A specific molecular marker, molecular marker combination and application thereof for sex identification of Coilia ectenes
By designing detection reagents for the SNP site of chromosome 17 of the Knife gene, using PCR and gel electrophoresis, the problem of nife gender identification was solved, rapid and accurate gender identification was achieved, and aquaculture efficiency and germplasm improvement were promoted.
Patent Information
- Application Number
- CN202410682623.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-29
- Publication Date
- 2024-12-27
- Estimated Expiration
- 2044-05-29
AI Technical Summary
The prior art is difficult to accurately identify the genetic gender of the snail through simple methods, which leads to difficulty in controlling single-sex populations in breeding and affects yield and germplasm improvement.
Detection reagents for specific SNP sites on chromosome 17 of the Knife gene were designed, and gender identification was performed using PCR and agarose gel electrophoresis, providing a fast and accurate gender identification method.
It realizes rapid and accurate gender identification of snails, reduces cost and complexity, is suitable for rapid identification of large samples, and lays the foundation for gender-controlled breeding.
Smart Images
Figure HDA0004865984550000011 
Figure HDA0004865984550000012 
Figure HDA0004865984550000021
Abstract
Description
Technical Field
[0001] The invention belongs to the field of fish sex identification in the field of aquaculture, and specifically relates to a specific molecular marker, a molecular marker combination and an application thereof for sex identification of ectenes. Background Art
[0002] The razor-sharp coil (Coilia nasus), belonging to the order Clupeiformes, family Engraulidae, genus Coilia, is a migratory fish also known as "long-jawed coil". Artificial breeding and aquaculture techniques for razor-sharp coil have been rapidly established in the past decade to meet the market demand for razor-sharp coil. However, since the establishment of the artificial aquaculture system for razor-sharp coil, no systematic breeding work has been carried out on this species. Environmental deterioration and long-term captivity have led to adverse selection and inbreeding, which have caused serious degradation of the razor-sharp coil germplasm. The cultured population has shown an obvious trend of miniaturization, accompanied by precocious puberty. Therefore, it is urgent to carry out genetic breeding of razor-sharp coil to improve the germplasm of razor-sharp coil and increase aquaculture yields, so as to promote the high-quality development of the razor-sharp coil industry.
[0003] Aquaculture has a great demand for sex control technology, especially for aquatic economic species with sexually dimorphic growth. Mature razorfish is a fish with sexually biased growth dimorphism. Therefore, breeding monosexual populations may help to further increase the production of razorfish. However, before the gonads of razorfish mature, it is difficult to accurately distinguish the sex by morphology. During the embryonic and juvenile growth stages of razorfish, there is almost no morphological difference between male and female individuals. If a specific molecular marker can be developed to accurately identify the genetic sex of razorfish through a simple method, the dominant sex group can be screened out in its early growth stage, and monosexual sex groups can be raised exclusively, thereby improving breeding efficiency. However, in the screening of sex-specific molecular markers for razor-sharp coil, only the invention patent with authorization announcement number CN114752664B discloses one SNP molecular marker for sex identification of razor-sharp coil. However, the process requires sanger sequencing technology to obtain the final sex identification result, which undoubtedly increases the cost and complexity of sex identification of razor-sharp coil. At present, there is still a lack of sex-linked molecular markers for razor-sharp coil based on gel electrophoresis method. Therefore, the patent of this invention can accelerate the breeding process of sex control of razor-sharp coil and further promote the genetic improvement and germplasm resource protection of this species. Summary of the invention
[0004] The invention aims to provide an application of a detection reagent designed for the 17176716th, 17176724th and 17176740th bases on chromosome 17 of anchovy gene in anchovy breeding.
[0005] Another object of the present invention is to provide a detection reagent designed for the bases 17176716 (for [C / T] mutation), 17176724 (for [C / A] mutation), 17176740 (for [G / A] mutation), and 17216848 (for [C / T] mutation) on chromosome 17 of the razorfish gene for use in razorfish breeding.
[0006] Another object of the present invention is to provide an application of a detection reagent for the polynucleotide described in SEQ ID NO.2 in the breeding of Coilia ectenes.
[0007] The last object of the present invention is to provide the use of a detection reagent for the polynucleotides described in SEQ ID NO.1 and SEQ ID NO.2 in the breeding of Coilia ectenes.
[0008] In order to achieve the above object, the present invention discloses the following technical solutions:
[0009] The inventors of the present application used the existing genome of the razorfish as a reference (accession number: GCA_007927625.1) and performed whole genome resequencing on 252 razorfish to obtain genetic variation sites at the genome level of the razorfish population. After sex-related GWAS analysis and Fst analysis, 241 SNP sites significantly associated with the sex of the razorfish were found, and 17100001bp-17250000bp of chromosome 17 was determined as one of the sex-determining regions of the razorfish. Finally, four SNP markers with significant correlation with the sex of the razorfish were selected, and the SNP markers were located on chromosome 17 at position 17176716 (for [C / T] mutation), position 17176724 (for [C / A] mutation), position 17176740 (for [G / A] mutation), and base 17216848 (for [C / TA] mutation).
[0010] The protection scope of the present invention includes:
[0011] Application of detection reagents designed for bases 17176716, 17176724 and 17176740 on chromosome 17 of Coilia scaly in sex identification of Coilia scaly.
[0012] Application of a detection reagent designed for the 17176716th, 17176724th and 17176740th bases on chromosome 17 of the scaly cod gene in the preparation of a sex identification kit for scaly cod;
[0013] Application of detection reagents designed for bases 17176716, 17176724 and 17176740 on chromosome 17 of Coilia edulis gene in artificial breeding of Coilia edulis;
[0014] Application of detection reagents designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the scaly coil gene in sex identification of scaly coil;
[0015] Application of detection reagents designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the scaly cod gene in the preparation of a sex identification kit for scaly cod;
[0016] Application of detection reagents designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the ectomeric coil gene in artificial breeding of ectomeric coil.
[0017] In the above application, preferably, the reagent is a primer; primers can be designed for each base for detection, or different numbers of primers can be used as a group of designed primers for detection.
[0018] In the above application, preferably, the detection primers for the 17176716th, 17176724th and 17176740th bases on chromosome 17 of the Coilia lanceolata gene are a set, and the 3'-end tail of the forward primer of the primer is the 17176740th base;
[0019] The detection primers for the 17216848th base on chromosome 17 of the scaly Coilia punctata gene are a set, and the 3' end tail of the forward primer of the primer is the 17216848th base;
[0020] The primers described above, preferably, the primers for detecting the 17216848th base on chromosome 17 of the Coilia lanceolata gene are:
[0021] S–2–F:5’–TGCTGTTTGGGTGTCTTT–3’
[0022] S–2–R:5’–GTGTAGTCCCTCGTGATTG–3’
[0023] The sequence amplified in female ectodontia using the above primers is shown as SEQ ID NO.1, and no product can be amplified in male ectodontia.
[0024] The primers for detecting the 17176716th, 17176724th and 17176740th bases on chromosome 17 of the razor-sharp Coilia gene are:
[0025] S–3–F:5’–CTTATATGTACAATGCACAAACTTTA–3’
[0026] S–3–R:5’–CTATGGAACGCTGGTGTATTT–3’
[0027] The sequence amplified in female ectodontia using the above primers is shown as SEQ ID NO.2, and no product can be amplified in male ectodontia.
[0028] The protection scope of the present invention also includes a molecular marker of a DNA fragment, and the molecular marker is as follows:
[0029] CTTATATGTACAATGCACAAACTTTAacggtttagttctgtctcacatcccacacacaggttgtgcatatagcaa aattgactgactaacaacattttgctgcggaaaaattataaacgcaacatttgaccacagtataacacccaaAAATACA CCAGCGTTCCATAG.
[0030] Application of the molecular marker or the detection reagent of the polynucleotide shown in SEQ ID NO.2 in sex identification of Coilia ectenes.
[0031] Application of the above molecular marker or the detection reagent of the polynucleotide shown in SEQ ID NO.2 in artificial breeding of Coilia ectenes.
[0032] Application of the molecular marker or the detection reagent of the polynucleotide shown in SEQ ID NO.2 in the preparation of a sex identification kit for Coilia otarius.
[0033] Compared with the prior art, the present invention has the following beneficial effects:
[0034] The present invention mainly obtains genetic sex identification molecular markers of razorfish through high-throughput sequencing of razorfish populations, GWAS analysis and Fst analysis, and designs corresponding primer pairs, which can use sample genomic DNA as a template, and can identify the genetic sex of razorfish only through PCR and agarose gel electrophoresis, which is time-consuming, less harmful to the fish body, convenient and fast, and has a higher accuracy rate, and is particularly suitable for rapid sex identification of large samples. The present invention provides basic data for further mining of sex determination genes of razorfish, and at the same time lays a foundation for sex control breeding of razorfish. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 This is a GWAS analysis diagram of the sex of Coilia edulis provided in an embodiment of the present invention.
[0036] Figure 2This is a Fst analysis diagram of the sex of the razor-sharp Coilfish provided in an embodiment of the present invention.
[0037] Figure 3 The agarose gel electrophoresis diagram of primer S-2-F / R in Example 3 of the present invention on 12 samples of male and female Coilia scabra.
[0038] Figure 4 The agarose gel electrophoresis diagram of primer S-3-F / R in Example 3 of the present invention on 12 samples of male and female Coilia scabra. DETAILED DESCRIPTION
[0039] The specific molecular markers and genetic sex identification method of Coilia edulis of the present invention are now clearly and completely described in conjunction with the accompanying drawings and embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, which are only used to explain the present application and are not used to limit the present application. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without paying creative work all belong to the scope of protection of the present invention.
[0040] Unless otherwise specified, the materials and reagents used in this example can be obtained from commercial sources; methods not described in detail are all conventional experimental methods and can be obtained from the prior art.
[0041] Embodiment 1:
[0042] Acquisition of sex-specific SNP markers and primer design for Coilia ectenes:
[0043] (1) The inventors of this application used the existing genome of Coilia sutchuenensis as a reference (accession number: GCA_007927625.1) to perform whole genome resequencing on 252 Coilia sutchuenensis to obtain genetic variation sites at the genome level of Coilia sutchuenensis population, with an average sequencing depth of 10×. After sufficient quality control, 925,137 SNP sites were used for subsequent sex-related GWAS analysis ( Figure 1 ) and Fst analysis ( Figure 2 ) and found 241 SNP loci significantly associated with the sex of the razor-sharp coil. They also identified chromosome 17,100,001 bp–17,250,000 bp as one of the sex-determining regions of the razor-sharp coil.
[0044] (2) The inventors of the present application comprehensively considered the results of GWAS analysis and Fst analysis, and finally selected 4 SNP markers that were significantly correlated with the sex of ectenes, which were located at bases 17176716, 17176724, 17176740, and 17216848 on chromosome 17.
[0045] (3) The inventors of the present application designed primers based on the genomic physical locations of the four sex-related SNP markers of scaly cod. The design strategy is that at least one SNP marker is located at the 3' tail of the forward primer. Finally, two pairs of scaly cod sex-specific primers S–2–F / R and S–3–F / R were designed based on the four SNP markers, and the four SNP markers were located at the 18th position of the forward primer S–2–F and the 2nd, 10th, and 26th positions of S–3–F, respectively.
[0046] The two pairs of primers designed for the four SNP markers are as follows:
[0047] S–2–F / R:
[0048] S–2–F:5’–TGCTGTTTGGGTGTCTTT–3’
[0049] S–2–R:5’–GTGTAGTCCCTCGTGATTG–3’
[0050] S–3–F / R:
[0051] S–3–F:5’–CTTATATGTACAATGCACAAACTTTA–3’
[0052] S–3–R:5’–CTATGGAACGCTGGTGTATTT–3’.
[0053] Embodiment 2:
[0054] Method for using sex-specific SNP marker primers for Coilia scabra:
[0055] (1) Extract the genomic DNA of the tested Megalobrama amblycephala as a template, and perform PCR amplification using at least one pair of primers in the primer set of Example 1. PCR amplification system: 2×Hieff PCR Master Mix, 10 μL; upstream and downstream primers, 0.5 μL each; template DNA, 1 μL; ddH2O, 8 μL. PCR amplification program: 94°C for 5 min; 94°C for 30 s, 62°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 10 min; cool to 4°C.
[0056] (2) The PCR amplification product was detected by electrophoresis in 1.3% agarose gel. The genetic sex of the cutlassfish was determined based on the bands in the electrophoresis results.
[0057] The determination method is as follows:
[0058] Primer S–2–F / R: No band was amplified in the DNA sample of male fish, but a 223 bp band (shown in SEQ ID NO.1) was amplified in the DNA sample of female fish;
[0059] Primer S–3–F / R: No band could be amplified in the DNA sample of male fish, but a 168 bp band (shown in SEQ ID NO.2) could be amplified in the DNA sample of female fish.
[0060] Any one or both of the above two molecular markers can determine the sex of the razor-sharp Coilfish with an accuracy rate of more than 99%.
[0061] Embodiment 3:
[0062] Application of sex-specific SNP marker primers in sex identification of Coilia edulis:
[0063] (1) Genomic DNA extraction and tissue section gender:
[0064] Sex identification was performed through gonad histological sections. Twelve female and male fish were randomly selected from the group of ectodon esculentus. The tail fins of each fish were cut off. The genomic DNA of the samples was extracted by the high salt method. The quality and concentration of DNA were detected by Nanodrop2000 spectrophotometer. The DNA quality was further detected by 1.3% agarose gel electrophoresis and then stored at -20℃ for future use.
[0065] (2) PCR amplification:
[0066] The genomic DNA sample of Coilia otarius extracted in step (1) was diluted to 100 ng / μL, and the diluted genomic DNA was used as a template to perform PCR amplification using the primer set described in Example 1. The amplification system and amplification procedure were the same as those described in Example 2.
[0067] (3) Gel electrophoresis results analysis:
[0068] The PCR amplification product obtained in step (2) was subjected to electrophoresis detection using 1.5% agarose gel. The electrophoresis results showed:
[0069] Primer S–2–F / R could not amplify any band in the DNA samples of 12 male fish, but could amplify a 223 bp band in all 12 female fish ( Figure 3 );
[0070] Primer S–3–F / R could not amplify any band in the DNA samples of 12 male fish, but could amplify a 168 bp band in all 12 female fish ( Figure 4 ).
[0071] The experimental results were consistent with the results of gonad histological identification, indicating that the two molecular markers can be used alone or in combination to identify the sex of Coilia otarius.
[0072] The above embodiments provide a detailed description of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes made without departing from the spirit of the present invention should be included in the protection scope of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.
Claims
1. Application of a detection reagent designed for bases 17176716, 17176724 and 17176740 on chromosome 17 of the scaly Coilia edulis gene in sex identification of scaly Coilia edulis, wherein the reagent is a primer, and the primer is: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’.
2. Use of a detection reagent designed for bases 17176716, 17176724 and 17176740 on chromosome 17 of the scaly Coilia edulis gene in the preparation of a sex identification kit for scaly Coilia edulis, wherein the reagent is a primer, and the primer is: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’.
3. Application of a detection reagent designed for bases 17176716, 17176724 and 17176740 on chromosome 17 of the Coilia edulis gene in artificial breeding of Coilia edulis, wherein the reagent is a primer, and the primer is: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’.
4. Application of a detection reagent designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the scaly Coilia edulis gene in sex identification of scaly Coilia edulis, wherein the reagent is a primer, The detection primers designed for the 17176716th, 17176724th and 17176740th bases are: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’; The detection primers designed for the 17216848th base are: S–2–F: 5’–TGCTGTTTGGGTGTCTTT–3’ S–2–R: 5’–GTGTAGTCCCTCGTGATTG–3’.
5. Use of a detection reagent designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the scaly Coilia edulis gene in the preparation of a sex identification kit for scaly Coilia edulis, wherein the reagent is a primer, The detection primers designed for the 17176716th, 17176724th and 17176740th bases are: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’; The detection primers designed for the 17216848th base are: S–2–F: 5’–TGCTGTTTGGGTGTCTTT–3’ S–2–R: 5’–GTGTAGTCCCTCGTGATTG–3’.
6. Application of a detection reagent designed for bases 17176716, 17176724, 17176740 and 17216848 on chromosome 17 of the scaly Coilia edulis gene in artificial breeding of scaly Coilia edulis, wherein the reagent is a primer, The detection primers designed for the 17176716th, 17176724th and 17176740th bases are: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’; The detection primers designed for the 17216848th base are: S–2–F: 5’–TGCTGTTTGGGTGTCTTT–3’ S–2–R: 5’–GTGTAGTCCCTCGTGATTG–3’.
7. Application of a detection reagent for the polynucleotides shown in SEQ ID NO.2 and SEQ ID NO.1 in sex identification of Coilia edulis, wherein the reagent is a primer, and the detection primer for the polynucleotide shown in SEQ ID NO.2 is: S–3–F: 5’–CTTATATGTACAATGCACAAACTTTA–3’ S–3–R: 5’–CTATGGAACGCTGGTGTATTT–3’; The detection primers for the polynucleotide shown in SEQ ID NO.1 are: S–2–F: 5’–TGCTGTTTGGGTGTCTTT–3’ S–2–R: 5’–GTGTAGTCCCTCGTGATTG–3’.