Carrier capable of sustainably secreting ultra-high molecular weight hyaluronic acid, umbilical cord mesenchymal stem cells, and construction method and application thereof

Abstract

Sustainable secretion of ultra-high molecular weight hyaluronic acid carrier, umbilical cord mesenchymal stem cells and their construction methods and applications belong to the field of biotechnology. The carrier of the sustainable secretion of ultra-high molecular weight hyaluronic acid of the present invention includes: CMV promoter and human HAS2 gene or naked mole rat Has2 gene. Its construction method includes: gene cloning of human HAS2 sequence, gene synthesis of naked mole rat Has2 sequence, insertion into pLVSIN-CMV vector, construction of human pLVSIN-CMV-HAS2 and naked mole rat pLVSIN-CMV-Has2 virus shuttle plasmids, virus packaging plasmids (gag, VSV-G) and shuttle plasmids (pLVSIN-CMV-HAS2 or pLVSIN-CMV-Has2) are co-transferred to virus packaging cells (HEK-293T), virus packaging is performed, and virus supernatant is collected. The human HAS2 or naked mole rat Has2 virus of the present invention is used to infect umbilical cord mesenchymal stem cells respectively, to obtain umbilical cord mesenchymal stem cells that can secrete a large amount of ultra-high molecular weight hyaluronic acid (molecular weight greater than 6MDa), and to lay a foundation for the further application of this method in anti-inflammatory cell therapy of clinical diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a carrier capable of sustainably secreting ultrahigh molecular weight hyaluronic acid, umbilical cord mesenchymal stem cells, and a construction method and application thereof. Background Art

[0002] Hyaluronic acid (HA) is a linear mucopolysaccharide composed of glucuronic acid and N-acetylglucosamine as disaccharide units alternately connected. High molecular weight HA has significant anti-inflammatory ability, can participate in tissue repair and regeneration, inhibit angiogenesis, reduce the production of tumor necrosis factor-α, prostaglandin E2 and interleukin (IL) IL-1β, IL-6. The HA content in synovial fluid is high, and the HA concentration in young normal knee synovial fluid is 2-4 mg / mL. Extremely high-molecular-mass hyaluronan (EHMM-HA, molecular weight is about 6-7MDa) is distributed in the synovial fluid of healthy tissue joints, which has the function of inhibiting inflammatory cell activity and lubricating articular cartilage. Osteoarthritis (OA) is the most common arthritis disease in clinical practice, characterized by focal cartilage degeneration and loss, subchondral bone degeneration, new bone remodeling, synovial hypertrophy, capsule thickening and surrounding tissue changes. There are approximately 40 million people suffering from osteoarthritis in my country, among which knee osteoarthritis (KOA) is the main disease. With the aging of the population, the incidence of knee osteoarthritis is on the rise. Knee osteoarthritis causes chronic pain. When the condition worsens, patients experience deformities, loss of function, and physical disability in the knee joint, which seriously affects the quality of life of patients. The development of osteoarthritis exacerbates inflammation, and high-molecular-weight hyaluronic acid in the synovial fluid decomposes in large quantities, reducing the molecular weight, leading to increased wear on the cartilage surface, cartilage loss, and increased pain. At present, the clinical use of high-molecular-weight hyaluronic acid for intra-articular administration has shown significant effects on the treatment of severe KOA, and can provide an effective and safer method for relieving knee pain. In addition to arthritis, HA can also relieve inflammation in other parts of the body and is used in clinical treatment. High molecular weight hyaluronic acid is mainly used in cataract surgery, vitreoretinal surgery, etc. in ophthalmic clinical applications; high molecular weight hyaluronic acid also plays an active role in the treatment of periodontitis, relieving inflammation and promoting wound healing by inhibiting the inflammatory mediators produced by Porphyromonas gingivalis and inhibiting the expression of NF-kB as well as the ERK and P38 MAPK pathways. The main preparation methods of HA products used in clinical treatment include: animal tissue extraction, chemical synthesis and microbial fermentation.The animal tissue extraction method has great limitations on the source of raw materials, cross-contamination of animal origin, extremely low product extraction rate (only 1%), complex process procedures and high costs; the relative molecular mass of HA prepared by chemical synthesis varies greatly, the function is relatively weak, and although the quality is stable, the structure is not pure enough; fermentation extraction using bacteria containing hyaluronic acid synthase genes, although the process is simple, there is a difference in molecular weight distribution between the HA obtained by microbial fermentation and the HA of animal origin, and there are residual proteins, nucleic acids, toxins and heavy metals in the bacteria. The HA obtained by the above methods has the risk of clinical complications such as allergies, tissue necrosis and immune reactions in clinical applications.

[0003] In summary, the hyaluronic acid products currently used for anti-inflammatory treatment of clinical diseases, whether extracted from animal tissues, prepared by microorganisms or artificially synthesized, have problems such as large differences in HA structure and molecular weight distribution in the human body, cross contamination, and low yield. At present, there are no reports on humanized cell therapy that continuously secretes ultra-high molecular weight hyaluronic acid. Summary of the invention

[0004] The purpose of the present invention is to solve the defects of existing HA products such as heterogeneous contamination, large molecular weight differences and low yield, provide a carrier that can sustainably secrete ultra-high molecular weight hyaluronic acid, umbilical cord mesenchymal stem cells and their construction method and application in human umbilical cord mesenchymal stem cells, enrich the existing anti-inflammatory drug treatment regimen, and better solve the problem that ultra-high molecular weight hyaluronic acid cannot be sustainably secreted and expressed at the lesion. At the same time, the cartilage differentiation potential of umbilical cord mesenchymal stem cells can promote the repair of damaged cartilage.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] A vector capable of continuously secreting ultra-high molecular weight hyaluronic acid, the vector comprising a CMV promoter, the sequence of the CMV promoter being shown in SEQ ID NO: 1, and the vector further comprising a human HAS2 gene or a naked mole rat Has2 gene;

[0007] The sequence of the human HAS2 gene is shown as SEQ ID NO: 2, or a nucleotide sequence obtained by replacing one or more nucleotides in SEQ ID NO: 2; the sequence of the naked mole rat Has2 gene is shown as SEQ ID NO: 3, or a nucleotide sequence obtained by replacing one or more nucleotides in SEQ ID NO: 3.

[0008] In the present invention, after the human HAS2 gene or naked mole-rat Has2 gene recombinant plasmid vector is used to infect umbilical cord mesenchymal stem cells respectively, umbilical cord mesenchymal stem cells overexpressing human HAS2 or naked mole-rat Has2 protein are obtained, that is, umbilical cord mesenchymal stem cells modified with the human HAS2 gene or naked mole-rat Has2 gene are obtained.

[0009] Preferably, the umbilical cord mesenchymal stem cells modified with the human HAS2 gene or the naked mole rat Has2 gene are prepared by the following method:

[0010] (1) constructing a recombinant plasmid vector of human HAS2 gene or naked mole rat Has2 gene;

[0011] (2) Infecting umbilical cord mesenchymal stem cells with the human HAS2 gene or naked mole-rat Has2 gene recombinant plasmid vector respectively to obtain umbilical cord mesenchymal stem cells modified with the human HAS2 gene or naked mole-rat Has2 gene.

[0012] Preferably, the human HAS2 gene or naked mole-rat Has2 gene recombinant plasmid vector is a lentiviral vector.

[0013] More preferably, the lentiviral vector is a pLVSIN-CMV plasmid.

[0014] Preferably, the packaging plasmid of the lentiviral vector is a gag-pol plasmid, and the envelope plasmid of the lentiviral vector is a VSV-G plasmid.

[0015] Preferably, the method for preparing umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene is as follows:

[0016] (1) taking the pLVSIN-CMV plasmid, the PCR product of the human HAS2 gene or the naked mole-rat Has2 gene, performing double restriction digestion with XhoI / BamHI, purifying and recovering, and then cloning the human HAS2 gene or the naked mole-rat Has2 gene fragment into the double-restriction pLVSIN-CMV vector to obtain the recombinant human pLVSIN-CMV-HAS2 or naked mole-rat pLVSIN-CMV-Has2 plasmid;

[0017] (2) The target plasmid pLVSIN-CMV-HAS2 or pLVSIN-CMV-Has2, packaging plasmid gag-pol and envelope plasmid VSV-G are used to infect umbilical cord mesenchymal stem cells cultured to the P3 generation to obtain umbilical cord mesenchymal stem cells modified with the human HAS2 gene or the naked mole rat Has2 gene.

[0018] The present invention also provides a drug, comprising: umbilical cord mesenchymal stem cells modified by the above-mentioned human HAS2 gene or naked mole rat Has2 gene; or ultra-high molecular weight hyaluronic acid secreted by umbilical cord mesenchymal stem cells modified by the above-mentioned human HAS2 gene or naked mole rat Has2 gene obtained by the above-mentioned preparation method.

[0019] Preferably, the ultra-high molecular weight hyaluronic acid secreted by umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene is prepared by the following method:

[0020] (1) constructing a recombinant plasmid vector of human HAS2 gene or naked mole rat Has2 gene;

[0021] (2) infecting umbilical cord mesenchymal stem cells with the human HAS2 gene or naked mole-rat Has2 gene recombinant plasmid vector respectively to obtain umbilical cord mesenchymal stem cells modified with the human HAS2 gene or naked mole-rat Has2 gene;

[0022] (3) collecting the culture medium of umbilical cord mesenchymal stem cells modified with the human HAS2 gene or naked mole rat Has2 gene after culturing for 15 days;

[0023] (4) using anhydrous ethanol precipitation method, adding 15 ml of anhydrous ethanol to 10 ml of cell culture supernatant to obtain a precipitate, and the collected precipitate was freeze-dried to obtain hyaluronic acid powder;

[0024] (5) dissolving hyaluronic acid using 1*TE buffer to obtain a hyaluronic acid solution of a certain concentration;

[0025] (6) Pulse-electrophoresis technology was used to identify that the molecular weight of hyaluronic acid secreted by umbilical cord mesenchymal stem cells overexpressing the human HAS2 gene was greater than 6 MDa; the molecular weight of hyaluronic acid secreted by umbilical cord mesenchymal stem cells overexpressing the naked mole-rat Has2 gene was greater than 6 MDa.

[0026] The above-mentioned drugs are preferably clinical anti-inflammatory drugs.

[0027] The present invention provides umbilical cord mesenchymal stem cells modified by human HAS2 gene or naked mole rat Has2 gene. It can be seen from experimental data that umbilical cord mesenchymal stem cells modified by human HAS2 gene or naked mole rat Has2 gene can continuously secrete ultra-high molecular weight hyaluronic acid compared with control group cells. This ultra-high molecular weight hyaluronic acid has been proven to have high anti-inflammatory ability, can reduce the release of inflammatory factors, and protect cell vitality. At the same time, umbilical cord mesenchymal stem cells have cartilage differentiation potential and promote the repair of damaged cartilage. This method has not been reported at home and abroad, and the present invention provides technical support for the development of clinical anti-inflammatory therapeutic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0029] Figure 1 A diagram of a carrier for constructing umbilical cord mesenchymal stem cells capable of sustainably secreting ultra-high molecular weight hyaluronic acid provided in Example 1 of the present invention;

[0030] Figure 2 The agarose gel electrophoresis diagram of the human HAS2 gene or naked mole rat Has2 gene provided in Example 1 of the present invention;

[0031] Figure 3 The double restriction enzyme electrophoresis diagram of the recombinant human pLVSIN-CMV-HAS2 and naked mole rat pLVSIN-CMV-Has2 plasmids provided in Example 1 of the present invention;

[0032] Figure 4 This is a microscopic image of umbilical cord mesenchymal stem cells of the P3 generation modified with the human HAS2 gene or the naked mole rat Has2 gene provided in Example 2 of the present invention;

[0033] Figure 5 A histogram of HAS2 gene expression in umbilical cord mesenchymal stem cells modified with the human HAS2 gene or the naked mole rat Has2 gene detected by the RT-PCR technology provided in Example 1 of the present invention;

[0034] Figure 6 The electrophoretic diagram of the expression of human HAS2 or naked mole rat Has2 protein in umbilical cord mesenchymal stem cells detected by the Western blot technology provided in Example 2 of the present invention;

[0035] Figure 7 Fluorescence microscopic imaging of the expression of human HAS2 or naked mole rat Has2 protein and hyaluronan binding protein (HABP) in umbilical cord mesenchymal stem cells detected by the immunofluorescence technique provided in Example 2 of the present invention;

[0036] Figure 8 This is a pulsed electrophoresis diagram of ultra-high molecular weight hyaluronic acid secreted by umbilical cord mesenchymal stem cells detected by the pulsed electrophoresis technology provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0037] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. It should be noted that the content of the present invention includes but is not limited to the following embodiments and their combined implementation methods. Based on the embodiments of the present invention, other embodiments obtained by ordinary technicians in this field without making creative work are all within the scope of protection of the present invention.

[0038] If no specific techniques or conditions are specified in the examples of the present invention, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be obtained through commercial purchase or other channels.

[0039] Example 1: Construction of recombinant plasmid

[0040] 1. The vector used is pLVSIN-CMV, such as Figure 1 As shown. The naked mole rat Has2 gene cDNA sequence was synthesized at BGI, with a length of 1659bp; the preparation steps of the human HAS2 gene cDNA sequence include: extracting RNA. According to the operating instructions of the Takara RTMaster Mix reverse transcription kit, 500ng of total RNA was taken for reverse transcription, the reaction system was 10μl, the reaction conditions were 37℃, 15min; 85℃, 15s; the reaction product was stored at -20℃ for later use. The reaction system is as follows: Template RNA 1μl, RTenzyme Master Mix 2μl, DEPC ddH2O 7μl.

[0041] The primers of human HAS2 gene Forward: 5'-TCGACTCGAGATGCATTGTGAGAGGTTTCTAT-3', Reverse: 5'-TCGAGGATCCTCATACATCAAGCACCATGTC-3' were used; the cDNA of human HAS2 gene obtained in step 1 was used as a template for conventional PCR amplification. The 50μl reaction system contained 25μl of premix Extaq, 50pmol / L of upstream and downstream primers, 0.1μg of cDNA template, and water was added to 50μl. The reaction was carried out according to the following procedure: pre-denaturation at 94℃ for 3min, denaturation at 94℃ for 30s, annealing at 60℃ for 30s, extension at 72℃ for 30s, 30 cycles, and extension at 72℃ for 5min. Identification by 1% agarose gel electrophoresis.

[0042] 2. Take 1 μg of pLVSIN-CMV plasmid, cDNA amplification product of human HAS2 gene or cDNA fragment of naked mole rat Has2 gene, and perform double restriction digestion with XhoI / BamHI. After purification and recovery, clone the human HAS2 gene or naked mole rat Has2 gene fragment into the double-restricted pLVSIN-CMV vector to obtain recombinant human pLVSIN-CMV-HAS2 plasmid or naked mole rat pLVSIN-CMV-Has2 plasmid. After double restriction digestion verification and sequencing identification, it is used for lentiviral packaging.

[0043] like Figure 2 As shown, the length of the PCR product of the amplified human HAS2 gene is about 1659 bp, which is consistent with the length of the human HAS2 gene; the length of the synthesized cDNA of the naked mole rat Has2 gene is about 1659 bp, which is consistent with the length of the naked mole rat Has2 gene;

[0044] like Figure 3As shown, the size of the recombinant human pLVSIN-CMV-HAS2 plasmid is about 1659 bp longer than that of pLVSIN-CMV, indicating that the human HAS2 gene has been integrated into the pLVSIN-CMV plasmid; the size of the naked mole-rat pLVSIN-CMV-Has2 plasmid is about 1659 bp longer than that of pLVSIN-CMV, indicating that the naked mole-rat Has2 gene has been integrated into the pLVSIN-CMV plasmid.

[0045] Example 2: Construction of umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene

[0046] 1. Take 2×10 HEK-293T cells in logarithmic growth phase 6 Inoculate in a 100mm cell culture dish, and replace with 10ml fresh DMEM complete medium when the cell confluence reaches 80%-90% after 24h. Mix the target plasmid human pLVSIN-CMV-HAS2 or naked mole rat pLVSIN-CMV-Has2 10μg, packaging plasmid gag-pol 9μg and envelope plasmid VSV-G 1μg with CaCl250μL, and drop into the HEK-293T cells after the medium change and mix gently for lentivirus packaging. Collect the virus solution after 48 hours and 72 hours of packaging, concentrate and store at -80℃ for later use.

[0047] 2. Take P3 umbilical cord mesenchymal stem cells at 2×10 per bottle. 5 The cells were inoculated in a T25 culture flask. When the cells grew and merged to 40-60%, the umbilical cord mesenchymal stem cells were infected with a virus titer of MOI=60IU / ml, and polybrene was added. The final concentration of the polybrene was: 1μg / ml~10μg / ml. After 12 hours, the virus solution was removed and replaced with fresh culture medium, and cultured for 36 hours. Polybrene can promote virus infection of cells and improve infection efficiency. The RNA and protein of umbilical cord mesenchymal stem cells in the infection group and the control group were extracted, and the expression of human HAS2 or naked mole rat Has2 at the gene level and protein level was detected by RT-PCR and Western blot technology.

[0048] like Figure 4 As shown, the morphology of P3 umbilical cord mesenchymal stem cells is long spindle-shaped, similar to fibroblasts.

[0049] like Figure 5 and Figure 6 As shown, the expression levels of human HAS2 or naked mole-rat Has2 at the gene level and protein level in umbilical cord mesenchymal stem cells infected with the human HAS2 gene or naked mole-rat Has2 gene mediated by lentivirus were significantly higher than those in the umbilical cord mesenchymal stem cells of the control group.

[0050] like Figure 7 As shown, hyaluronan binding protein (HABP) can bind to HA in cells and can indirectly analyze changes in the content of HA in cells. Through the protein expression analysis of HABP, it was found that compared with the control group, the expression of HABP protein in cells overexpressing human HAS2 or naked mole-rat Has2 gene was significantly upregulated, indicating that the intracellular HA content was significantly increased. At the same time, compared with the control group, the expression of human or naked mole-rat Has2 protein was significantly upregulated. The above results show that the infected human HAS2 or naked mole-rat Has2 gene was successfully overexpressed in umbilical cord mesenchymal stem cells, and umbilical cord mesenchymal stem cells overexpressing human HAS2 or naked mole-rat Has2 gene can synthesize a large amount of HA.

[0051] Example 3: Identification of ultra-high molecular weight hyaluronic acid secreted by umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene

[0052] 1. Collect the culture medium of umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene after culturing for 15 days. Centrifuge at 300g for 10 minutes and then at 3000g for 15 minutes to remove cells and cell debris in the culture medium supernatant;

[0053] 2. Using the anhydrous ethanol precipitation method, 15 ml of anhydrous ethanol was added to 10 ml of cell culture supernatant to obtain a precipitate, and the collected precipitate was freeze-dried to obtain hyaluronic acid powder;

[0054] 3. Use 1*TE buffer to dissolve hyaluronic acid to obtain a hyaluronic acid solution;

[0055] 4. The molecular weight of hyaluronic acid was identified by pulsed electrophoresis technology. The specific steps included: preparing 0.4% gold gel; adding 5 μL of 4 mol / L sucrose buffer to 25 μL of sample, mixing and spotting into the gel wells, and spotting 10 μL of hyaluronic acid marker into the gel wells; running the gel at 4°C, 75V overnight; gel staining: placing the gel after electrophoresis in 0.005% (w / v) Stains-All and staining overnight in the dark; destaining: placing the gel in deionized water for 48 hours, avoiding light, and then placing it under white light at room temperature for 4 hours; photographing and imaging under white light.

[0056] like Figure 8 As shown, the cell culture medium of umbilical cord mesenchymal stem cells modified with the human HAS2 gene or the naked mole-rat Has2 gene after 15 days of culture was collected and tested, and it was found that the ultra-high molecular weight hyaluronic acid secreted by the umbilical cord mesenchymal stem cells modified with the human HAS2 gene had a molecular weight greater than 6 MDa; the ultra-high molecular weight hyaluronic acid secreted by the umbilical cord mesenchymal stem cells modified with the naked mole-rat Has2 gene had a molecular weight greater than 6 MDa, indicating that the umbilical cord mesenchymal stem cells modified with the human HAS2 gene or the naked mole-rat Has2 gene can continuously secrete ultra-high molecular weight hyaluronic acid.

[0057] The above-mentioned embodiments only express several implementation modes of the present invention, and the description thereof is relatively specific and detailed, but it should not be understood as limiting the patent scope of the present invention. It should be pointed out that, for those skilled in the art, without departing from the concept of the present invention, several modifications and improvements can be made, for example: using lentivirus, retrovirus, transposon construction vectors such as pCDH, pLVX, PHR-SIN-CSGW, pWPXL, pLVSO2; and using umbilical blood mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose tissue mesenchymal stem cells, placental chorionic membrane mesenchymal stem cells, dental pulp mesenchymal stem cells, embryonic stem cells, induced pluripotent stem cells, neural stem cells, muscle stem cells, epidermal stem cells, hematopoietic stem cells. cells) as cells modified with human HAS2 or naked mole rat Has2 genes, all of which belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

[0058] Sequence Listing

[0059] SEQ ID NO: 1

[0060] GTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT

[0061] SEQ ID NO:2

[0062]

[0063] SEQ ID NO:3

[0064]

Claims

1. A method for constructing umbilical cord mesenchymal stem cells that can continuously secrete ultra-high molecular weight hyaluronic acid, characterized in that: The umbilical cord mesenchymal stem cells contain human pLVSIN-CMV-HAS2 or naked mole rat pLVSIN-CMV-Has2 plasmid vectors that can sustainably secrete ultra-high molecular weight hyaluronic acid; the umbilical cord mesenchymal stem cells that can sustainably secrete ultra-high molecular weight hyaluronic acid are umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene; The vector includes a CMV promoter, the sequence of which is shown in SEQ ID NO: 1, and the vector also includes a human HAS2 gene or a naked mole rat Has2 gene; The sequence of the human HAS2 gene is shown in SEQ ID NO: 2; the sequence of the naked mole rat Has2 gene is shown in SEQ ID NO: 3; The method is: Step 1: construct a viral shuttle vector pLVSIN-CMV-HAS2 or pLVSIN-CMV-Has2 that can sustainably secrete ultra-high molecular weight hyaluronic acid; co-transfect the viral shuttle vector with the packaging vector gag-pol and VSV-G into viral packaging tool cells to obtain a lentivirus that overexpresses human HAS2 or naked mole rat Has2; Step 2: Infect P3 umbilical cord mesenchymal stem cells with the lentivirus of step 1 at a virus titer of MOI=60IU / ml, add polybrene, the final concentration of the polybrene is: 1μg / ml~10μg / ml, remove the virus solution after 12 hours, replace it with fresh culture medium, and continue to culture for 36 hours to obtain umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene.

2. The method for constructing umbilical cord mesenchymal stem cells capable of sustainably secreting ultra-high molecular weight hyaluronic acid according to claim 1, characterized in that: The construction method of the vector is: Step 1: amplify the human HAS2 gene sequence or synthesize the naked mole-rat Has2 gene, and clone it into the pLVSIN plasmid containing the CMV promoter to obtain the human pLVSIN-CMV-HAS2 or naked mole-rat pLVSIN-CMV-Has2 recombinant plasmid; Step 2: Using the human pLVSIN-CMV-HAS2 or naked mole-rat pLVSIN-CMV-Has2 recombinant plasmid obtained in step 1 as a template, transform the plasmid into the Stable3 competent state, amplify it, and shake the bacteria at 37°C for 12-14 hours to obtain the human pLVSIN-CMV-HAS2 or naked mole-rat pLVSIN-CMV-Has2 plasmid vector that can continuously secrete ultra-high molecular weight hyaluronic acid.

3. The method for constructing umbilical cord mesenchymal stem cells capable of sustainably secreting ultra-high molecular weight hyaluronic acid according to claim 2, characterized in that: In step 1, pCDH, pLVX, PHR-SIN-CSGW, and pWPXL can also be used as construction vectors.

4. The method for constructing umbilical cord mesenchymal stem cells capable of sustainably secreting ultra-high molecular weight hyaluronic acid according to claim 1, characterized in that: Human HAS2 gene-modified umbilical cord mesenchymal stem cells that can sustainably secrete ultra-high molecular weight hyaluronic acid refer to cells that can detectably continuously secrete hyaluronic acid with a molecular weight greater than 6 MDa during the cell growth cycle; naked mole rat Has2 gene-modified umbilical cord mesenchymal stem cells that can sustainably secrete ultra-high molecular weight hyaluronic acid refer to cells that can detectably continuously secrete hyaluronic acid with a molecular weight greater than 6 MDa during the cell growth cycle.

5. Use of umbilical cord mesenchymal stem cells capable of sustainably secreting ultra-high molecular weight hyaluronic acid constructed by the construction method according to any one of claims 1 to 4, characterized in that: The ultra-high molecular weight hyaluronic acid secreted by umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene is prepared by the following method: (1) Constructing a recombinant plasmid vector of human HAS2 gene or naked mole rat Has2 gene; (2) infecting umbilical cord mesenchymal stem cells with the human HAS2 gene or naked mole-rat Has2 gene recombinant plasmid vector respectively to obtain umbilical cord mesenchymal stem cells modified with the human HAS2 gene or naked mole-rat Has2 gene; (3) Collecting the culture medium of umbilical cord mesenchymal stem cells modified with human HAS2 gene or naked mole rat Has2 gene after culturing for 15 days; (4) Using anhydrous ethanol precipitation method, 15 ml of anhydrous ethanol was added to 10 ml of cell culture supernatant to obtain a precipitate, and the collected precipitate was freeze-dried to obtain hyaluronic acid powder; (5) Dissolving hyaluronic acid using 1*TE buffer to obtain a hyaluronic acid solution of a certain concentration; (6) Pulse-electrophoresis technology was used to identify that the molecular weight of hyaluronic acid secreted by umbilical cord mesenchymal stem cells overexpressing the human HAS2 gene was greater than 6 MDa; the molecular weight of hyaluronic acid secreted by umbilical cord mesenchymal stem cells overexpressing the naked mole rat Has2 gene was greater than 6 MDa; The use described is not for diagnostic or therapeutic purposes.

6. A medicine, characterized in that: The invention comprises umbilical cord mesenchymal stem cells modified by overexpressing human HAS2 or naked mole rat Has2 gene as described in any one of claims 1 to 4.

Images