for RT reaction to synthesize the first strand of cDNA; the 10 μL RT reaction system was as follows: 2 μL total RNA, 1 μL 10 μM RsPV1 specific reverse primer RsPV1-R1, 1 μL RNA-free H 2 O 3μL, denature at 70℃ for 10min, and quickly cool on ice for 2min; then add 5×M-MLV buffer 2μL, 10mM dNTP mixture 1μL, 30U / μL RNase inhibitor 0.34μL, 200U / μL M-MLV reverse transcriptase 0.35μL and RNA-free 0.31μL; after mixing, place in a 42℃ water bath for 1h, keep warm at 70℃ for 15min, and place on ice for use.

[0163] 2) PCR reaction

[0164] Using the first strand of cDNA as a template, PCR amplification of the RdRp gene of Codonopsis pilosula RsPV1 was performed under the action of Ex Taq DNA polymerase;

[0165] The PCR reaction system was 25.0 μL, including: 50 ng cDNA 1.0 μL, 5 U / μL Ex Taq DNA polymerase 0.2 μL, 10× PCR buffer 2.5 μL, 2.5 mM dNTP mixture 2 μL, 10 μM forward primer RsPV1-F1 0.5 μL, 10 μM reverse primer RsPV1-R1 0.5 μL, nuclease-free H 2 O is added to 25.0 μL;

[0166] PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 45 s, 35 cycles of amplification, and a final extension at 72°C for 5 min;

[0167] Reference Figure 3As shown, after the PCR product was detected by 1.5% agarose gel electrophoresis, the target fragment was recovered, and the target fragment was connected to the pMD18-T vector using a cloning vector kit, transformed into DH5α competent cells, and screened on a blue-white plate; three white-white colonies were randomly picked and inoculated on ampicillin LB medium, and the bacteria were shaken at 37°C for 12 hours; the plasmid was extracted using a plasmid micro-extraction kit; 1 μL of the plasmid was taken respectively, and PCR amplification was performed under the same conditions as the above PCR reaction system; the positive recombinant plasmids obtained by PCR detection were sequenced; the positive plasmids with completely correct sequences confirmed by sequencing were the positive control substances, and the corresponding lengths of the RsPV1 RdRp gene fragments of Codonopsis pilosula were 968 bp; the plasmid concentrations of the standards were determined using a NanoDrop ND-1000 nucleic acid / protein analyzer;

[0168] 4. Sequence of positive control

[0169] After sequencing, the positive standard of the RdRP gene of Codonopsis pilosula RsPV1 was consistent with expectations, and the sequence of the recovered reference fragment was as follows:

[0170] The positive standard sequence of RdRp gene of Codonopsis pilosula RsPV1:

[0171] GCTCATGGCTCATCCCTTGAACCTCACATGGTCGATAGACGTATGACGATAGGATCTCTACAATGAGATGTTTTTCATCAATCGACTTAACATTCACCTTATTAAAGATGGATGGATAACCAATAAACACGGACACGATCTTAGATATTGGCATACAGCTCATGCTCGACAGCATTTAGTTGAAGCTAATGAAGAAGACAAAGTTCGACTTGTTTTTGGCGCACCTTCCACCCTTTTGATGGCTGAGCTCATGTTCATTTGGCCGATACAATCTAGTTTACTATCTAGAGGTTCACAATCGCCAATGTTATGGGGCTACGAAACCACAACTGGAGGATGGTCACGCCTTTACAACTGGGCTGCCAAAGAGCTGCCTAAATTTGCATCAGTTGCGACCCTTGACTGGAGCCGCTTCGACAAAGACGCAAGACACACTGTTATCAGAGACATTCACTCAATGATATTGAGGCCTATGTTTGATTTCACTGCAGGTTACCACCCCACATATCAGAATCCCAGGACTACTCCTGACCCCCAAAGGCTTGAAAACCTATGGAATTGGATGACTGACGCCATACTGACAACACCGCTGCTGTTGCCTGATGGACGAATGCTAAGGTTCACTCACTCAGGAATCTACTCTGGCTATTTTCAGACCCAGATTCTAGATTCGATCTACAACTGCGTGATGATTTTCACCATTCTATCAAGAATGGGAATCGACTTAAATACAATCGCGTTGAAAGTACAGGGAGATGACTCTATTATTTTGTTATCTCACAATTTTACTTTACTGCGCAAATCATTTCTACAGATGTTTGCAGAGCTGGCCAACACCTATTTTGGATCAACTCTCAACACAAAGAAGAGCGAACTTCTCCCCTCATTAGAAGGAGCAGAAGTACTGCGATATCGTAATCAGGCACTATGCCATACAGAGACGAATTACAGTTGCTAGCCATGTTGCG。

[0172] Example 2

[0173] This embodiment also provides a method for rapidly detecting the emerging viral pathogen RsPV1 of Codonopsis pilosula using the PAE-RT-qLAMP kit.

[0174] 1. Concentration, purification and PAE adsorption enrichment of Codonopsis pilosula RsPV1 virus particles:

[0175] 1) Take 50-100 mg of the tissue material such as Codonopsis pilosula leaves and seeds to be tested, add 1 mL of phosphate buffer PBS and grind, transfer the grinding solution into a 1.5 mL sterile centrifuge tube, centrifuge at 3000 rpm for 2 min, and the supernatant is the crude extract of the diseased tissue;

[0176] 2)Reference Figure 1 As shown, the crude extract of the above-mentioned diseased tissue is filtered through a 0.45 μm hydrophilic filter membrane to remove cell debris and other large particle aggregates to achieve the purpose of clarification and purification;

[0177] 3)Reference Figure 2 As shown, the filtered and purified virus solution is further concentrated by a centrifugal ultrafiltration tube to obtain a diseased tissue concentrate;

[0178] 4) Take 100 μL of the above infected tissue concentrate and add it to a 0.5 mL PCR tube and incubate at 4°C for 15 minutes;

[0179] 5) Discard the crude extract of the infected tissue, wash once with phosphate-buffered saline (PBST), and use RNA-free H 2 Wash once with 5% CO, centrifuge briefly, and remove the residual liquid.

[0180] 2. Initial denaturation of virus particles:

[0181] Take 10uL of RNA-free H containing 15units (U) RNase inhibitor 2 O, add to the bottom of the above PCR tube, incubate at 95℃ for 1 minute for denaturation, then quickly put on ice for 1 minute for subsequent reactions.

[0182] 3.RT reaction:

[0183] 1) Take a new PCR tube and add 2 μL of the denatured solution, 1 μL of 10 μM RsPV1-specific reverse primer RsPV1-R, and 1 μL of RNA-free H 2 O 2μL, after mixing, incubate at 70℃ for 10min, then quickly put on ice for 2min;

[0184] 2) Add 2 μL of 5×M-MLV buffer, 1 μL of 10 mM dNTP mixture, 0.34 μL of 30 U / μL RNase inhibitor, 0.35 μL of 200 U / μL M-MLV reverse transcriptase, and RNA-free H 2 Add 0 to 10 μL, mix well, and place in a 42°C water bath for 1 h and incubate at 70°C for 15 min to obtain the first-chain cDNA for subsequent LAMP amplification.

[0185] 4. Fluorescence quantitative qLAMP amplification reaction:

[0186] Take a new PCR tube and add the following reagents for fluorescence quantitative qLAMP amplification. The reaction system is 12.5 μL, where the qLAMP amplification reagents include 50 ng cDNA 1.0 μL, 10× Thermpopol buffer 2.5 μL, 100 mM MgSO 4 1.5μL, 10mM dNTP mixture 3.5μL, 10μM F3 and B3 Primer 0.5μL each, 10μM FIP and BIP Primer 2.0μL each, 10μM LF and LB Primer 0.5μL each, 8U / μL Bst DNA polymerase 1.0μL, 0.25μl LAMP fluorescent dye Dye, nuclease-free H 2 O to 12.5 μL; at the same time, add nuclease-free HO 2 O was used as a negative control, and the positive standard of Codonopsis pilosula RsPV1 RdRp gene was used as a positive control; LAMP amplification was performed on a real-time fluorescence quantitative PCR thermal cycler, and the reaction conditions were: 60℃ amplification for 60min and 80℃ denaturation for 5min.

[0187] In other embodiments, if the content of RsPV1 virus in a sample is to be detected, when performing the above-mentioned qLAMP amplification reaction, a 10-fold diluted RdRp gene positive standard of Codonopsis pilosula RsPV1 needs to be amplified simultaneously, and a standard curve needs to be drawn.

[0188] 5. Analyze and determine the reaction products

[0189] After the above fluorescence quantitative qLAMP amplification reaction is completed, observe whether the real-time fluorescence PCR thermal cycler detects the fluorescent signal in the PCR tube:

[0190] If an obvious fluorescent signal is detected in the sample PCR tube, it means positive, indicating that the sample contains Codonopsis RsPV1 virus;

[0191] If no obvious fluorescent signal is detected in the sample PCR tube, it means negative, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus.

[0192] In other embodiments, if the content of RsPV1 virus in a positive sample is to be determined, the copy number of RsPV1 virus in the positive sample needs to be quantitatively determined based on the amplification Ct value of the positive sample in combination with the standard curve.

[0193] Example 3

[0194] This embodiment provides a method (PAE-RT-LAMP) for rapid detection of Codonopsis pilosula RsPV1 virus pathogens using a common PCR thermal cycler based on the PAE-RT-qLAMP kit of Example 1, which does not use a real-time fluorescence quantitative PCR thermal cycler. In other embodiments, a constant temperature device such as a water bath, a constant temperature incubator, a metal bath, etc. can be used to perform a common LAMP display reaction.

[0195] Compared with Example 2, the only difference is the LAMP amplification reaction in step 4:

[0196] The reaction system was 12.5 μL, and the LAMP amplification reagents included 50 ng cDNA 1.0 μL, 10× Thermpopol buffer 2.5 μL, 100 mM MgSO 4 1.5μL, 10mM dNTP mixture 3.5μL, 10μM B3 and F3 Primer 0.5μL each, 10μM FIP and BIP Primer 2.0μL each, 10μM LF and LB Primer 0.5μL each, 8U / μL Bst DNApolymerase 1.0μL, nuclease-free H 2 Add HO to 12.5 μL; add nuclease-free HO 2 O was used as a negative control, and the positive standard of Codonopsis pilosula RsPV1 RdRp gene was used as a positive control; after the reaction system was configured, 1 μL of 100×SYBR Green I fluorescent dye developer was added to the inner wall of the PCR tube cap, the PCR tube cap was tightly closed, and LAMP amplification was performed; the reaction conditions of LAMP were: 64°C amplification for 60 min, 80°C denaturation for 5 min, and termination of the reaction.

[0197] Analyze and judge the reaction products:

[0198] After the above LAMP reaction is completed, centrifuge or gently shake the PCR tube without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, turn it upside down to mix well, and observe the color change of the mixed solution in the PCR tube with the naked eye under natural light:

[0199] If the color of the mixed solution turns green, it means that the SYBR Green I dye binds to the double-stranded DNA, which is a positive reaction, indicating that the sample tested contains the Codonopsis RsPV1 virus;

[0200] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus.

[0201] Example 4

[0202] This example provides a method for detecting the pathogen of Codonopsis pilosula RsPV1 by RT-qPCR.

[0203] The primers for amplifying the RsPV1 RdRp gene by fluorescence quantitative qPCR are as follows:

[0204]

[0205] The fluorescence quantitative qPCR reaction system was 10 μL, including 50 ng cDNA 1.0 μL, TB Green Premix Ex Taq (2X) (Tli RNaseH Plus) 5.0 μL, 10 μM forward primer RsPV1-qPCR-F1 0.2 μL, 10 μM reverse primer RsPV1-qPCR-R1 0.2 μL, ROX Reference Dye (50X) 0.2 μL, nuclease-free H 2 O to 10.0 μL; at the same time, add nuclease-free H 2 O was used as a negative control, and qPCR amplification was performed on a real-time fluorescence quantitative PCR thermal cycler. The reaction conditions were: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing for 34 s, and 35 cycles of amplification.

[0206] In order to evaluate the accuracy of the method results, this example also performed melting curve amplification with parameters of 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0207] Example 5

[0208] This embodiment provides a method for detecting the pathogen of Codonopsis pilosula RsPV1 using an RT-PCR method.

[0209] The primers for conventional PCR amplification of the AVA CP gene are as follows:

[0210]

[0211] The general PCR reaction system is 25.0 μL, including: 50 ng cDNA 1.0 μL, 5U / μL Ex Taq DNA polymerase 0.2 μL, 10× PCR buffer 2.5 μL, 2.5 mM dNTP mixture 2 μL, 10 μM forward primer RsPV1-PCR-F1 0.5 μL, 10 μM reverse primer RsPV1-PCR-R1 0.5 μL, nuclease-free H 2 O was added to 25.0 μL; PCR amplification conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 54°C annealing for 30 s, 72°C extension for 45 s, 35 cycles of amplification, and finally 72°C extension for 5 min.

[0212] The amplified products were analyzed by gel electrophoresis.

[0213] Experimental Example 1

[0214] Screening of qLAMP primer sets

[0215] In order to screen the optimal primer set for qLAMP amplification, four sets of LAMP primers were designed in the region of the Codonopsis pilosula RsPV1 RdRp gene using PrimerExplorer5 software and default settings. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The cDNA of healthy Codonopsis pilosula leaf samples was used as a negative control, and the cDNA of the Codonopsis pilosula RsPV1 positive leaf samples in the above embodiment was used as a reaction sample. The qLAMP reaction was carried out on an Mx3000p real-time PCR thermal cycler using the qLAMP detection system and detection method in the above embodiment. The reaction program was 60°C amplification for 60 minutes, 80°C denaturation for 5 minutes, and the fluorescence signal amplification curve of each reaction sample was observed after the amplification. The experiment was repeated 3 times; the sequences of each primer are shown in the following table:

[0216]

[0217]

[0218] The amplification results are as follows Figure 4As shown in the figure, among the four primers, the RsPV1-LAMP3 and RsPV1-LAMP4 primers did not produce fluorescent signals and could not amplify the RdRp gene of Codonopsis pilosula RsPV1; while the other two primers, RsPV1-LAMP1 and RsPV1-LAMP2, could quickly amplify the cDNA of the leaf samples of Codonopsis pilosula RsPV1-positive plants. The peak time of the RsPV1-LAMP2 primer group was the earliest, at 20 minutes, followed by the RsPV1-LAMP1 primer group, with a peak time of 30 minutes. After a large number of screening and repeated verification, it was finally determined that the RsPV1-LAMP2 primer group had the highest sensitivity to the cDNA of the Codonopsis pilosula RsPV1-positive samples and was used for subsequent experiments.

[0219] Experimental Example 2

[0220] This experimental example provides a common colorimetric LAMP naked eye observation experiment at different reaction temperatures and reaction times using the PAE-RT-qLAMP kit in Example 2 to quickly detect Codonopsis RsPV1 virus. The detection method is shown in Example 2.

[0221] The amplification results of RT-LAMP amplification at 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C and 70°C for 80 min were tested respectively. Figure 5 As shown in the figure: reaction tube CK: negative control; reaction tube 56°C-70°C corresponds to: 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C and 70°C. As can be seen from the figure, the amplification primer set provided in the embodiment of the present invention can achieve efficient amplification of the RdRp gene of Codonopsis pilosula RsPV1 under the condition of 56-70°C.

[0222] The amplification results of the RT-LAMP amplification time of 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min, and 100min with an amplification temperature of 64°C were tested respectively. Figure 6 As shown in the figure: reaction tube CK: negative control; reaction tube 20-100min corresponds to: 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min, 100min. It can be seen from the figure that the amplification primer combination provided by the embodiment of the present invention can achieve efficient amplification of the RdRp gene of Codonopsis pilosula RsPV1 under the condition of 30-100min.

[0223] Experimental Example 3

[0224] The PAE-RT-qLAMP kit is specific for rapid detection of the emerging viral pathogen RsPV1 in Codonopsis pilosula.

[0225] In order to analyze the specificity of the PAE-RT-qLAMP kit for detecting the newly emerging RsPV1 virus of Codonopsis pilosula, the infected leaves of seven viruses in the field, including apple latent spherical virus ALSV and autumn cauliflower mottle virus LycMoV infecting Angelica sinensis, lily latent virus LSV, cucumber mosaic virus CMV and lily mottle virus LMoV infecting lily, konjac mosaic virus KoMV infecting Angelica sinensis and radish bipartite virus 1 RsPV1 infecting Codonopsis pilosula, were used as samples. The infected tissue crude extract and concentrate were prepared after grinding with phosphate buffer PBS. RT-qLAMP amplification was performed according to the PAE-RT-qLAMP detection system and detection method in the above embodiment. The reaction procedure was amplification at 60°C for 60 min, followed by denaturation at 80°C for 5 min to terminate the reaction. After the amplification, the fluorescent signal detected on the real-time fluorescence PCR thermal cycler was observed. The nuclease-free H 2 O was the blank control, healthy Codonopsis pilosula leaves were used as the negative control, and the experiment was repeated 3 times.

[0226] Fluorescence signal observation results refer to Figure 7 As shown, only the leaves of Codonopsis pilosula infected with RsPV1 amplified the fluorescence curve, and the amplified products of the other diseased leaves, the blank control and the healthy Codonopsis pilosula leaves all detected obvious fluorescence signals, which indicates that the PAE-RT-qLAMP method established in the present invention has high specificity for the Codonopsis pilosula RsPV1 virus and has no cross reaction with other common Chinese medicinal materials viruses.

[0227] As a comparative test, the infected leaves of the above 7 viruses in the field were used as samples, and the infected tissue crude extract and concentrate were prepared after grinding with phosphate buffer solution PBS. According to the detection system and detection method in the above Example 3, RT reaction was carried out to synthesize the first chain of cDNA, and then a common LAMP color reaction was carried out. The reaction procedure was amplification at 64°C for 60 minutes and denaturation at 80°C for 5 minutes. After the amplification, the PCR tube was centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, and the tube was mixed upside down, and the color change of the mixed solution in the PCR tube was observed by naked eyes under natural light; nuclease-free H 2 O was the blank control, healthy Codonopsis pilosula leaves were used as the negative control, and the experiment was repeated 3 times.

[0228] The color development results were observed with the naked eye under natural light, referring to Figure 8 It was shown that only the mixed solution of the Codonopsis pilosula leaf sample infected with RsPV1 turned green, while the amplification products of the other diseased leaves, the blank control and the healthy Codonopsis pilosula leaves were all orange, indicating that the PAE-RT-LAMP method established in the present invention has high specificity for the Codonopsis pilosula RsPV1 virus and has no cross-reaction with other common Chinese medicinal material viruses.

[0229] The above results show that the specific detection results of PAE-RT-qLAMP and PAE-RT-LAMP for Codonopsis pilosula RsPV1 virus are completely consistent.

[0230] Experimental Example 4

[0231] The sensitivity of PAE-RT-qLAMP kit for rapid detection of emerging viral pathogen RsPV1 in Codonopsis pilosula.

[0232] In order to analyze the sensitivity of the PAE-RT-qLAMP kit for quantitative detection of RsPV1 virus pathogens, the cDNA of the positive leaves infected with RsPV1 of Codonopsis pilosula in the above example was used as a sample and the DNA was purified by nuclease-free H 2 The cDNA samples were diluted 10-fold and stored at -20°C as templates. 1.0 μL of each 10-fold dilution was taken as a template and added to the qLAMP reaction reagent in Example 1 for fluorescence quantitative qLAMP amplification. The reaction procedure was 60°C for amplification for 60 min, followed by denaturation at 80°C for 5 min to terminate the reaction. After the amplification, the fluorescence signal detected on the real-time fluorescence PCR thermal cycler was observed. The nuclease-free H 2 O was the blank control, healthy Codonopsis pilosula leaves were used as negative control, and the experiment was repeated three times;

[0233] As a comparative test, each of the dilutions diluted 10 times above was subjected to fluorescent quantitative qPCR amplification (Example 4) and conventional PCR amplification (Example 5).

[0234] After the qLAMP reaction is completed, observe the fluorescent signal detected in the real-time fluorescence PCR thermal cycler, refer to Fig. 9 As shown in the figure, the sensitivity of PAE-RT-qLAMP to cDNA of RsPV1 positive leaf samples of Codonopsis pilosula was 10 -4 ;

[0235] After the fluorescence quantitative qPCR reaction is completed, observe the fluorescence signal detected on the real-time fluorescence PCR instrument and refer to Fig.10 As shown in the figure, the sensitivity of PAE-RT-qPCR to the cDNA of Codonopsis pilosula RsPV1 positive samples was also -4 ; Melting curve analysis reference Fig.11 As shown, the melting temperature of the target product of RsPV1 is around 84°C, the amplified product is single, forming a specific melting peak, no mixed peaks appear, and the peak values ​​are relatively consistent, indicating that the quantitative results of PAE-RT-qPCR are reliable.

[0236] After the PCR reaction, 5 μL of the amplified product was loaded and subjected to agarose gel electrophoresis. Fig.12 As shown in Figure 2, the product size (968 bp) was consistent with expectations, and the sensitivity of PAE-RT-PCR to cDNA from RsPV1-positive leaf samples of Codonopsis pilosula was 10 -2 .

[0237] In summary, the sensitivity of PAE-RT-qLAMP in detecting RsPV1 in Codonopsis pilosula is the same as that of PAE-RT-qPCR, and the sensitivity of both to cDNA of RsPV1-positive samples is 100 times higher than that of PAE-RT-PCR.

[0238] Experimental Example 5

[0239] The dissolution curve of the PAE-RT-qLAMP kit for rapid detection of the viral pathogen RsPV1 of Codonopsis pilosula.

[0240] In order to analyze the dissolution curve of the PAE-RT-qLAMP kit for quantitative detection of RsPV1 virus pathogens, the cDNA of the positive leaves infected with Codonopsis pilosula RsPV1 in Example 1 was used as a sample and the nuclease-free H 2 The cDNA samples were diluted 10-fold and stored at -20°C as templates. 1.0 μL of each 10-fold dilution was taken as a template and added to the qLAMP reaction reagent in Example 1 for fluorescent quantitative qLAMP amplification. The reaction procedure was 60°C amplification for 60 min, followed by denaturation at 80°C for 5 min, and then a melting curve was obtained at 50-95°C at a rate of 1°C / sec; nuclease-free H 2 O was the blank control, healthy leaves were used as the negative control, and the experiment was repeated 3 times.

[0241] After the qLAMP reaction is completed, observe the fluorescence signal and melting curve detected in the real-time fluorescence PCR thermal cycler, and refer to Fig.13 As shown, the original concentration and 10 1 , 10 2 , 10 3 and 10 4 Each cDNA sample diluted 10-fold produced a single melting peak with a melting temperature of about 88°C, while 5 and 10 6 times diluted cDNA samples and nuclease-free H 2 Neither the blank control of O nor the negative control of cDNA of healthy leaves amplified fluorescent signals, indicating that no nonspecific products and dimers appeared in qLAMP amplification, and the PAE-RT-qLAMP kit had good reliability in detecting the viral pathogen of Codonopsis pilosula RsPV1.

[0242] Experimental Example 6

[0243] Establishment of standard curve for quantitative detection of Codonopsis pilosula RsPV1 viral pathogen using PAE-RT-qLAMP kit.

[0244] In order to accurately quantify the content of RsPV1 virus particles in the sample, the RdRp gene positive standard of Codonopsis pilosula RsPV1 was used as the sample, and the starting concentration was 100 ng / μL, i.e. 2.49x10 10 copies / μL, use nuclease-free H 2 The positive standard of the RdRp gene of Codonopsis pilosula RsPV1 was diluted 10 times and stored at -20°C. 1.0 μL of the starting concentration and each of the dilutions after 6 consecutive 10-fold dilutions were taken as templates, and the qLAMP reaction reagent in the above example was added to perform fluorescent quantitative qLAMP amplification. The reaction procedure was 60°C amplification for 60 min, followed by denaturation at 80°C for 5 min; nuclease-free H 2 O was the negative control, and the experiment was repeated 3 times.

[0245] After the qLAMP reaction is completed, observe the fluorescent signal detected in the real-time fluorescence PCR thermal cycler, refer to Fig.14 As shown, the amplification curve was obtained, with the logarithm of the copy number as the x-axis and the cycle number of the fluorescence signal baseline (Cycle threshold, Ct value) as the y-axis, and the standard curve was drawn. The PAE-RT-qLAMP standard curve of Codonopsis pilosula RsPV1 was y=-5.770x+71.379, R 2 =0.98, indicating that the curve is at 2.49x10 10 -2.49x10 4 It has a good linear relationship in the range of copies / μL, and can accurately quantify the viral pathogen of Codonopsis pilosula RsPV1.

[0246] Experimental Example 7

[0247] PAE-RT-qLAMP kit was used to detect laboratory-detoxified or field-grown Codonopsis pilosula samples.

[0248] Samples of Codonopsis pilosula leaves and seeds, etc., which are detoxified in the laboratory or collected in the field, are ground with phosphate buffered saline (PBS), filtered, purified and concentrated according to the PAE method in Example 2 to obtain a concentrated solution of diseased tissues, and then RT-qLAMP amplification is performed using the PAE-RT-qLAMP detection system in Example 2 to obtain a concentrated solution of diseased tissues. 2 O was used as negative control, and the positive standard of RdRp gene of Codonopsis pilosula RsPV1 diluted 10 times was used as positive control. The experiment was repeated 3 times. After the amplification, observe whether the fluorescent signal in the PCR tube is detected in the real-time fluorescence PCR thermal cycler:

[0249] If an obvious fluorescent signal is detected in the sample PCR tube, it means positive, indicating that the sample contains Codonopsis RsPV1 virus;

[0250] If no obvious fluorescent signal is detected in the sample PCR tube, it means negative, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus;

[0251] Optionally, if the content of RsPV1 virus in the sample is to be detected, a 10-fold diluted Codonopsis pilosula RsPV1RdRp gene positive standard is required to be amplified simultaneously, and a standard curve is drawn. According to the amplification Ct value of the test sample, combined with the standard curve, the copy number of RsPV1 virus in the test sample is quantitatively obtained;

[0252] Optionally, when there is no experimental equipment such as a real-time fluorescent PCR thermal cycler, the PAE-RT-LAMP detection system in the above Example 2 can be used to perform a common RT-LAMP color development reaction. After the LAMP reaction is completed, the PCR tube is centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, and the tube is turned upside down to mix well, and the color change of the mixed solution in the PCR tube is observed with the naked eye under natural light:

[0253] If the color of the mixed solution turns green, it is a positive reaction, indicating that the sample contains Codonopsis pilosula RsPV1 virus;

[0254] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula RsPV1 virus.

[0255] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A LAMP nucleic acid combination for detecting Raphanus sativus partitivirus 1 in Codonopsis pilosula, characterized in that: It includes: LAMP forward outer primer F3 shown in SEQ ID NO.2, LAMP reverse outer primer B3 shown in SEQ ID NO.3, LAMP forward inner primer FIP shown in SEQ ID NO.4, LAMP reverse inner primer BIP shown in SEQ ID NO.5, LAMP forward loop primer LF shown in SEQ ID NO.6 and LAMP reverse loop primer LB shown in SEQ ID NO.

7.

2. The LAMP nucleic acid combination for detecting Raphanus sativuspartitivirus 1 in Codonopsis pilosula according to claim 1, characterized in that: The LAMP nucleic acid combination also includes a reverse transcription primer.

3. The LAMP nucleic acid combination for detecting Raphanus sativuspartitivirus 1 in Codonopsis pilosula according to claim 2, characterized in that: The reverse transcription primer is shown as SEQ ID NO.

1.

4. A nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula, characterized in that: It includes: The upstream primer is shown in SEQ ID NO.8, and the downstream primer is shown in SEQ ID NO.

9.

5. The nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 4, characterized in that: The nucleic acid combination also includes a reverse transcription primer.

6. The nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 5, characterized in that: The reverse transcription primer is shown as SEQ ID NO.

1.

7. A nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula, characterized in that: It includes: The upstream primer is shown in SEQ ID NO.10, and the downstream primer is shown in SEQ ID NO.

11.

8. The nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 7, characterized in that: The nucleic acid combination also includes a reverse transcription primer.

9. The nucleic acid combination for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 8, characterized in that: The reverse transcription primer is shown as SEQ ID NO.

1.

10. A product for detecting Radish Bipartite Virus 1 in Codonopsis pilosula, the product being a reagent, a kit or a chip, characterized in that: The product comprises at least one of the following nucleic acid combinations: The LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula according to any one of claims 1-3, the nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula according to any one of claims 4-6, and the nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula according to any one of claims 7-9.

11. The product according to claim 10, characterized in that The product also includes: a reverse transcription reagent, which includes a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mixture and water.

12. The product according to claim 11, characterized in that When the product is used for LAMP amplification, the product further comprises: a LAMP amplification reagent, and the LAMP amplification reagent comprises: dNTPs, ThermoPol reaction buffer, Mg ions, DNA polymerase, LAMP fluorescent dye and water.

13. The product according to claim 11, characterized in that When the product is used to perform a fluorescent quantitative qPCR reaction, the product further comprises: a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix.

14. The product according to claim 11, characterized in that When the product is used to perform a PCR reaction, the product further comprises: a PCR reaction premix.

15. The product according to claim 14, characterized in that The PCR reaction premix also includes: DNA polymerase, PCR buffer, dNTP mixture and water.

16. The product according to claim 10, characterized in that The product also includes: a positive control and a negative control.

17. The product according to claim 16, characterized in that The positive control is Codonopsis pilosula radish bipartite virus 1 R Gene.

18. The product according to claim 10, characterized in that The product also includes: a physical adsorption enrichment device for tissue separation of the sample to be tested, the physical adsorption enrichment device includes a filter and an ultrafiltration tube; the filter is provided with a hydrophilic filter membrane.

19. A method for detecting radish bipartite virus 1 in Codonopsis pilosula, characterized in that: It includes the following steps: The sample to be tested is subjected to reverse transcription reaction using the reverse transcription primer in the LAMP nucleic acid combination according to any one of claims 2 to 3 or the product according to any one of claims 11 to 18 to obtain cDNA, and then the cDNA is subjected to LAMP reaction using the LAMP nucleic acid combination according to any one of claims 1 to 3 under the following reaction conditions: 56-70° C., 30-100 min; 80° C., 5-10 min.

20. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 19, characterized in that: The LAMP reaction was carried out under the following conditions: 60-64°C, 30-100 min; 80°C, 5-10 min.

21. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 19, characterized in that: The LAMP reaction system includes: a LAMP reverse outer primer B3 with a final concentration of 0.2-0.4 μM, a LAMP forward outer primer F3 with a final concentration of 0.2-0.4 μM, a LAMP forward inner primer FIP with a final concentration of 1.5-1.7 μM, a LAMP reverse inner primer BIP with a final concentration of 1.5-1.7 μM, a LAMP forward loop primer LF with a final concentration of 0.3-0.5 μM, and a LAMP forward loop primer LB with a final concentration of 0.3-0.5 μM.

22. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 21, characterized in that: The LAMP reaction system also includes: Mg ions with a final concentration of 8.0-12.5 mM, dNTPs with a final concentration of 1.4-2.8 mM, and DNA polymerase with a final concentration of 0.32-0.64 U.

23. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 19, characterized in that: Before the reverse transcription reaction, the method also includes the preparation of the sample to be tested, which includes: using tissue extract to roughly extract the sample of the Codonopsis pilosula material to be tested, filtering through a filter, transferring the collected filtrate to an ultrafiltration tube for concentration; and then incubating and washing to obtain the product.

24. The method for detecting radish bipartite virus 1 in Codonopsis pilosula according to claim 23, characterized in that: The washed sample is subjected to initial denaturation and then used for reverse transcription reaction. The conditions of the initial denaturation are: 85-95° C., 1-5 min; ice bath.

25. A method for detecting radish bipartite virus 1 in Codonopsis pilosula, characterized in that: The method is any one of the following methods: (1) Using the reverse transcription primer in the nucleic acid combination of any one of claims 4 to 6 or the product of any one of claims 11 to 18 to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then using the upstream primer and downstream primer in the nucleic acid combination of any one of claims 4 to 6 to perform qPCR amplification on the cDNA; and detecting the amplified product; (2) Using the reverse transcription primers in the nucleic acid combination of any one of claims 7 to 9 or the product of any one of claims 11 to 18 to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then using the upstream primer and downstream primer in the nucleic acid combination of any one of claims 7 to 9 to perform PCR amplification on the cDNA.

26. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 25, characterized in that: The qPCR reaction conditions are: 95°C, 30 s; 95°C 5 s, 60°C 34 s, and 30-40 cycles of amplification.

27. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 26, characterized in that: The qPCR reaction system includes an upstream primer with a final concentration of 0.2-0.7 μM and a downstream primer with a final concentration of 0.2-0.7 μM.

28. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 26, characterized in that: The PCR reaction conditions are: 95°C, 3-5min; 95°C 5s, 54°C 30s, 70-72°C 45s, and 30-40 cycles of amplification.

29. The method for detecting Radish Bipartite Virus 1 in Codonopsis pilosula according to claim 26, characterized in that: The PCR reaction system includes 0.2-1.0 μM upstream primer and 0.2-1.0 μM downstream primer.

30. Use of the LAMP nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula as described in any one of claims 1-3, the nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula as described in any one of claims 4-6, the nucleic acid combination for detecting radish bipartite virus 1 in Codonopsis pilosula as described in any one of claims 7-9, or the product as described in any one of claims 10-18 in detecting radish bipartite virus 1 in Codonopsis pilosula.

Images