Trichothecene synthase pathogenicity gene IrTri01 and its application

Abstract

The present invention discloses a trichothecene synthase pathogenic gene IrTri01 and its application. The only gene of the trichothecene synthase gene family is screened out in the CBLJ‑3 genome and named IrTri01. The gene is successfully knocked out in CBLJ‑3 by CRISPR / Cas9 technology and PEG-mediated genetic transformation. ΔIrTri01 produces less pigment and more white aerial hyphae than the wild type (WT) on RBCA. The results of pathogenicity determination show that the pathogenicity of ΔIrTri01 is significantly less than that of WT, and IrTri01 positively regulates the pathogenicity of I. robusta to ginseng; the deletion leads to a decrease in the toxicity of I. robusta crude toxin, and trichothecene toxins are virulence factors of I. robusta. Bacillus amyloliquefaciens FG14 strain can inhibit the expression of IrTri01.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a trichothecene synthase pathogenic gene IrTri01 and an application thereof. Background Art

[0002] Ginseng (Panax ginseng) is a perennial medicinal plant of the Araliaceae family. It has extremely high medicinal and economic value and is a traditional precious Chinese medicine.

[0003] Ilyonectria species are common soil fungi, opportunistic plant root pathogens or asymptomatic root endophytes. Ilyonectria fungi can cause grape blackleg, apple replant disease and beech canker, etc. Most of the affected plants are representative hosts of economic importance, especially the lignified roots of perennial plants. Therefore, Ilyonectria and Ilyonectria-like species are often associated with decay and decay of woody and herbaceous plants. Ginseng rust caused by Ilyonectria robusta was first reported in China in 2015. After infection by ginseng rust, the roots of ginseng showed reddish-brown dry rot, and most of the roots showed grooves. A study of a large number of ginseng rust samples found that I. robusta was the main dominant species of ginseng rust. In addition, the pathogenicity of ginseng rust is related to the difference in pathogenicity between strains. There are many differences between strong and weak strains in morphology, optimal growth temperature, enzyme activity and genetic map, which are believed to be related to the observed differences in pathogenicity. Summary of the invention

[0004] The purpose of the present invention is to solve the above problems and provide a trichothecene synthase pathogenicity gene IrTri01 and a CRISPR / Cas9 knockout vector.

[0005] The trichothecene synthase pathogenicity gene IrTri01, its base sequence is shown in the sequence listing SEQ ID NO.1.

[0006] A CRISPR / Cas9 knockout vector, wherein the sgRNA includes TRI5-sgRNA-0, TRI5-sgRNA-1 and / or TRI5-sgRNA-2;

[0007] TRI5-sgRNA-0: CAACCGAATAACCTTCTCGA;

[0008] TRI5-sgRNA-1:ACTTGTTGGAGCGACACGAT;

[0009] TRI5-sgRNA-2:AACGTCGGGGATAGAGCGCTT.

[0010] Left homology arm fragment:

[0011] F:GACGACGATCTTGTCGGT;

[0012] R: CGACCGGGAACCAGTTATCCTACGTAGTAGCACTAAGGCT;

[0013] Hygromycin fragment:

[0014] F: AGCCTTAGTGCTACTACGTAGGATAACTGGTTCCCGGTCG;

[0015] R: GCCAGTAGAATAATGAATGTAGCCTTTGGTTTAGTCGTCAGGC;

[0016] Right homology arm fragment:

[0017] F: GCCTGACGACTAAACCAAAGGCTACATTCATTATTCTACTGGC;

[0018] R: GAGAGCTCTGGGTGTACAC.

[0019] The present invention provides a trichodiene synthase pathogenic gene IrTri01. The inventor screened out the only gene of the trichodiene synthase gene family in the CBLJ-3 genome and named it IrTri01. The gene was successfully knocked out in CBLJ-3 by CRISPR / Cas9 technology and PEG-mediated genetic transformation. On PDA, CDA, and SNA culture media, the mycelial growth rate of ΔIrTri01 was higher than that of CBLJ-3, but similar to that of EDBH-2; on RBCA, ΔIrTri01 produced less pigment and more white aerial mycelium than the wild type (WT). The results of pathogenicity assay showed that the pathogenicity of ΔIrTri01 was significantly less than that of WT, proving that IrTri01 positively regulated the pathogenicity of I. robusta to ginseng. Since IrTri01 is the only gene of the trichothecenes synthase gene family in CBLJ-3, the deletion of IrTri01 can cut off the synthesis pathway of trichothecenes in CBLJ-3, and the degree of decay caused by ΔIrTri01 crude toxin on ginseng is significantly weaker than that of CBLJ-3. This proves that the deletion of IrTri01 leads to the reduction of the toxicity of I. robusta crude toxin and trichothecenes are the virulence factors of I. robusta. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 , I. robusta IH and I. robusta IL pathogenicity determination. A: Mycelial inoculation. B: Spore solution (2.25×105 spores / ml) inoculation. C: Crude toxin inoculation;

[0021] CK: sterile PDA inoculation or sterile water treatment; IH: I. robusta IH strain; IL: I. robusta IL strain; _7d / _9d: crude toxin inoculation prepared by culturing in PDB for 7d / 9d;

[0022] Figure 2 , A. Mycelial growth rate; B. Spore production determination; C. Spore germination rate;

[0023] Figure 3 , Real-time fluorescence quantitative PCR detection of IH and IL content;

[0024] Figure 4 , IH and IL CAZymes gene numbers. CBMs: genes of carbohydrate-related modules; CEs: carbohydrate esterase genes; GHs: glycoside hydrolase genes; GTs: glycosyltransferase genes; PLs: polysaccharide lyase genes; AAs: oxidoreductase genes;

[0025] Figure 5 , A. Venn diagram of IH secretory proteins and CAZymes overlapping with PHI genes; B. Venn diagram of IL secretory proteins and CAZymes overlapping with PHI genes;

[0026] Figure 6 , IH and IL genome colinearity analysis. The yellow box represents the forward strand of the genome, the blue box represents the reverse strand of the genome, and the height of the filled color in the box represents the similarity of the alignment. The color of the line indicates the alignment type: Colinearity: colinearity; Translocation: translocation; Inversion: inversion; Tran+Inver: translocation and inversion;

[0027] Figure 7 , Gene family expansion and contraction. Circles and their associated numbers indicate the expansion / contraction of the number of gene families;

[0028] Figure 8 , IH-IL gene family clustering;

[0029] Fig. 9 , 3 Comparison of fusaric acid biosynthesis gene clusters between Ilyonectria strains and reference strains;

[0030] Fig.10 ,3 Comparison of Fusarin A biosynthesis gene clusters between Ilyonectria strains and reference strains;

[0031] Fig.11 , Correlation analysis of each sample;

[0032] Fig.12 , DEGs statistics between different control groups. FDR and log2FC were used to screen FDR < 0.05 and |log2FC| >1;

[0033] Fig.13 A. Clustering of gene expression trends at three time points (0d-4d-7d) during IH (upper part) / IL (lower part) infection of ginseng; colors represent significantly enriched modules, and the same color represents similar gene expression trends in the modules; the numbers below the modules represent the number of genes enriched in the trend; B. GO enrichment analysis of genes in trend 6 of IH strain trend analysis; C. GO enrichment analysis of genes in trend 6 of IL strain trend analysis;

[0034] Fig.14 , GO enrichment analysis of upregulated DEGs in IH4dvsIL4d;

[0035] Fig.15 , Correlation analysis between IH and IL samples and each module based on WGCNA; the number in each square is the correlation between the module and the sample, the number in the bracket is the significant P value, and the color represents the expression level;

[0036] Fig.16 , heat map of correlation coefficients between modules and traits;

[0037] Fig.17 , arkred module gene expression pattern; the heat map is the expression level of genes in the module, red is high expression, green is low expression; the bar graph is the expression pattern of the module feature value in different samples;

[0038] Fig.18 , the co-expression relationship of genes with weight greater than 0.15 in the darkred module; the larger the kWithin value, the larger the gene circle. The red circle represents the 5 genes with kWithin values ​​in the TOP1-5, and the orange circle represents the 5 genes with kWithin values ​​in the TOP6-10.

[0039] Fig.19 , the relative expression trends of 7 genes in 2 strains during pure culture (0dpi) and infection with ginseng (2dpi 4dpi 6dpi 7dpi) and qPCR-verified transcriptome data;

[0040] Fig. 20 ,The plot generated by principal component analysis (PCA) showed that the metabolomics of IH and IL strains were repeatedly clustered in different groups;

[0041] Fig.21 , KEGG enrichment analysis of differential metabolites of IHvsIL neg.

[0042] Fig. 22 Southern blot verification of the probe selection used; the upper part is the wild type (5000 bp + gene + 5000 bp), and the lower part is the mutant (5000 bp + hygromycin resistance gene + 5000 bp);

[0043] Fig.23 Phylogenetic analysis and motif analysis of trichodiene synthase in IrTri01 and other species; the conserved catalytic motifs of trichodiene synthase in each strain are represented by different color blocks;

[0044] Fig.24 A. Electrophoresis of the 900 bp fragment upstream of the target gene (fragment A), the hygromycin resistance fragment (fragment B), and the 900 bp fragment downstream of the target gene (fragment C) after amplification. B. Electrophoresis of the fragments A, B, and C after they were connected to form homologous resistance fragments. C. Sequencing verification of knockout vector. D. PCR identification of positive transformants. E. qRT-PCR verification of positive transformants.

[0045] Fig.25 Southern blot images. WT: wild type; T-12 / T-15 / T-22: mutants.

[0046] Fig.26 A. Mycelial growth rate of the four strains on PDA, SNA, CDA and RBCA; B. Spore production determination; C. Spore germination rate; D. Colony morphology of the four strains after 7 days of culture on RBCA.

[0047] Fig. 27 , 4 The symptoms caused by inoculating ginseng with mycelium, spore fluid and crude toxin of each strain;

[0048] Fig.28 , the relative expression level of IrTri01 after treatment with biocontrol bacteria and chemical agents. DETAILED DESCRIPTION

[0049] Materials used in the present invention:

[0050] Strains:

[0051] Ginseng rust pathogen (Ilyonectria robusta) CBLJ-3 strain (IH) and EDBH-2 strain (IL) were collected, isolated and purified by the College of Plant Protection, Jilin Agricultural University, and stored at –20 ℃.

[0052] "Genome and interactive transcriptome analysis of ginseng rust pathogen Ilyonectria robusta and establishment of transformation system", Master's electronic journal publication information: Year and issue: 2023 Issue 02.

[0053] Bacillus methylotrophicus NJ13 strain, strain accession number: CGMCC No.6679;

[0054] Bacillus amyloliquefaciens FG14 strain, ("Preparation of Bacillus amyloliquefaciens FG14 wettable powder and its field control of ginseng rust disease", Journal of Jilin Agricultural University. 2020, 42(04));

[0055] Bacillus velezensis NT35 strain, (Master's thesis "Study on the preventive and therapeutic effects of Bacillus velezensis NT35 strain on ginseng rust disease", Wang Jiarui, Jilin Agricultural University).

[0056] Culture medium:

[0057] PDA: 200 g potatoes, 20 g glucose, 20 g agar, 1 L distilled water;

[0058] SNA: agar 15 g, sucrose 0.2 g, glucose 0.2 g, potassium nitrate 1.0 g, potassium dihydrogen phosphate 1.0 g, potassium chloride 0.5 g, magnesium sulfate heptahydrate 0.5 g, distilled water 1 L;

[0059] CDA: 30 g sucrose, 15 g agar, 1 g potassium dihydrogen phosphate, 3 g sodium nitrate, 0.01 g ferrous sulfate, 0.5 g potassium chloride, 0.5 g magnesium sulfate, 1 L distilled water;

[0060] WA: agar 15 g, distilled water 1 L;

[0061] CMA: 40 g corn flour, 15 g agar, 1 L distilled water;

[0062] PDB: 200 g potatoes, 20 g glucose, 1 L distilled water.

[0063] TB3 medium: 3 g yeast powder, 3 g acid hydrolyzed casein, 200 g sucrose, add water to 1000 mL;

[0064] STC buffer: sucrose 100 g, 0.5 M Tris-Cl (PH8.0) 50 mL, CaCl2•2H2O 3.6755 g, add pure water to 500 mL;

[0065] PTC: PEG8000 40 g, add STC solution to 100 mL;

[0066] 0.7 M NaCl solution: 40.09 g NaCl solid, add water to 1 L and stir to fully dissolve;

[0067] Protoplast buffer: 0.1 g of lysozyme, 0.1 g of wall-lytic enzyme, 0.3 g of snail enzyme, and 0.2 g of cellulase were dissolved in 10 mL of 0.7 M NaCL, shaken at room temperature for 30 min to fully dissolve, centrifuged at 3500 rpm for 6 min, and the supernatant was aspirated to lyse protoplasts;

[0068] Bottom Agar and Top Agar: 3 g yeast powder, 3 g acid hydrolyzed casein, 200 g sucrose, add water to 1L, add 10 g and 15 g agar to Bottom Agar and Top Agar respectively.

[0069] Example 1 Pathogenicity determination of CBLJ-3 and EDBH-2

[0070] Surface disinfection of in vitro inoculated ginseng: Take healthy ginseng and wash it with clean water, wipe the surface of ginseng once with 2% sodium hypochlorite solution and wipe the surface of ginseng twice with 5% alcohol for surface disinfection, wipe the surface disinfected ginseng twice with sterile water, and dry the water in a sterile environment. Take the dried ginseng and make wounds on the ginseng with a hole puncher, 4 to 5 wounds per ginseng, and each wound is 6 mm deep, for subsequent in vitro inoculation experiments.

[0071] 1. Determination of mycelial pathogenicity

[0072] The strain was pure cultured with PDA. After culturing in a 25°C incubator for 7 days, a 6-mm diameter mycelium cake was taken from the edge of the colony with a cork puncher and inoculated on the treated ginseng wound. The mycelium cake was cultured in a sterile environment for 9 days (the mycelium cake was removed at 1 dpi). Sterile PDA was set as a blank control. After 9 days, the mycelium was cut open for observation and record.

[0073] The results showed that ginseng inoculated with CBLJ-3 mycelium had a more obvious red rust color 1 day after inoculation than that inoculated with EDBH-2; in the middle stage of infection, CBLJ-3 caused more obvious lesions on the ginseng epidermis; at 9 dpi, CBLJ-3 caused a larger area of ​​rot in the internal tissue of ginseng ( Figure 1 A).

[0074] 2. Determination of pathogenicity of spore fluid

[0075] Take a 6 mm mycelium cake of the strain that has been cultured at 25 ℃ for more than 7 days on a PDA plate, inoculate 8 mycelium cakes per bottle (100mL) of PDB, and culture at 25 ℃ and 120 r / min with shaking. Take the culture solution of 7 days and 9 days, respectively, and filter the spore liquid obtained after removing the mycelium through 8 layers of gauze. Drop 10 μL of the spore liquid into each well of the treated ginseng, and set sterile water as a blank control. Place the ginseng roots inoculated with the spore liquid in a sterile environment at 25 ℃ for 9 days, and cut them open for observation and record after 9 days.

[0076] The results showed that: at the early stage of inoculation with spore suspension, there were no obvious symptoms on the surface of ginseng. At 5 dpi, the surface of ginseng inoculated with CBLJ-3 showed obvious discoloration and decay, while the surface of ginseng inoculated with EDBH-2 showed no obvious symptoms. At 9 dpi, CBLJ-3 caused a large area of ​​ginseng to decay, while EDBH-2 caused a small area of ​​ginseng to change color and decay slightly ( Figure 1 B).

[0077] 3. Determination of pathogenicity of crude toxin

[0078] Take a 6 mm mycelium cake of the strain that has been cultured at 25 ℃ for more than 7 days on a PDA plate, inoculate 8 mycelium cakes per bottle (100 mL) of PDB, and culture at 25 ℃ and 120 r / min. Take the culture solution of 7 days and 9 days respectively, filter it with 8 layers of gauze to remove the mycelium to obtain the culture solution, and filter it with a 0.22 μm sterile filter membrane twice to remove the spores to obtain the crude toxin liquid. Drop 10 μL of the crude toxin liquid into the treated ginseng in each well, repeat the dripping 3 times in each well, and set sterile water as the blank control. Place the ginseng inoculated with crude toxin in a sterile environment at 25 ℃ for 9 days, and cut it open for observation and record after 9 days.

[0079] The results show that: Figure 1C shows that the crude toxins prepared by CBLJ-3 and EDBH-2 after culturing for 7 d and 9 d, respectively, had no obvious symptoms on the surface of ginseng, while among the crude toxins prepared by CBLJ-3 and EDBH-2 after culturing for 7 d and 9 d at 9 dpi, CBLJ-3 caused more obvious discoloration and decay of the internal tissues of ginseng than EDBH-2; compared with the crude toxin prepared by CBLJ-3 after culturing for 9 d, the crude toxin after culturing for 7 d can cause discoloration and decay of a larger area of ​​ginseng.

[0080] 4. Fluorescence quantitative PCR detection of strain content

[0081] Quantitative analysis samples: After inoculation of spore suspension, 4 samples (from ginseng diseased parts) were collected from each treatment at 5 dpi, 7 dpi, and 9 dpi. The analysis method was described in Jiang (JIANG Y, JIN H, LI X, et al. Development of a novel real-time quantitative PCR method for detection of Ilyonectria robusta, the predominant species causing ginseng rusty root rot [J]. Plant Disease, 2023, 107(6): 1680-9.)

[0082] The results showed that: as shown in Tables 1 and 2, the content of IH in ginseng showed an increasing trend with the increase of infection time, while the content of IL at 7dpi and 9dpi was similar, but both were higher than that at 5dpi. Figure 3 The results showed that there was no significant difference in the contents of IH and IL at 5 dpi; however, the contents of IH were significantly higher than those of IL at 7 dpi and 9 dpi.

[0083] ;

[0084] Example 2 Study on the Growth Characteristics of CBLJ-3 (IH) and EDBH-2 (IL)

[0085] 1. Detection of mycelial growth rate and spore production: Take 8 mm cakes of the pre-cultured strains and inoculate them on PDA, SNA, CDA and CMA culture media. Add 15 mL of quantitative culture medium to each plate. Repeat 3 times and culture at 25 °C for 7 d. Measure the colony diameter by the cross method. Then scrape the plate spores with 5 mL of sterile water and use a hemocytometer to count the spores.

[0086] The results showed that the two strains were cultured on PDA, SNA, CDA and CMA to determine the growth rate and spore production. Figure 2 A shows that the two strains grow faster on PDA and SNA, and grow relatively slowly on CDA and CAN. It is worth noting that the growth rate of IL on the four media is significantly higher than that of IH. Figure 2 B shows the spore counts of the two strains after 7 days of growth on the four media, and the spore counts of IL were all higher than those of IH.

[0087] 2. Determination of spore germination rate: Spread the spore liquid on WA, place it at a constant temperature of 25 ℃ for 12 hours, examine the spore germination under a microscope and calculate the spore germination rate according to the formula, repeat 3 times, repeat 3 fields of view for each treatment, 200 spores in each field of view, observe at 1h, 3h, 5h, 7h, 9h, and 11h respectively. Calculate according to the following formula: Germination rate (%) = [number of germinated spores (pieces) / number of observed spores (pieces)] × 100%

[0088] The results show that: Figure 2 C It can be seen that the germination of spores of the two strains on WA showed a rapid growth trend from 1 h to 9 h, but the spore germination rate no longer increased significantly after reaching 90% at 9 h. However, the spore germination rate of IL was significantly higher than that of IH at 3 h, 5 h, and 7 h.

[0089] Example 3 Comparative analysis of CBLJ-3 (IH) and EDBH-2 (IL) genomes

[0090] 1. Comparison of basic genome features and carbohydrate-active enzymes

[0091] Genome sequencing sample preparation: EDBH-2 mycelia were cultured in PDB at 120 r / min and 25 °C for 3 days. Mycelia were collected and sent to Novogene Biotech Co., Ltd. for sequencing.

[0092] EDBH-2 sample sequencing and assembly: After the SDS method was used to extract the sample genomic DNA, the qualified DNA samples detected by electrophoresis were broken into target fragments of appropriate size using Covarisg-TUBE. After DNA damage repair, hairpin adapters were connected to both ends of the DNA fragments, and the DNA fragments were purified and selected using AMPUREPB magnetic beads to construct the SMRTBELL library. The purified fragments were dissolved in buffer, and the fragments of specific size were screened by BluePipin fragments, and the DNA fragments were purified by AMPurePB magnetic beads. The constructed library was quantified by Qubit concentration, and the size of the inserted fragments was detected by agilent2100. After the library was qualified, HiSeqPE150 and Pacbio rsii sequencing were performed.

[0093] Analysis of genomic components: Coding gene prediction: de novo PASA prediction based on transcriptome data using Transdecoder, Glimmer, and Snap, de novo Augustus (version 2.7) prediction based on transcriptome data, and homologous Genewise (version 2.4.1) prediction using closely related sequences as references. The results of multiple methods were integrated using EVM and validated by the second round of PASA.

[0094] Repeat sequence prediction: Interspersed repeat sequence prediction was performed using RepeatMasker (Version open-4.0.5) software

[10] , and tandem repeat sequence prediction was performed using TRF (Tandem Repeats Finder, Version 4.07b)

[11] . Non-coding RNA prediction: tRNA was predicted using tRNAscan-SE software (Version 1.3.1); rRNA was predicted using rRNAmmer software (Version 1.2); Rfam software was used for Rfam database comparison and annotation, and then the final sRNA, snRNA, and miRNA were determined using the cmsearch program (default parameters).

[0095] Gene function analysis: Main databases: GO (Gene Ontology), KEGG (Kyoto Encyclopedia of Genes and Genomes), KOG (Clusters of Orthologous Groups), NR (Non-Redundant Protein Database databases), TCDB (Transporter Classification Database), P450, and, Swiss-Prot.

[0096] Secretory proteins were predicted by Signal P database, secondary metabolism gene clusters were predicted by antiSMASH, pathogenicity and drug resistance-related genes were predicted using PHI and DFVF, and carbohydrate-active enzymes were predicted by CAZy database.

[0097] The results showed that: From Table 2, it can be seen that the genome size of IL is 62.23 Mb (GC content is 49.86%), with 15936 putative coding genes, and the total length of the coding region accounts for 35.47% of the whole genome; the genome size of IH is 66.09 Mb (GC content is 50.74%), with 16297 putative coding genes, and the total length of the coding region accounts for 34.48% of the whole genome. In addition, there are differences in the interspersed repetitive sequences in the genomes of the two strains (Table 3), among which the long terminal repeats, DNA transposons and long interspersed repetitive sequences of IH are significantly more than those of IL. Figure 4 It can be seen that IH and IL have 995 and 925 genes encoding CAZymes, respectively, including some hybrid CAZymes genes; the number of annotated GH genes in both strains exceeds 50% of the annotated CAZymes genes, which is much larger than the other five types of CAZymes genes, and IH has more CBM, CE, GH, GT, and AA type CAZymes genes than IL, and the difference in GH is the largest. The signal peptide structure and transmembrane structure of the protein sequence were predicted, and secretory proteins with signal peptides and no transmembrane structure at the N-terminus were screened out. As shown in Table 4, IH has 1069 secretory proteins and IL has 1025 secretory proteins.

[0098] As shown in Table 5, 2243 and 2178 genes were annotated and classified in the PHI database for IH and IL, respectively. Among them, 985 genes were marked as unaffected virulence, 101 genes were marked as lethal, 800 genes were marked as reduced virulence, 131 genes were marked as lost virulence, 36 genes were marked as increased virulence, and 16 genes were marked as effectors for IH; 950 genes were marked as unaffected virulence, 100 genes were marked as lethal, 785 genes were marked as reduced virulence, 127 genes were marked as lost virulence, 25 genes were marked as increased virulence, and 14 genes were marked as effectors for IL.

[0099] The secretory proteins, CAZymes and PHI annotation results were screened. Figure 5 As shown in the figure, there are 105 secretory CAZymes associated with pathogenicity in IH, of which 43 genes are marked as reduced virulence, 10 genes are marked as effectors, 9 genes are marked as increased virulence, and 1 gene is marked as lost pathogenicity; there are 97 secretory CAZymes associated with pathogenicity in IL, of which 42 genes are marked as reduced virulence, 9 genes are marked as effectors, 10 genes are marked as increased virulence, and 2 genes are marked as lost pathogenicity. After further screening and comparison, it was found that there was a unique LysM effector protein in the 105 secretory CAZymes genes associated with pathogenicity in IH.

[0100] ;

[0101] ;

[0102] ;

[0103] ;

[0104] 2. Genome Collinearity Analysis

[0105] MUMmer software (Version 3.23) was used to align the EDBH-2 genome and the CBLJ-3 genome to determine large-scale colinearity. LASTZ (Version 1.03.54) was used to align the regions to confirm the local positional relationship and to find the regions of translocation (Translocation / Trans), inversion (Inversion / Inv), and translocation+inversion (Trans+Inv).

[0106] The results show that: Figure 6 As shown in the figure, the IH and IL genomes have high coverage and homology. The total length of the sequence alignment region in the IH genome is 55166678bp, accounting for 83.46% of the entire genome; the total length of the sequence alignment region in the IL genome is 55179224bp, accounting for 88.66% of the entire genome (Table 6). Although IH and IL have high coverage, the colinearity between them is relatively low, and there are a large number of translocations, translocations and inversions. IL shows large colinearity with IH in contigs 1, 7, 4, and 6, and shows a large number of translocations, translocations and inversions with IH in other contigs.

[0107] ;

[0108] 3. Phylogenetic relationships and gene family analysis

[0109] The reference genomes of Ilyonectria.spp, Cylindrodendrum.spp, Neonectria.spp, and Fusarium.spp were downloaded from NCBI for species evolution analysis. The CBLJ-3 genome was sequenced by the laboratory in the early stage and re-annotated using the same database and method as EDBH-2 for comparative analysis. MEGA-X, OrthoVeen3, and TimeTree 5 ( https: / / timetree.org / ) is used for gene family evolution analysis, with the species differentiation time provided by TimeTree as a reference.

[0110] The results show that: Figure 7 It can be seen that the ingroup consisting of five species including I. robusta first appeared 28.7 million years ago; Ilyonectria. spp appeared 4.61 million years ago, expanding 92 gene families and shrinking 88 gene families. Among the six strains, I. destructans had the largest number of gene family expansions, followed by I. robusta IH; compared with IL, IH expanded more gene families but shrank fewer gene families. Figure 8 It can be seen that IH and IL clustered together to obtain 13,219 gene families, with 161 unique gene families in IH and 77 unique gene families in IL. In the PHI annotation of the 161 IH-specific gene families, a short-chain dehydrogenase family involved in abscisic acid biosynthesis was found, which contained two genes, both of which were marked as completely reduced virulence (Table 7).

[0111] Table 7 IH-specific short-chain dehydrogenase family

[0112] Gene ID PHI Pfam evm.model.Contig1.153 PHI:5440 PF00106: short chain dehydrogenase evm.model.Contig13.11 PHI:5440 PF00106: short chain dehydrogenase

[0113] 4. Genes related to the synthesis of fusaric acid, fusarin A and trichothecenes

[0114] I. destructans MPI-CAGE-AT-0134, Fusarium verticillioides and F. graminearum data were downloaded from NCBI. The antiSMASH database (https: / / fungismash.secondarymetabolites.org / ) was mainly used to predict biosynthetic gene clusters, and gene function prediction was performed by combining the annotation results of the above multiple databases and sequence alignment. Fusaric acid and fusarin A biosynthetic gene clusters of I. destructans MPI-CAGE-AT-0134, I. robusta IL and I. robusta IH were compared with Fusarium verticillioides and F. graminearum as references.

[0115] The results show that: Fig. 9It can be seen that I. destructans MPI-CAGE-AT-0134 has the same number of FSA synthesis-related genes as F. verticillioides, but some of their genes have differences in sequence; compared with the other two strains, IH seems to lack FUB2 and FUB5, and IL lacks FUB5, but these genes of IL and IH have extremely high homology. In terms of gene cluster structure, there are differences among the four strains, including inversion and displacement of some genes, and FUB11 and FUB3 of IH are not clustered with other genes. Fig.10 It can be seen that there are inversions and translocations of some genes between I. destructans MPI-CAGE-AT-0134 and F. graminearum; IL and IH both lack FGM4, but the other parts show high colinearity with I. destructans MPI-CAGE-AT-0134. For some Fusarium A genes, there are also certain differences in the sequences of related genes in the three Ilyonectria strains and F. graminearum. However, the genes related to trichothecenes synthesis in I. robusta are not clustered, and the synthesis-related genes are shown in Table 8.

[0116] Table 8 ;

[0117] Example 4 Comparative analysis of transcriptomes of ginseng roots infected with IH and IL

[0118] 1. Transcriptome sequencing overall sample analysis

[0119] Sample preparation and sequencing: The IH / IL strains cultured on PDA for 7 days were inoculated on surface-sterilized ginseng (using the wound inoculation method) and cultured at 25°C. Fresh mycelium cultured on PDA for 7 days was used as the control sample (0 dpi). At 4 dpi and 7 dpi, the diseased ginseng tissues were collected under sterile conditions, wrapped in tin foil and stored in liquid nitrogen. They were then sent to Beijing Novogene Biotechnology Co., Ltd. for Illumina sequencing.

[0120] Preprocessing of transcriptome data: The image data of the fragments measured by the high-throughput sequencer is converted into sequence data (raw reads or raw data) using CASAVA base recognition. The file is in fastq format, which mainly contains the sequence information of the sequenced fragments and their corresponding sequencing quality information. The raw data is filtered: reads with adapters are removed; reads containing N (N means that the base information cannot be determined) are removed; low-quality reads (reads with bases of Qphred ≦ 20 accounting for more than 50% of the entire read length) are removed. The raw data is filtered, the sequencing error rate is checked, and the GC content distribution is checked to obtain clean reads for subsequent analysis, and the data is summarized.

[0121] Reference genome alignment and quantitative analysis: Use HISAT2 software to quickly and accurately align the clean reads after quality control with the reference genome to obtain the positioning information of the reads on the reference genome. According to the positioning information, the number of reads covered by each gene is counted from the beginning to the end, and reads with alignment quality values ​​below 10, reads on non-aligned pairs, and reads aligned to multiple regions are filtered out. FeatureCounts (1.5.0-P3) was used to perform quantitative analysis of gene expression levels for each sample, and the expression matrix of all samples was obtained after merging, and the FPKM of each gene was calculated using StringTie software. The expression levels of all genes were calculated using the FPKM method.

[0122] Screening of differentially expressed genes and their functional enrichment analysis: DESeq2 (1.16.1) software was used to screen the differentially expressed genes in all comparison combinations.

[0123] The results showed that RNA-seq sequencing was performed on 18 samples at 0 dpi (IH0 d, pure culture sample), 4 dpi (IH4 d), 7 dpi (IH7 d) after IH inoculation with ginseng and 0 dpi (IL0 d, pure culture sample), 4 dpi (IL4 d), 7 dpi (IL7 d) after IL inoculation with ginseng, with three repetitions. As shown in Table 9, a total of 168.6 Gb of Clean data was obtained, and the Clean data of each sample was 6.33-26.49 Gb. The overall sequencing error rate of the data was below 0.02%-0.03%, the Q20 base percentage was above 97.00%, the Q30 base percentage was above 92.00%, and the GC content was 46.62%-56.61%. Fig.11 As shown, the transcriptome sequencing quality was high and the data could meet the requirements of subsequent related analysis. Finally, the expression profiles of 15,587 genes were used for further analysis.

[0124] Fig.12 The results showed that a total of 37,312 DEGs were identified in the nine comparison combinations (FDR < 0.05 and |log2FC| >1). A total of 15,740 DEGs were found in the three comparison groups during IH infection of ginseng (IH4 d vs IH0 d, IH7 d vs IH0 d, IH7 d vs IH4d), of which 3018, 3262, and 1264 were up-regulated, and 2624, 4239, and 1333 were down-regulated, respectively; in the three comparison groups during IL infection of ginseng (IL4 d vs IL0 d, IL7 d vs IL0 d, IL7 d vs IL4d), 15,740 DEGs were found in the three comparison groups during IL infection of ginseng (IH4 d vs IL0 d, IL7 d vs IL0 d, IL7 d vs IL4d). d) A total of 10,150 DEGs were found, among which 2540, 1765, and 627 were up-regulated, while 2896, 1890, and 432 were down-regulated, respectively; a total of 11,422 DEGs were found in the three comparison groups between IH and IL (IH0d vs IL0d, IH4d vs IL4d, and IH7d vs IL7d), among which 3199, 1463, and 747 were up-regulated, while 3608, 1284, and 1121 were down-regulated, respectively.

[0125] .

[0126] 2. Gene expression trends and GO enrichment analysis

[0127] Short Time-series Expression Miner (STEM) software was used to cluster the gene expression levels in each sample to obtain the clustering results of each gene expression pattern. ClusterProfiler software was used to perform GO functional enrichment analysis on the genes enriched in each trend, and the threshold for significance analysis was P value < 0.05.

[0128] The results show that: Fig.13 As shown in A, during the infection of ginseng by IH strain, DEGs were mainly enriched in trends 0, 1, 3, and 6 (P ≤ 0.05), and among the enriched trends, trend 6 showed a unique expression trend. These genes all showed a trend of continuous expression after being upregulated in the early stage of infection. GO enrichment analysis was performed on the genes enriched in trend 6. Fig.13 As shown in B, the genes that were first up-regulated and then continuously expressed during the infection of ginseng by IH were more significantly enriched in some items related to hydrolase activity. Fig.13As shown in A, during the infection of ginseng by IL strains, DEGs were mainly enriched in trends 0, 1, and 6 ( P ≤ 0.05), and among its significantly enriched trends, IL trend 6 showed the same trend as IH. Similarly, GO enrichment analysis was performed on the genes in IL profile 6. Fig.13 C shows that these genes are mostly enriched in some items related to RNA processing.

[0129] GO enrichment analysis revealed that the two strains had different functions in the genes that were upregulated in the early stage of infection and then continuously expressed. IH was more significantly enriched in some hydrolase activities, while IL was more enriched in RNA processing.

[0130] 3. Comparative analysis of gene expression of strains during infection with ginseng

[0131] The DEGs of the two strains during the infection of ginseng were compared and analyzed (IH vs IL). ClusterProfiler software was used for GO enrichment analysis and KEGG functional enrichment analysis of differentially expressed genes in the sample comparison groups of IH0 d vs IL0 d, IH4 d vs IL4 d, and IH7 d vs IL7 d, and the threshold for significance analysis was P value < 0.05.

[0132] . .

[0133] The results show that: Fig.14 As shown in the figure, the GO enrichment analysis of DEGs upregulated in the early stage of ginseng infection (IH4d vs IL4d) found that the items related to some enzyme activities such as carbohydrate metabolism, hydrolase activity, lyase activity and extracellular region were significantly enriched. The proteins encoded by the genes enriched in these items are mostly some hydrolases secreted into the extracellular space to decompose polysaccharides. KEGG pathway enrichment analysis was performed on the upregulated genes between the two strains (IH0 d vs IL0 d, IH4 d vs IL4 d, IH7 d vs IL7 d). As shown in Table 10, in the pure culture stage (IH0 d vs IL0 d) and the entire infection process (IH4 d vs IL4 d, IH7 d vs IL7 d), the genes upregulated by IH compared with IL were significantly enriched in the "secondary metabolite biosynthesis" pathway.

[0134] 4. Weighted gene co-expression network analysis

[0135] The WGCNA package in R (Version 3.5.0) was used for analysis with default parameters, and association analysis was performed using virulence as the categorical trait.

[0136] The results show that: Fig.15As shown in the figure, the genes of 18 samples were clustered, a co-expression network was constructed, and 31 co-expression modules were divided. The correlation analysis of each module was performed with the virulence level as the classification trait, and the significantly positively correlated module darkred ( Fig.16 ). The characteristic gene expression in this module showed up-regulated expression in all IH samples, but down-regulated expression in all IL samples ( Fig.17 ).like Fig.18 As shown in the figure, genes with weight values ​​greater than 0.15 in the darkred module were selected to further screen the co-expression network, and the hub genes in the module were further screened according to the kWithin value. Among the co-expressed gene pairs with weight values ​​greater than 0.15, 4 genes encoded fungal-specific transcription factors and 1 gene was annotated as glycoside hydrolase family 7.

[0137] 5. qRT-PCR verification of candidate differentially expressed genes

[0138] RNA was extracted from ginseng tissue samples infected with IH / IL strains at 0 dpi, 2 dpi, 4 dpi, 6 dpi, and 7 dpi. After reverse transcription, qPCR verification was performed to observe the expression of pathogenicity-related genes at different infection time points. The total RNA of the samples of the two strains at five time points was extracted using the RNAiso Plus method. cDNA was obtained by operating according to the Rapid Genome Reverse Transcription Kit (Kangwei Century Biotechnology Co., Ltd.). q-PCR reaction conditions: the cDNA of each sample was mixed in equal amounts and used as a template, and the RT-qPCR test was performed using the Kangwei Century Biotechnology Co., Ltd. Fluorescence Quantification Kit. The reaction system was 2×FAstSYBR Mixture 10 μL, 1 μL of upstream and downstream primers, 1 μL of template cDNA, 7 μL of dd H2O, and the reaction system was 20 μL. PCR amplification was performed according to the two-step method, and the reaction program was 95℃ pre-denaturation for 300 s, 95℃ denaturation for 30s, 60℃, 60s, for a total of 45 cycles. Melting curve analysis at 65℃~95℃. Three biological replicates and three technical replicates were performed for each gene. The relative expression of genes was calculated and analyzed using the 2-ΔΔCq method. The primers used are shown in Table 11.

[0139] The results show that: Fig.19As shown in the figure, to verify the RNA-seq results, 7 common genes (2 pectin lyase genes, 2 cellulase genes and 3 trichothecene synthesis-related genes) were screened for gene expression analysis during IL and IH infection of ginseng. The linear fitting analysis results showed that the qPCR data had a good correlation with the RNA-seq data. The expression levels of the 7 genes at 0 dpi (PDA pure culture), 2 dpi, 4 dpi, 6 dpi and 7 dpi were analyzed at the same time. The expression patterns of the 4 cell wall degradation enzyme genes in the two strains have one thing in common: after infection with ginseng, the expression of the genes increased sharply and then stabilized or slowly decreased. The expression patterns of trichothecene synthesis-related genes in IH and IL are completely different, but compared with IL, these 3 genes are upregulated at most time points in IH.

[0140] .

[0141] Example 5 Non-targeted extracellular metabolome study

[0142] Non-targeted metabolomics research based on liquid chromatography-mass spectrometry (LC-MS) technology.

[0143] Sample preparation: The IH / IL strain was cultured in PDA for 7 days, and then 6 mm mycelium cakes were taken. Eight mycelium cakes were inoculated into each bottle of PDB (100 mL) and cultured at 25°C, 120 r / min for 7 days. The 7-day culture solution was collected, and the mycelium was filtered through 8 layers of gauze. The supernatant was collected by centrifugation at 4°C, 4000 r / min for 20 minutes. The supernatant was filtered twice with a 0.22 μm sterile filter membrane to obtain the strain culture solution sample, and 6 replicates were set for each strain. The collected samples were frozen in liquid nitrogen and sent to Beijing Novogene Biotechnology Co., Ltd. for non-targeted metabolomics detection.

[0144] Qualitative and quantitative analysis of metabolites: CD3.1 software was used for preprocessing of raw data. Through simple screening of parameters such as mass-to-charge ratio and retention time, peak alignment was performed for each sample based on retention time deviation and mass deviation (Part per million, ppm); peak extraction was then performed based on the set ppm, signal-to-noise ratio (S / N), adduct ion and other information, and peak area was quantitatively calculated. Metabolites were identified by comparing the high-resolution secondary spectrum databases mzCloud and mzVault and the MassList primary database search. Metabolites with a coefficient of variation (CV) of less than 30% in the QC samples were retained as the final identification results for subsequent analysis. The chromatographic peaks detected in each sample were integrated using CD3.1 software, where the peak area of ​​each characteristic peak represents the relative quantitative value of a metabolite. The quantitative results were standardized using the total peak area, and finally the quantitative results of the metabolites were obtained.

[0145] Metabolite pathway and classification annotation: The identified metabolites were annotated and classified using the KEGG, HMDB, and LIPID MAPS databases.

[0146] Screening and analysis of differential metabolites: PCA was used to observe the overall distribution trend between the two groups of samples. Partial least squares regression was used to establish a relationship model between metabolite expression and sample category to predict the sample category. The PLS-DA model of each comparison group was established, and the model evaluation parameters (R2, Q2) were obtained through 7-fold cross-validation (seven-fold cross-validation, when the number of biological replicates of the sample n<=3, it was k-fold cross-validation, k=2n).

[0147] The screening thresholds for differential metabolites were set as P-value < 0.05, FC > 1 / FC < 0.667, and VIP > 1.0. The hypergeometric test method was used to obtain the P-value of pathway enrichment, with P-value ≤ 0.05 as the threshold. KEGG pathways that met this condition were defined as KEGG pathways that were significantly enriched in differential metabolites.

[0148] The results showed that the non-targeted extracellular metabolomics of I. robusta IH and I. robusta IL were compared. Principal component analysis (PCA) of all sample data showed that replicates of IH and IL strains clustered in two different groups, indicating that there were differences in the extracellular metabolomics between IH and IL strains ( Fig. 20). In the positive ion mode (pos), 920 metabolites were detected, of which 187 were up-regulated and 244 were down-regulated in CBLJ-3 compared with EDBH-2; in the negative ion mode (neg), 464 metabolites were detected, of which 79 were up-regulated and 134 were down-regulated in CBLJ-3 compared with EDBH-2 (Table 12). KEGG enrichment analysis found that the differential metabolites were significantly enriched only in phenylalanine metabolism (21). It is worth noting that two type A trichothecenes (T-2 triol and diacetyloxysuccinol) and two type B trichothecenes (15-acetyldeoxynivalenol and 4-deacetylneotoxin) were identified among these metabolites, among which 15-acetyldeoxynivalenol was a significantly up-regulated differential metabolite (Table 13).

[0149] ;

[0150] .

[0151] Example 6 Identification of pathogenic genes and characterization of deletion mutants

[0152] 1. Identification of pathogenic genes and acquisition of knockout mutants

[0153] MEGA-X and MEME were used for target gene evolution analysis and conserved motif analysis.

[0154] CRISPR-Cas9 vector construction: Based on the CDS sequences of some pathogenic genes screened, sgRNA was designed to connect with CRISPR empty vector, and E. coli DH5a was transformed and then plasmid was extracted and sequenced to verify whether the vector was successfully constructed. Design sgRNA: sgRNA Designer CRISPR KO website (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design). After the sgRNA sequence is successfully designed, the Sense primer is: 5'-ACCT+N (20)-3', and the Anti primer is: 5'-AAAC+N' (the reverse complementary sequence of the above 20 N)-3'. Synthesize short fragments, i.e. spacer: 2ul Sense oligo (100umol / L), 2ul Anti-sense oligo (100umol / L) mixed, 95 degrees for 5min, 25 degrees for 10min (annealing and self-ligation). Ligation and transformation: 2ul spacer, 200ng digested CRISPR vector (BsmbI55 degree digestion), 2ul 10ⅹLigase Buffer (NEB), 1.5ul T4DNALigase (NEB), ddH2O to 20ul, 16℃ overnight connection. E. coli transformation: Take out 100ul of E. coli competent DH5α stored in a -80℃ refrigerator, put it on ice to thaw for a few minutes; the whole process is completed in a super-bacterial workbench, add 20ul of the ligation product, mix gently; immediately insert it into ice, ice bath for 30min, no shaking during the period; place it in a 42℃ water bath for 90s, then immediately insert it into ice, continue ice bath for 3min; add 500ul LB liquid culture medium without antibiotics, place it in a 37℃ shaker at 180rpm for 1-2 hours; then shake at 8000rpm Centrifuge for 1min; pour out 400ul supernatant, blow gently with a pipette tip to mix the bacteria evenly; draw 100ul and add it to the LB solid medium containing ampicillin resistance, and spread it evenly with a coating rod, mark it, and place it in a 37℃ incubator overnight; pick a single colony, add it to the LB liquid medium containing ampicillin, and place it in a 37℃ shaker at 180rpm for 12h. Take a part of the bacterial solution to preserve the strain, and add the bacterial solution and 50% glycerol in a ratio of 1:1. Put it in a -80℃ refrigerator for next use. The remaining bacterial solution is used to extract the plasmid. Use the TIANGEN kit to extract the plasmid, and after the extraction is completed, use 1.2% agarose gel electrophoresis and 100V voltage for electrophoresis detection. Detect the purity and concentration of the extracted plasmid.It was then sent to a biological company for sequencing to verify whether the CRISPR-Cas9 knockout vector for the gene was successfully constructed.

[0155] Overlap extension PCR to obtain homologous resistance fragments: PCR amplification was performed on the upstream 1000bp fragment, the downstream 1000bp fragment and the hygromycin DNA designed primers of the candidate gene respectively, and the left and right homologous arm fragments and hygromycin fragment of the target gene were obtained by gel cutting and recovery after electrophoresis.

[0156] The principles of primer synthesis are:

[0157] Left homology arm fragment: F: Design primer for the first 1000 bp upstream (GACGACGATCTTGTCGGT)

[0158] R: Design the reverse complementary primer about 20 bp after upstream + 20 bp before hygromycin, a total of 40 bp (CGACCGGGAACCAGTTATCCTACGTAGTAGCACTAAGGCT)

[0159] Hygromycin fragment: F: Design primers about 20 bp upstream + 20 bp before the hygromycin gene (AGCCTTAGTGCTACTACGTAGGATAACTGGTTCCCGGTCG)

[0160] R: 20 bp after the hygromycin gene + the first 20 bp downstream of the gene, a total of 40 bp of reverse complement (GCCAGTAGAATAATGAATGTAGCCTTTGGTTTAGTCGTCAGGC)

[0161] Right homology arm fragment: F: 20 bp after the hygromycin gene + about 20 bp downstream of the gene. Forward primer design (GCCTGACGACTAAACCAAAGGCTACATTCATTATTCTACTGGC)

[0162] R: Reverse complement after 1000 bp downstream (GAGAGCTCTGGGTGTACAC)

[0163] The target band was excised and recovered to obtain gel recovery products of three fragments, and overlap extension PCR was performed. The three fragments were connected to obtain homologous recombinant fragments, and then gel electrophoresis and gel excised and recovered were performed.

[0164] PEG-mediated genetic transformation:

[0165] A. Mycelium preparation: I. robusta was cultured in PDB for 7 days at 25°C and 150 r / min, and spores were collected. The spore suspension was cultured in 100 mL of PDB for 22 hours at 25°C and 150 r / min, and mycelium was collected.

[0166] B. Plasmid extraction: For the constructed cas9 vector of the candidate gene, extract the plasmid and detect the concentration and purity.

[0167] C. Preparation of enzymatic hydrolysis solution: 5 mL of protoplast buffer (0.15 g of lysase, 0.1 g of wall-dissolving enzyme) was mixed with 0.5 g of mycelium; 5 mL of protoplast buffer was used, and an osmotic pressure stabilizer (0.7 mol / L KCL + 0.7 mol / L MgSO 4 7H 2 O), shaken at room temperature for 30 min, then at 3500 rpm for 10 min, and the supernatant was collected and filtered through a microporous membrane.

[0168] D. Filtration of mycelium: Collect mycelium after spore germination for 22 h, add it to 10 mL of protoplast buffer, and perform enzymatic hydrolysis at 30°C and 90 rpm for 3 h.

[0169] E. Filter the enzymatic hydrolysate: Filter the enzymatic hydrolysate mixture through three layers of lens paper into a 50 mL centrifuge tube.

[0170] F. Centrifuge at 3500 rpm for 10 min at room temperature;

[0171] E. Remove the supernatant, add 10 mL STC Buffer to resuspend, and centrifuge at 3500 rpm for 10 min;

[0172] G. Remove the supernatant, add 1 mL STC Buffer to resuspend, transfer to a 2 mL centrifuge tube, and centrifuge at 3500 rpm for 10 min at room temperature;

[0173] H. After resuspension, the concentration of protoplasts was tested and reached 1×10 7 protoplasts / mL or above is best;

[0174] I. Add 5 μg of CRISPR vector and amplified homologous resistance fragment to 200 μL protoplasts, mix well, and let stand for 20 min;

[0175] J. Add 1 mL of 40% PTC8000, mix well, and let stand for 20 min;

[0176] K. Add 5 mL TB3 (containing 50 ug / mL ampicillin) and culture overnight at 25°C, 100 rpm;

[0177] Mix 45 mL Bottom Agar with the overnight cultured protoplasts and pour into the culture dish;

[0178] M. Culture at 25 ℃ for 24 h, then pour Top Agar containing hygromycin, culture at 25 ℃ for about 7 days, and pick out transformants for subsequent experiments.

[0179] Identification of positive transformants: After transformants grow out of the upper culture medium, each transformant is transferred to PDA basal culture medium for culture and preservation. Mycelium of each transformant is collected, genomic DNA is extracted, and the target fragment and hygromycin resistance gene are amplified.

[0180] qRT-PCR verification of target gene expression in positive transformants: RNA from mutant and wild-type (CBLJ-3) samples was extracted using the RNAiso Plus method. cDNA was obtained using the Rapid Genome Reverse Transcription Kit (Kangwei Century Biotechnology Co., Ltd.). q-PCR reaction conditions: cDNA from each sample was mixed in equal amounts and used as a template, and RT-qPCR was performed using the Kangwei Century Biotechnology Co., Ltd. Fluorescence Quantification Kit. The reaction system was 2×FAstSYBR Mixture 10 μL, 1 μL of upstream and downstream primers, 1 μL of template cDNA, 7 μL of dd H2O, and the reaction system was 20 μL. PCR amplification was performed according to the two-step method, and the reaction procedure was 95℃ pre-denaturation for 300 s, 95℃ denaturation for 30 s, 60℃, 60s, for a total of 45 cycles. Melting curve analysis at 65℃~95℃. Three biological replicates and three technical replicates were performed for each gene. The relative expression of genes was calculated and analyzed using the 2-ΔΔCq method. The primers used are shown in novel.2695 in Table 11.

[0181] Southern blot was performed to verify the positive transformants initially screened by conventional PCR and qPCR. The specific experimental steps were carried out according to the instructions of the kit. Probe design and selection Fig. 22 .

[0182] The results showed that the only trichothecene diene synthase family gene was identified from the IH genome and named IrTri01. Fig.23 It can be seen that IrTri01 belongs to the longifolene synthase in the trichothecene synthase family and has a conserved trichothecene synthase domain. Three CRISPR / Cas9 knockout vectors targeting IrTri01 were constructed, and the homologous fragment containing the hygromycin resistance gene and the knockout vector were simultaneously transformed into I. robustaIH protoplasts through PEG-mediated genetic transformation ( Fig.24A, B, C); Transformants were selected on a medium containing hygromycin B and analyzed by PCR and qPCR ( Fig.24 D, E) and Southern blot verification ( Fig.25 ), two deletion mutants (T-12, T-15) and one random insertion mutant (T-22) were obtained, and T-12 and T-15 were used for subsequent experiments.

[0183] 2. Growth characteristics of knockout mutants

[0184] Mycelial growth rate and spore production detection: 8 mm cakes of the pre-cultured strains were inoculated on PDA, SNA, CDA and RCBA culture media, and 15 mL of quantitative culture medium was added to each plate. The treatment was repeated 3 times and cultured at 25 °C for 7 d. The colony diameter was measured by the cross method, and the plate spores were scraped with 5 mL of sterile water, and the spore amount was calculated using a hemocytometer.

[0185] Determination of spore germination rate: Spread the spore solution on WA and place it at a constant temperature of 25 ℃ for 12 hours. Observe the spore germination under a microscope and calculate the spore germination rate according to the formula. Repeat 3 times. Each treatment has 3 repeated fields, 200 spores in each field, and observe at 1 h, 3 h, 5 h, 7 h, 9 h, and 11 h. Calculate according to the following formula:

[0186] Germination rate (%) = [number of germinated spores (pieces) / number of observed spores (pieces)] × 100%

[0187] The results show that the growth rates of T-12 and T-22 in PDA, SNA and CDA are higher than those of IH and similar to those of IL, but the growth rates of T-12 and T-15 in RBCA are similar to those of IH and higher than those of IL ( Fig.26 A). When cultured on RBCA, T-12 and T-22 produced less pigmentation and more white aerial hyphae ( Fig.26 D). The results of spore production showed that the spore production of T-12 and T-15 on the four culture media was significantly lower than that of IH ( Fig.26 B), but the spore germination ability was not significantly different from that of IH ( Fig.26 C). The results showed that the loss of IrTri01 affected the hyphal growth of IH and reduced the spore production ability of IH, resulting in some hyphal growth characteristics of IH being similar to those of IL, which also indicated that IrTri01 was one of the reasons for the differences in growth characteristics between IH and IL at the genetic level.

[0188] 3. Determination of Pathogenicity of Knockout Mutants

[0189] Mycelial inoculation: After pure culture on PDA, use a cork puncher to take a 6 mm diameter mycelial block from the edge of the colony and inoculate it into the wound of ginseng. Culture it in a sterile environment for 9 days (remove the mycelial block 1 dpi), use sterile PDA as a blank control, and observe and record after 9 days.

[0190] Spore suspension inoculation: Take 6 mm mycelium blocks of the strain that have been cultured at 25°C for more than 7 days on PDA plates, inoculate 8 mycelium blocks in each bottle (100 mL) of PDB, shake the flask at 120 r / min, and culture at 25°C for 7 days. Use 8 layers of gauze (spore concentration is 2×10 5 Spores / mL) were filtered out to obtain the spore liquid after the mycelium was removed. 10μL of spore liquid was dropped into the treated ginseng, and sterile water was used as a blank control. The ginseng roots inoculated with spore liquid were placed in a sterile environment at 25℃ for 9 days, and observations were recorded after 9 days.

[0191] Crude toxin inoculation: Take 6 mm mycelium blocks of the strain cultured at 25 °C for more than 7 days on the PDA plate, inoculate 8 mycelium blocks per bottle (100 mL) of PDB, culture at 25 °C with a shaker at 120 r / min for 7 days, and filter the mycelium with 8 layers of gauze to obtain the culture solution. Filter twice continuously with a 0.22 μm sterile filter membrane to remove spores and obtain the crude toxin induced by PDB. Drop the crude toxin into the treated ginseng at 10 μL / well, repeat the dripping 3 times per well, and use sterile water as a blank control. The ginseng inoculated with crude toxin was placed in a sterile environment at 25 °C for 9 days, and cut off after 9 days for observation and record.

[0192] TBI-induced crude toxin inoculation: The same concentration (2 × 10 5 The spore solution (spores / ml) was placed in TBI in the dark and cultured at 25 ℃ and 120 r / min for 7 days. The mycelium was removed by filtration with 8 layers of gauze to obtain the culture solution. The spores were removed by continuous filtration with a 0.22 μm sterile filter membrane twice to obtain the crude toxin induced by TBI. The crude toxin solution was dripped into the treated ginseng, 10 μL per well, and each well was repeated for 3 times. Sterile water was used as a blank control. The ginseng inoculated with crude toxin was placed in a sterile environment at 25 ℃ for 9 days. After 9 days, it was cut open and observed and recorded.

[0193] The results show that: Fig. 27It can be seen that after mycelium inoculation and spore inoculation, the rot area caused by T-12 and T-15 was significantly smaller than that caused by IH, but similar to that caused by IL, indicating that IrTri01 positively regulates the pathogenicity of I. robusta; it is worth noting that after inoculation of crude toxin, the symptoms caused by T-12 and T-15 were lighter than those caused by IH, but more severe than those caused by IL. Compared with the crude toxin prepared by PDB culture, the crude toxin prepared by TBI culture of the four strains can cause a larger area of ​​rot, with IH causing the largest area of ​​rot, followed by IL, and T-12 and T-15 causing the smallest area of ​​rot. These results indicate that the loss of IrTri01 leads to a reduction in substances harmful to ginseng produced by I. robusta, and trichothecenes may play a role as virulence factors in the process of infecting ginseng.

[0194] 4. Inhibition of IrTri01 expression by biocontrol bacteria and pesticides

[0195] Three strains of biocontrol bacteria (NJ13, FG14, NT35) and three chemical agents (fenpropimorph, carbendazim, fludioxonil) were selected to treat CBLJ-3, and RNA of CBLJ-3 samples was extracted using RNAiso Plus method. cDNA was obtained by using the Rapid Genome Reverse Transcription Kit (Kangwei Century Biotechnology Co., Ltd.). q-PCR reaction conditions: cDNA of each sample was mixed in equal amounts and used as a template, and RT-qPCR was performed using the fluorescent quantitative kit of Kangwei Century Biotechnology Co., Ltd. The reaction system was 2×FAstSYBR Mixture 10 μL, 1 μL of upstream and downstream primers, 1 μL of template cDNA, 7 μL of dd H2O, and the reaction system was 20 μL. PCR amplification was performed according to the two-step method, and the reaction program was 95℃ pre-denaturation for 300 s, 95℃ denaturation for 30 s, 60℃, 60s, for a total of 45 cycles. Melting curve analysis was performed at 65℃~95℃. Each gene was replicated three times biologically and three times technically. The relative expression of genes was calculated and analyzed using the 2-ΔΔCq method. The primers used are shown in Table 11, novel.2695.

[0196] The results show that: Fig.28 As shown in the figure, except for the fact that IrTri01 was not downregulated after difenoconazole treatment, the other five treatments could inhibit the expression of IrTri01 to varying degrees. Among all the treatments, the biocontrol fungus FG14 had the most severe inhibition on IrTri01, followed by carbendazim, NJ13 and fludioxonil.

Claims

1. The trichothecene synthase pathogenicity gene IrTri01, whose base sequence is shown in the sequence listing SEQ ID NO.

1.

2. A CRISPR / Cas9 knockout vector designed for the trichothecene synthase pathogenicity gene IrTri01 described in claim 1.

Images