A method for inducing guava hairy roots without tissue culture

Abstract

The present invention relates to the field of crop genetic breeding, and in particular to a method for inducing guava hairy roots without tissue culture. The present invention uses pretreated guava seedlings as explants, uses Agrobacterium rhizogenes carrying a reporter gene and a target gene to infect the explants, and then transfers the infected explants to a culture matrix for cultivation, thereby successfully establishing a simple, low-cost and efficient genetic transformation system for obtaining transgenic materials. Compared with traditional guava genetic transformation methods, the induction method provided by the present invention does not require tissue culture, improves transformation efficiency, shortens the transformation cycle, and also reduces consumables and manpower consumption, thereby solving the problems of complex experimental operation, large-scale equipment and consumables, long cycle and low success rate in the original guava genetic transformation technology, and provides a convenient and efficient tool for the study of guava gene functions (especially root-specific expression of gene functions).

Description

Technical Field

[0001] The invention relates to the field of crop genetic breeding, and in particular to a method for inducing guava hairy roots without tissue culture. Background Art

[0002] Guava (Psidium guajava L.) is an important specialty economic crop in Guangdong. It belongs to the genus Psidium of the Myrtaceae family. It is native to tropical America and is distributed or cultivated in many places in my country. Modern pharmacological and clinical studies have shown that guava is rich in a variety of important aromatic secondary metabolites. It is these polyphenols that give guava a variety of effects, such as softening blood vessels, lowering blood sugar and blood lipids, anti-oxidation and anti-tumor, etc. At the same time, it also has obvious therapeutic effects on symptoms such as diarrhea, enteritis, gastrointestinal ulcers, eczema and cough.

[0003] Establishing a guava genetic system is not only the main tool for gene function research, but also an important prerequisite for molecular precision breeding, which is of great significance to the field of guava germplasm resources. At present, guava genetic transformation is mainly carried out by co-cultivation of Agrobacterium under tissue culture conditions to obtain transgenic plants. The success of tissue culture depends on the strict control of various parameters of the growth environment, including pH value, oxygen content, nutrient concentration, and hormone concentration, which requires the establishment of a highly sophisticated laboratory to ensure the accuracy and reliability of the experiment. It can be seen that obtaining transgenic materials through tissue culture has the disadvantages of complex experimental operations, occupying a large amount of equipment and consumables, long cycles, and low success rates. Therefore, finding a simple, efficient and short-cycle method is of great significance to guava breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a method for inducing guava hairy roots without tissue culture to solve the problems existing in the above-mentioned prior art. The method of the present invention has the advantages of being simple, efficient and having a short cycle.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a method for inducing guava hairy roots without tissue culture, comprising the steps of using pretreated guava seedlings as explants, infecting the explants with Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then transferring the infected explants to a culture medium for culturing;

[0007] The pretreatment comprises the step of cutting off the underground part of the guava seedling at an oblique angle of 45 degrees to form a smooth incision.

[0008] Preferably, the guava seedlings are guava seedlings having a radicle length of ≥0.5 cm and <1 cm.

[0009] Preferably, the activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 30° C. for 24 hours.

[0010] Preferably, the Agrobacterium rhizogenes is Agrobacterium rhizogenes K599.

[0011] Preferably, the culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1.

[0012] Preferably, the culture matrix covers the wound site of the pretreated guava seedlings.

[0013] Preferably, after the infected explants are transferred to the culture matrix, a film-covering step is also included.

[0014] Preferably, the culture includes dark culture and light culture; the dark culture time is 2 days, and the temperature is 25°C; the light culture time is 15-25 days, and the temperature is 25°C.

[0015] The present invention discloses the following technical effects:

[0016] The invention establishes a genetic transformation system without tissue culture. It is very critical to use guava seedlings with radicle length of ≥0.5 cm and <1 cm as experimental materials, which ensures the vitality of the materials, improves the occurrence rate and positive rate of hairy roots, and reduces the pollution rate of the materials. The hairy roots can be induced to generate in 15-25 days, and the positive rate exceeds 75%. High-temperature sterilized quartz sand and vermiculite are used as culture substrates, and sterile water is sprayed to keep moisture, thereby ensuring the water retention and air permeability of the substrate and reducing the pollution rate. The culture method is simple to operate, low in consumption, and can achieve high-throughput processing. Agrobacterium rhizogenes K99 induces guava seedlings to generate hairy roots, avoiding the complex process of tissue culture in the Agrobacterium tumefaciens transformation system; using YEP solid culture medium to activate Agrobacterium rhizogenes K599 simplifies the vacuum infection step required for liquid bacterial liquid, delays the time for bacterial body to infect the incision, simplifies the genetic transformation process, and improves the incidence rate and positive rate of hairy roots; the optimal activation time of Agrobacterium rhizogenes K599 is 24h, under this condition, the incidence rate and positive rate of hairy roots are both high; in addition, using the GUS marker gene, rapid and batch detection of positive hairy roots can be achieved. It can be seen that the present invention successfully establishes a simple, low-cost and efficient genetic transformation system for obtaining transgenic materials. Moreover, the results of the specific embodiments of the present invention show that the technical path of using Agrobacterium rhizogenes K599 to transform guava seedling materials under tissue culture-free conditions to obtain transgenic composite plants is feasible and efficient. Compared with traditional guava genetic transformation methods, the induction method provided by the present invention does not require tissue culture, improves transformation efficiency, shortens transformation cycle, and also reduces consumables and manpower consumption, thereby solving the problems of complex experimental operation, large amount of equipment and consumables, long cycle, low success rate, etc. in the original guava genetic transformation technology, and provides a convenient and efficient tool for the study of guava gene function (especially root-specifically expressed gene function). BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 The effect of different guava seedling materials on guava transformation efficiency; A is the hairy root incidence rate; B is the positive rate;

[0019] Figure 2 The effect of different activation time of Agrobacterium rhizogenes K599 on the transformation efficiency of guava; A is the incidence of hairy roots; B is the positive rate; C is the length of root hairs;

[0020] Figure 3The figure is an experimental flow chart; A is the activation of Agrobacterium rhizogenes K599 (abbreviated as Agrobacterium); B is the germination of guava seeds by paper culture; C is the treatment of guava seedlings and infection with Agrobacterium rhizogenes K599 (abbreviated as K599); D is the transfer to culture matrix for culture; E is dark culture; F is artificial incubator culture (light culture); G is the induction of hairy root formation; H is the control GUS staining test result; I is the positive root seedling GUS staining test result;

[0021] Figure 4 This is the electrophoresis diagram of Bar gene PCR detection;

[0022] Figure 5 The results are observed under a stereo microscope; A is the result of observation of the control (wild-type guava) hairy roots under a stereo microscope, and B is the result of observation of the positive guava hairy roots under a stereo microscope. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] Example 1 Effect of different guava seedling materials on guava transformation efficiency

[0029] In order to study whether there are differences in the genetic transformation efficiency of different guava seedling materials, guava seedlings with radicle lengths ranging from 0 cm < radicle length < 0.5 cm (0-0.5 cm), 0.5 cm ≤ radicle length < 1 cm (0.5-1 cm), 1 cm ≤ radicle length < 1.5 cm (1-1.5 cm), and 1.5 cm ≤ radicle length < 2 cm (1.5-2 cm) were selected for experiments. The specific experiments were as follows:

[0030] (1) Agrobacterium rhizogenes transformation

[0031] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, and then added to 0.5mL YEP liquid culture medium, cultured at 28℃ for 1h, and then about 50μL of bacteria were pipetted with a pipette and spread on a YEP solid plate containing 50mg / L spectinomycin, and cultured at 28℃ for 2d. A single colony was picked, and after sequencing and verification, it was stored at -80℃ for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0032] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0033] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator, inoculated on YEP solid medium containing 50 mg / L spectinomycin, and cultured at 28℃ for 1 day. The effective viable count of the culture was 10 9 CFU / mL.

[0034] (3) Paper culture germination and one-step induction of guava

[0035] Guava seeds were germinated by paper culture, and guava seedlings with different radicle lengths and good growth conditions were selected. Then, the underground part of the guava seedlings was cut off at an angle of 45° with a scalpel to form a smooth incision. The activated recombinant Agrobacterium rhizogenes K599 was applied to the incision, and then the guava seedlings into which the treated seedlings were transferred were transferred to the culture matrix. The volume ratio of quartz sand and vermiculite in the culture matrix was 1:1, and both quartz sand and vermiculite were sterilized. During the culture process, ensure that the wound part of the seedlings is covered by the culture matrix, and cover the seedlings with a layer of plastic wrap, and spray water several times a day to keep the culture matrix moist. First, culture at 25℃ in the dark for 2 days and then move to the artificial climate box for light culture. The culture condition parameters are: culture at 25℃ for 15 days to induce the formation of capillary roots.

[0036] Afterwards, the positive identification of transgenic plants was carried out, and the DNA in the hairy roots was extracted by the CTAB method. Specifically, after the hairy roots of transgenic guava were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube, and 1000 μL CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10 g / L PVP-40), after adding steel beads to the centrifuge tube, the sample was completely crushed, heated in a water bath at 65°C for 30 minutes, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5 minutes, centrifuged at 12000rpm for 8 minutes, the supernatant was drawn into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10 minutes, centrifuged at 12000rpm for 5 minutes, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μLddH2O was added to dissolve the DNA and the concentration was determined.

[0037] Then, Bar gene PCR detection was performed, specifically: PCR identification was performed using Bar gene primers (F: CAACCACTACATCGAGACAAGCA, SEQ ID NO.1; R: TCATCAGATCTCGGTGACGGG, SEQ ID NO.2), and the PCR program was set to: 94°C 3min, 30 repeated cycles (specifically including: 94°C 30s, 60°C 30s, 72°C 1min), 72°C 10min, and the hairy roots that could amplify a Bar gene band of about 50bp were positive.

[0038] The results are as follows Figure 1 As shown, guava seedlings with radicle length in the range of 0.5-1 cm showed the highest transformation efficiency, with a hairy root incidence rate of 91% and a hairy root positive rate of 88%. Therefore, in subsequent transformation experiments, guava seedlings with radicle length in the range of 0.5-1 cm were selected as genetic transformation materials.

[0039] Example 2 Analysis of the transformation efficiency of guava by different activation times of Agrobacterium rhizogenes K599

[0040] In order to determine the activation time of Agrobacterium rhizogenes K599 with the highest genetic transformation efficiency, this example uses recombinant Agrobacterium rhizogenes K599 activated for 24h, 48h and 72h to genetically transform guava seedlings, and the specific steps are as follows:

[0041] (1) Agrobacterium rhizogenes transformation

[0042] Same as Example 1.

[0043] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0044] Recombinant Agrobacterium rhizogenes K599 was taken out from the -80℃ refrigerator and inoculated on YEP solid medium containing 50 mg / L spectinomycin. It was cultured at 28℃ for 24 h (1d), 48 h (2d) and 72 h (3d). The effective viable counts of the cultures were 10 9 CFU / mL, 10 11 CFU / mL and 10 15 CFU / mL.

[0045] (3) Paper culture germination and one-step induction of guava

[0046] Guava seeds were germinated by paper culture, and guava seedlings with good growth status and radicle length ≥ 0.5 cm and < 1 cm were selected. Then, the underground part of the guava seedlings was cut off at an angle of 45° with a scalpel to form a flat incision. The activated recombinant Agrobacterium rhizogenes K599 was applied to the incision, and then the guava seedlings into which the treated seedlings were transferred were transferred to the culture matrix, the volume ratio of quartz sand and vermiculite in the culture matrix was 1:1, and both quartz sand and vermiculite were sterilized. During the culture process, ensure that the wound part of the seedlings is covered by the culture matrix, and cover the seedlings with a layer of plastic wrap, and spray water several times a day to keep the culture matrix moist. First, culture at 25℃ in the dark for 2 days and then move to the artificial climate box for light culture. The culture condition parameters are: culture at 25℃ for 15 days to induce the formation of capillary roots.

[0047] Afterwards, the positive identification of transgenic plants was carried out, and the DNA in the hairy roots was extracted by the CTAB method. Specifically, after the hairy roots of transgenic guava were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube, and 1000 μL CTAB (CTAB contains: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10 g / L PVP-40), after adding steel beads to the centrifuge tube, the sample was completely crushed, heated in a water bath at 65°C for 30 minutes, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5 minutes, centrifuged at 12000rpm for 8 minutes, the supernatant was drawn into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10 minutes, centrifuged at 12000rpm for 5 minutes, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μLddH2O was added to dissolve the DNA and the concentration was determined.

[0048] Then, Bar gene PCR detection was performed, specifically: PCR identification was performed using Bar gene primers, and the PCR program was set to: 94°C for 3 min, 30 repeated cycles (specifically including: 94°C for 30 s, 60°C for 30 s, 72°C for 1 min), 72°C for 10 min, and the hairy roots that could amplify a Bar gene band of about 50 bp were positive.

[0049] The results show Figure 2 As shown in the figure, the recombinant Agrobacterium rhizogenes K599 activated for 24 hours had the highest genetic transformation efficiency, with a hairy root incidence rate of 93% and a hairy root positive rate of 86%. On the 15th day after genetic transformation, the average length of the hairy roots reached 2.9 cm. Therefore, in subsequent transformation experiments, recombinant Agrobacterium rhizogenes K599 activated for 24 hours was used for genetic transformation to improve the transformation efficiency.

[0050] Example 3 Analysis of transformation efficiency of guava with different explants

[0051] In order to study whether there are differences in the genetic transformation efficiency of different guava explants, we selected guava semi-lignified branches, leaves, young shoots, guava seedlings with radicle lengths within the range of 0.5 cm ≤ radicle length < 1 cm and good growth conditions, and guava seedlings that had germinated for 15 days for the experiment. The specific experimental steps are as follows:

[0052] (1) Agrobacterium rhizogenes transformation

[0053] Same as Example 1.

[0054] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0055] Example 1.

[0056] (3)Explant

[0057] The guava seeds were germinated by the paper culture method. After the seeds germinated, the guava seed seedlings germinated by the paper culture method with the radicle length within the range of .5 cm ≤ radicle length < 1 cm and in good growth state were selected. The underground part of the guava seedlings was cut off at an angle of 45 degrees with a scalpel to form a smooth incision;

[0058] Germinate seeds using soil culture method, and pick guava seedlings after the first true leaf unfolds (seedlings 15 days after germination);

[0059] Guava semi-lignified branches;

[0060] Guava leaves;

[0061] Guava sprouts.

[0062] (4) Inducing the formation of transgenic hairy roots

[0063] Afterwards, the activated recombinant Agrobacterium rhizogenes K599 was applied to the incision, and the subsequent steps were the same as in Example 1 to induce the formation of capillary roots.

[0064] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results are shown in Table 1. As shown in Table 1, transgenic hairy roots could not be obtained within 15 days from seedlings, guava semi-lignified branches, leaves and buds after germination in soil culture for 15 days. This shows that different explants have a great influence on the transformation efficiency of guava.

[0065] Table 1 Analysis of transformation efficiency of guava with different explants

[0066]

[0067] Example 4 Analysis of transformation efficiency of guava by different infection methods

[0068] In order to study whether different infection methods have different effects on the genetic transformation efficiency of guava, we selected injection infection and one-step coating infection for experiments. The specific experimental steps are as follows:

[0069] (1) Agrobacterium rhizogenes transformation

[0070] Same as Example 1.

[0071] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0072] Same as Example 1.

[0073] (3) Guava germination in paper culture

[0074] Same as Example 1.

[0075] (4) Inducing the formation of transgenic hairy roots

[0076] Afterwards, half of the material was cut off from the underground part of the guava seedling at an angle of 45° with a scalpel to form a smooth incision, and then the recombinant Agrobacterium rhizogenes K599 was directly applied to the wound surface, and the other half of the material was still kept underground and the recombinant Agrobacterium rhizogenes K599 was dipped with a sterile needle and injected to infect the seedling. Then, the guava seedlings into which the treated seedlings were transferred were transferred to the culture matrix, and the subsequent steps were the same as in Example 1 to induce the formation of capillary roots.

[0077] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results are shown in Table 2. As shown in Table 2, the incidence and positive rate of hairy roots in the coating infection reached more than 88%, while the injection infection rate was only about 62%. Therefore, we chose the coating infection method to treat the seedlings.

[0078] Table 2 Analysis of transformation efficiency of guava by different infection methods

[0079] One-step coating infection Injection infection Hair root incidence (%) 91.7 63.2 Hair root positive rate (%) 88.5 62.1

[0080] Example 5 Analysis of transformation efficiency of different Agrobacterium rhizogenes in guava

[0081] In order to study whether there are differences in the genetic transformation efficiency of guava with different rhizogenes, we selected injection infection and coating infection for experiments. The specific experimental steps are as follows:

[0082] (1) Agrobacterium rhizogenes transformation

[0083] The Agrobacterium used in the experiment was Agrobacterium K599, MSU440 and ATCC15834, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium K599 were transformed by freeze-thaw method, and then added to 0.5mL YEP liquid medium, cultured at 28℃ for 1h, and then 50μL of the bacteria were pipetted and spread on a YEP solid plate containing 50mg / L spectinomycin, and cultured at 28℃ for 2d. A single colony was picked, and after sequencing and verification, it was stored at -80℃ for standby use, which was the recombinant Agrobacterium K599.

[0084] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0085] Same as Example 1.

[0086] (3) Paper culture germination and one-step induction of guava

[0087] The same as Example 1, except that guava seedlings in good growth condition with radicle length ≥ 0.5 cm and < 1 cm were selected.

[0088] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The results are shown in Table 3. As shown in Table 3, the root incidence rate and hairy root positive rate of Agrobacterium rhizogenes K599 were both above 88%, while the root incidence rate and hairy root positive rate of Agrobacterium rhizogenes MSU440 and Agrobacterium rhizogenes ATCC15834 were both below 75%. Therefore, we chose Agrobacterium rhizogenes K599.

[0089] Table 3 Analysis of transformation efficiency of guava with different Agrobacterium rhizogenes

[0090]

[0091]

[0092] Example 6 Effects of different activation modes of recombinant Agrobacterium rhizogenes K599 on guava transformation efficiency

[0093] In order to study whether different activation methods of different recombinant Agrobacterium rhizogenes K599 have different effects on the genetic transformation efficiency of guava, we selected two methods, solid activation and liquid activation, for experiments. The specific experimental steps are as follows:

[0094] (1) Agrobacterium rhizogenes transformation

[0095] Same as Example 1.

[0096] (2) Activation of recombinant Agrobacterium rhizogenes K599

[0097] Solid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it on the YEP solid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL;

[0098] Liquid activation: Take out the recombinant Agrobacterium rhizogenes K599 from the -80℃ refrigerator, inoculate it in YEP liquid medium containing 50mg / L spectinomycin, and culture it at 28℃ for 24h. The effective viable count of the culture is 10 9 CFU / mL.

[0099] (3) Paper culture germination and one-step induction of guava

[0100] The same as Example 1, except that guava seedlings in good growth condition with radicle length ≥ 0.5 cm and < 1 cm were selected.

[0101] Afterwards, positive identification of transgenic plants and PCR detection of Bar gene were performed. The test results are shown in Table 4. As shown in Table 3, on the 15th day after induction treatment, the root incidence rate and hairy root positive rate of Agrobacterium rhizogenes K599 obtained by solid activation reached more than 89%, while the hairy root incidence rate of Agrobacterium rhizogenes obtained by liquid activation was less than 26%, and the hairy root positive rate was less than 76%. Therefore, we chose to activate Agrobacterium rhizogenes K599 with solid culture medium.

[0102] Table 3 Analysis of transformation efficiency of guava with different Agrobacterium rhizogenes

[0103] Solid Activation Liquid Activation Hair root incidence (%) 92.1 25.7 Hair root positive rate (%) 89.5 75.4

[0104] Example 7

[0105] 1. Transgenic hairy root induction

[0106] The experimental process is detailed in Figure 3 , specifically:

[0107] (1) Agrobacterium transformation

[0108] The Agrobacterium rhizogenes used in the experiment was Agrobacterium rhizogenes K599, and the vector was pTF102 containing the GUS reporter gene. The competent cells of Agrobacterium rhizogenes K599 were transformed by freeze-thaw method, added to 0.5 mL of YEP liquid medium, cultured at 28 ° C for 1 h, and then 50 μL of the bacteria were pipetted and spread on a YEP solid plate containing 50 mg / L spectinomycin, and cultured at 28 ° C for 2 days. A single colony was picked, and after sequencing and verification, it was stored at -80 ° C for standby use, which was the recombinant Agrobacterium rhizogenes K599.

[0109] (2) Activation of Agrobacterium K599

[0110] K599 containing pTF102 plasmid was taken out from -80℃ refrigerator, inoculated on YEP solid medium containing spectinomycin, and cultured at 28℃ for 24h ( Figure 3 A), the effective viable count of the culture is 10 9 CFU / mL.

[0111] (3) Paper culture germination and one-step induction of guava

[0112] Paper culture method for germinating guava seeds ( Figure 3 B), pick guava seedlings with a radicle length of 0.5-1 cm and good growth. Then, use a scalpel to cut the lower part of the guava seedling at an angle of 45° to form a smooth incision. Apply the activated recombinant Agrobacterium rhizogenes K599 to the incision ( Figure 3 C), and then the guava seedlings into which the treated seedlings were transferred were transferred to a culture medium, wherein the volume ratio of the culture medium quartz sand and vermiculite was 1:1, and both the quartz sand and vermiculite were sterilized ( Figure 3 During the culture process, ensure that the wound of the seedlings is covered with the culture medium, and cover the seedlings with a layer of plastic wrap, and spray water several times a day to keep the culture medium moist. First, culture at 25℃ in the dark for 2 days ( Figure 3 E) and then moved to an artificial climate chamber for light culture. The culture conditions were as follows: 25°C for 15 days ( Figure 3 F in the figure), inducing the formation of hairy roots ( Figure 3 G in the middle); after 7 days of culture in quartz sand vermiculite medium, guava seedlings began to form hairy roots, and on the 15th to 25th day, lateral roots began to form a relatively complete root system ( Figure 3 G in.

[0113] 2. Positive identification of transgenic plants

[0114] (1) Bar gene PCR detection

[0115] DNA extraction from hairy roots using CTAB method

[0116] After the hairy roots of transgenic guava were formed, about 0.05 g of hairy roots were taken into a 1.5 mL centrifuge tube and 1000 μL C CTAB (CTAB containing: 12.114 g / L Tris, 7.44 g / L EDTA-Na2, 81.9 g / L NaCl, 20 g / L CTAB, 10 g / L PVP-40), after adding steel beads to the centrifuge tube, the sample was completely broken, heated in a water bath at 65°C for 30 minutes, allowed to stand and cool, an equal volume of chloroform: isoamyl alcohol mixture (the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1) was added, mixed and allowed to stand for 5 minutes, centrifuged at 12000rpm for 8 minutes, the supernatant was aspirated into a new 1.5mL centrifuge tube, 2 / 3 volume ratio of isopropanol was added, mixed and allowed to stand for 10 minutes, centrifuged at 12000rpm for 5 minutes, the supernatant was discarded, the DNA was washed twice with 70% (volume percentage) ethanol, air-dried on a clean bench, 10μL ddH2O was added to dissolve the DNA and the concentration was determined.

[0117] Bar gene PCR detection

[0118] PCR identification was performed using Bar gene primers, and the PCR program was set as: 94°C for 3 min, 30 repeated cycles (specifically including: 94°C for 30 s, 60°C for 30 s, 72°C for 1 min), 72°C for 10 min. The roots that could amplify a Bar gene band of about 500 bp were positive roots, and the positive roots were retained for subsequent GUS staining experiments. At the same time, some negative roots were retained as controls for subsequent experiments.

[0119] (2) GUS staining verification

[0120] Rinse the hair roots twice with secondary water, and then transfer them to GUS staining solution (the formula of GUS staining solution: 1mM X-Gluc and 0.1M Na2HPO4 / NaH2PO4, pH 7.2). Then, vacuum the sample for 40 minutes and transfer it to 37°C to stain overnight in the dark. The stained hair roots are positive hair roots, which are transferred to 75% (volume percentage) ethanol for storage, and their staining is observed and photographed using a stereo microscope.

[0121] (3) Results:

[0122] The DNA of guava hairy root material was extracted and conventional PCR was performed using Bar gene primers. The hairy roots that could amplify a Bar gene band of about 500 bp were positive, while the DNA of the roots of wild-type guava seedlings (control) could not expand the Bar gene band ( Figure 4 ).

[0123] Further GUS staining of the hairy roots showed good GUS activity staining effect, while the roots of wild-type guava seedlings (control) could not be stained ( Figure 3 H and I in Figure 3), by observing under a stereomicroscope, it can be observed that the GUS-tagged protein is stably expressed in the hairy roots and is strongly expressed in all parts of the root system of the positive guava seedlings, while the roots of the wild-type guava seedlings cannot be stained ( Figure 5 ).

[0124] The above experimental results show that the technical path of using Agrobacterium rhizogenes K599 to transform guava seedling materials under tissue culture-free conditions to obtain transgenic composite plants is feasible and efficient. The present invention uses guava seedlings germinated by paper culture as materials, and uses high-temperature sterilized quartz sand mixed with vermiculite as a culture medium under relatively open experimental conditions. The underground part of the guava seedlings is directly cut off, and the transgenic hairy roots are obtained by infecting the seedling incision with recombinant Agrobacterium rhizogenes K599, and then the positive hairy roots are quickly and efficiently identified using the GUS tag protein stably expressed in the positive hairy roots. Compared with the traditional guava genetic transformation method, the induction method provided by the present invention does not require tissue culture, improves the transformation efficiency, shortens the transformation cycle, and also reduces consumables and manpower consumption.

[0125] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for inducing guava hairy roots without tissue culture, characterized in that: The method comprises the steps of using pretreated guava seedlings as explants, infecting the explants with Agrobacterium rhizogenes carrying a reporter gene and a target gene, and then transferring the infected explants to a culture medium for culturing; The pretreatment comprises the steps of cutting off the underground part of the guava seedling at an oblique angle of 45° to form a smooth incision; The guava seedlings are guava seedlings with a radicle length of ≥0.5 cm and <1 cm; the guava is obtained by paper culture; The activation method of the Agrobacterium rhizogenes carrying the reporter gene and the target gene is to spread the Agrobacterium rhizogenes carrying the reporter gene and the target gene on a YEP solid culture medium containing 50 mg / L spectinomycin, and culture at 30° C. for 24 hours; The infection method is to apply the activated Agrobacterium rhizogenes carrying the reporter gene and the target gene to the incision of the explant; The Agrobacterium rhizogenes is Agrobacterium rhizogenes K599; The culture matrix includes quartz sand and vermiculite; the volume ratio of the quartz sand to the vermiculite is 1:1; The culture matrix covers the wound site of the pretreated guava seedling; After the infected explants are transferred to the culture matrix, the step of covering with a film is also included; The culture includes dark culture and light culture; the dark culture time is 2 days and the temperature is 25°C; the light culture time is 15-25 days and the temperature is 25°C.

Images