A single-molecule detection and analysis method based on proximity ligation for the quantitative detection of low-abundance biomarker proteins

Abstract

The present invention provides a single-molecule detection and analysis method for detecting low-abundance biomarker proteins based on proximity ligation, which solves the technical problems of low sensitivity and low precision of existing real-time fluorescence quantitative PCR detection methods based on PLA. The present invention divides the reaction system into a plurality of micro-droplet systems, completes QPCR or PCR cyclic amplification reactions inside the micro-droplets, realizes signal amplification, and thus accurately quantifies the protein concentration. The present invention evenly distributes the reaction system in a plurality of droplet systems, performs signal amplification on them through nucleic acid amplification technology, thereby improving the signal detection rate of low-concentration proteins in the droplets, and can perform multiple protein detection quantification.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a single-molecule detection and analysis method based on proximity ligation for quantitative detection of low-abundance biomarker proteins. Background Art

[0002] Quantification of pathogen and host biomarkers is crucial for the diagnosis, monitoring, and treatment of disease. Longitudinal biomarker analysis requires rapid sample processing, the ability to detect small differences between samples (i.e., high resolution) and low concentrations of analyte (i.e., low limits of detection), while using as little biological sample as possible. High resolution is required to determine whether different readouts at different time points correspond to true biological differences or measurement noise. However, most commercially available molecular detection platforms for cytokine quantification are based on ELISA, which generally have poor sensitivity, are not suitable for simultaneous measurement with other types of biomarkers (e.g., DNA and RNA), and require large sample volumes.

[0003] Proximity ligation assay (PLA) is a highly sensitive in vitro protein analysis technique based on an enzyme-linked mechanism and a linker (a single, artificially designed linear oligonucleotide with two complementary ends to a specific target sequence. Upon hybridization, the linker and target sequence are spatially brought into close proximity, allowing the probe ends to ligate into a chain under the action of DNA ligase). This method first utilizes a pair of proximity probes to dually recognize the target molecule, generating an amplifiable detection signal. Quantitative PCR is then used to achieve timed, quantitative detection, transforming protein detection into DNA detection, resulting in extremely high sensitivity and specificity. PLA can analyze low-abundance proteins by amplifying the signal from antibody-antigen binding events, making it suitable for the development of multiplexed assays for the simultaneous quantification of protein and nucleic acid targets. However, traditional PLA relies on real-time fluorescence quantitative PCR (qPCR) readouts, standards, and a standard curve generated by curve fitting. This results in high measurement noise, low resolution, low accuracy, and low sensitivity. Summary of the Invention

[0004] The present invention aims to solve the technical problems of low sensitivity and low precision of existing PLA-based real-time fluorescence quantitative PCR detection methods, and provides a single-molecule detection and analysis method based on proximity ligation with high sensitivity and high precision for the quantitative detection of low-abundance biomarker proteins.

[0005] The present invention evenly distributes the reaction system in tens of thousands of droplet systems and amplifies their signals through nucleic acid amplification, thereby improving the signal detection rate of low-concentration proteins in the droplets and enabling multiple protein detection and quantification.

[0006] The present invention provides a single-molecule detection and analysis method for quantitative detection of low-abundance biomarker proteins based on proximity ligation, comprising the following steps:

[0007] The first step is to prepare an proximity probe pair, which consists of proximity probe I and proximity probe II; proximity probe I is composed of antibody I containing a thiol group coupled to oligonucleotide chain I containing a maleimide group at the 5' end, and the nucleotide sequence of oligonucleotide chain I is shown in SEQ ID NO. 1; proximity probe II is composed of antibody II containing a thiol group coupled to oligonucleotide chain II containing a maleimide group at the 3' end, and the nucleotide sequence of oligonucleotide chain II is shown in SEQ ID NO. 2; antibody I and antibody II are monoclonal antibodies that specifically recognize cytokines and have different antigenic determinants;

[0008] In the second step, the proximity probe I and proximity probe II are diluted with antibody diluent, and the diluted proximity probe I and proximity probe II are mixed to prepare a proximity probe mixture, wherein the concentration of proximity probe I in the proximity probe mixture is 500 ng / mL, and the concentration of proximity probe II in the proximity probe mixture is 500 ng / mL;

[0009] The third step is to take the sample to be tested, and the volume ratio of the proximity probe mixture to the sample to be tested is 1:1. The proximity probe mixture is added to the sample to be tested and incubated to prepare an incubation solution;

[0010] Step 4: Prepare a PCR reaction system, which includes 2.0 μL linker, 2.0 μL T4 DNA Ligase, 3.5 μL forward primer, 3.5 μL reverse primer, 1.5 μL Taqman Probe, 0.5 μL dNTP, 2.0 μL ATP, 15.0 μL buffer, 0.5 μL Taq DNA polymerase, 1.0 μL BSA, 1.0 μL Tween-20, and 12.5 μL ddH2O. The linker is shown in SEQ ID NO. 3, the forward primer is shown in SEQ ID NO. 4, the reverse primer is shown in SEQ ID NO. 5, and the Taqman Probe is shown in SEQ ID NO. 6. The 5' end of the Taqman Probe is labeled with a FAM fluorescent reporter group.

[0011] Step 5: Mix the PCR reaction system and incubation solution in a well plate at a volume ratio of 1:9. After mixing, run a ligation reaction in a PCR amplification module to prepare a PCR premix.

[0012] Step 6: Divide the PCR premix into numerous microdroplets with a diameter of 50 μm.

[0013] Step 7: Perform PCR amplification reaction on the numerous microdroplets;

[0014] Step 8: Collect images of the numerous microdroplets after the amplification reaction using a laser confocal microscope;

[0015] The ninth step is to process the image and calculate the number of molecules to be measured.

[0016] Preferably, the sixth step is to divide the PCR premix solution into a plurality of microdroplets using a microfluidic chip;

[0017] The microfluidic chip is provided with a sample channel, an oil phase channel, a sample injection port, an oil phase injection port, an outlet, and a collection chamber. The oil phase channel is rectangular as a whole, the sample channel is linear as a whole, the sample channel crosses one side of the oil phase channel, the oil phase injection port is connected to the other side of the oil phase channel through a channel, the sample injection port is connected to one end of the sample channel, the other end of the sample channel is connected to the collection chamber, the outlet is connected to the collection chamber through a channel, and the collection chamber is provided with a microdam array;

[0018] The PCR premix is ​​injected from the sample inlet of the microfluidic chip through a microinjection pump, and the oil phase is injected from the oil phase inlet through another microinjection pump. The PCR premix is ​​divided into numerous microdroplets and distributed in the collection chamber. The oil phase flows through the collection chamber and is discharged from the outlet; the sample inlet, oil phase inlet and outlet are sealed with a PDMS cover.

[0019] Preferably, in the ninth step, the microdroplets in the image are divided into positive droplets and negative droplets, and then the number of molecules to be measured is calculated according to the number of positive droplets and negative droplets.

[0020] Preferably, in the seventh step, the conditions for the PCR amplification reaction are: thermal activation of the amplification enzyme at 95°C for 10 minutes, followed by 35 PCR cycles after thermal activation;

[0021] In the fifth step, during the ligation reaction, the temperature of the ligation process is 37°C and the duration is 30 minutes, and the temperature of the inactivation process is 65°C and the duration is 10 minutes.

[0022] The present invention effectively divides the reaction reagents evenly into numerous tiny droplets, performs single-molecule template PCR amplification, and calculates the protein and mRNA copy number in the sample based on the number of positive reaction units, eliminating the need for standard curves and standards. Compared with traditional real-time fluorescence quantitative PCR, the method is simpler, more sensitive, and more accurate. It can directly quantify protein and mRNA copy number, quantify very small changes in the concentrations of these molecules, and achieve sub-femtomolar resolution of protein targets.

[0023] The reaction system is evenly distributed in tens of thousands of droplet systems, and its signal is amplified through nucleic acid amplification technology, which improves the signal detection rate of low-concentration proteins in the droplets.

[0024] The present invention can perform multiple protein and nucleic acid quantitative detection. The process does not involve a cleaning step and does not require additional microspheres or other means to increase the pore drop rate, thereby simplifying the operating steps and improving the detection sensitivity.

[0025] The present invention does not involve a cleaning step, which is beneficial to improving detection sensitivity.

[0026] The present invention enables simultaneous quantitative multiplex detection of protein and nucleic acid targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a flow chart for the preparation of proximity probe pairs for detecting cytokine protein concentrations;

[0028] Figure 2 is a flow chart of the detection and analysis method;

[0029] Figure 3 It is a schematic diagram of the structure of the microfluidic chip;

[0030] Figure 4 It is a schematic diagram of the structure of the microfluidic chip placed in the PCR amplification module;

[0031] Figure 5 This is a laser confocal microscopy image of different concentrations of cytokine IL-6 protein;

[0032] Figure 6 Yes Figure 5 A graph showing statistical analysis of the number of negative and positive droplets.

[0033] Explanation of symbols in the figure:

[0034] 1. Microfluidic chip, 1-1. Sample channel, 1-2. Oil phase channel, 1-3. Sample inlet, 1-4. Oil phase inlet, 1-5. Outlet, 1-6. Collection chamber; 2. Microdroplets; 3. PCR heating module, 4. Heat dissipation module. DETAILED DESCRIPTION

[0035] The present invention will be further described in detail below with reference to the accompanying drawings using specific embodiments.

[0036] This invention is a single-molecule detection and analysis method and platform for the quantitative detection of low-abundance biomarker proteins, further developed based on proximity ligation technology. The reaction system is evenly distributed in tens of thousands of droplet systems, and the signal is amplified by nucleic acid amplification technology, thereby improving the signal detection rate of low-concentration proteins in the droplets, and can simultaneously quantify multiple detections of protein and nucleic acid targets. The overall method is referenced Figure 2 .

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present invention. The reagents or raw materials used in the following examples, unless otherwise specified, are all commercially available. The antibodies used in the examples were purchased from Suzhou Jinan Protein Technology Co., Ltd., where antibody I is Human IL-6 antibody (15H5) and antibody II is Human IL-6 antibody (19D6). Antibody I and antibody II are monoclonal antibodies that specifically recognize the cytokine, and the two have different antigenic determinants; the cytokine is the cytokine IL-6.

[0038] The first step, reference Figure 1 , prepare a proximity probe pair for detecting cytokine protein concentration, the proximity probe pair consisting of proximity probe I and proximity probe II.

[0039] Step 1: Prepare proximity probe I.

[0040] Step (1), activation of NH2-modified oligonucleotide chain I:

[0041] 1) Add 3 μL of 100 μM amino-modified oligonucleotide chain I to 4.5 μL of 4 mM sulfo-SMCC crosslinker, incubate at room temperature for 1 hour, and then allow to stand to prepare mixed solution I; oligonucleotide chain I is shown in SEQ ID NO. 1.

[0042] 2) Add 20 μL of 5 M NaCl and 1 mL of 100% ice-cold ethanol (-20°C) to Mixture I, mix thoroughly, and let stand at -20°C for 30-60 min to prepare Mixture II.

[0043] 3) Centrifuge Mixture II at 13200 rpm for 8 minutes, discard the supernatant to remove excess sulfo-SMCC crosslinker, collect the precipitate, add 1 mL of 70% ice-cold ethanol, rinse to remove residual salt, and air-dry to produce maleimide-containing oligonucleotide chain I (MCC-Oligo-I).

[0044] 4) Dissolve the MCC-Oligo-I prepared in step 3) in 20 μL of PBS containing 20 mM EDTA to obtain a maleimide-containing oligonucleotide chain I (MCC-Oligo-I) solution for later use.

[0045] Step (2), introduction of sulfhydryl groups into the antibody:

[0046] 1) Pass the commercially available antibody I through a 50 kDa ultrafiltration column to remove sodium azide from the antibody protection solution to prevent it from affecting subsequent reactions;

[0047] 2) Take 50 μg of antibody I treated in step 1) and add 20 μL of 0.5 mM 2-iminothiolane hydrochloride (2-IT) to it. Incubate at room temperature for 1 hour. After 1 hour, pass it through a 50 kDa ultrafiltration column to obtain the desalted antibody I to be conjugated with the sulfhydryl group introduced.

[0048] In step (3), 20 μg of the antibody I to be coupled obtained in step (2) was added to 3 μL of the oligonucleotide chain I solution containing a maleimide group obtained in step (1). After incubation at room temperature for 1 hour, 10 μL of a 10 mM N-acetylmaleimide (NEM) aqueous solution was added to block the remaining sulfhydryl groups on the antibody. After standing at room temperature for 2 hours, the solution was passed through a YM-50 centrifugal filter column (YM-50 centrifugal filter column is a product of Millipore) to remove the uncoupled Oligo DNA and obtain the final proximity probe I. It can be seen that the proximity probe I is formed by coupling the antibody I containing a sulfhydryl group and the oligonucleotide chain I containing a maleimide group at the 5' end.

[0049] Step 2: Prepare proximity probe II.

[0050] Step (1), activation of NH2-modified oligonucleotide chain II:

[0051] 1) Add 3 μL of 100 μM amino-modified oligonucleotide chain II to 4.5 μL of 4 mM sulfo-SMCC crosslinker, incubate at room temperature for 1 hour, and then allow to stand to prepare mixed solution I; oligonucleotide chain II is shown in SEQ ID NO. 2.

[0052] 2) Add 20 μL of 5 M NaCl and 1 mL of 100% ice-cold ethanol (-20°C) to Mixture I, mix thoroughly, and let stand at -20°C for 30-60 minutes to prepare Mixture II.

[0053] 3) Centrifuge Mixture II at 13200 rpm for 8 minutes, discard the supernatant to remove excess sulfo-SMCC crosslinker, collect the precipitate, add 1 mL of 70% ice-cold ethanol, rinse the residual salt, and air-dry to obtain Maleimide-containing oligonucleotide chain II (MCC-Oligo-I).

[0054] 4) Dissolve the MCC-Oligo-I prepared in step 3) in 20 μL of PBS containing 20 mM EDTA to obtain a maleimide-containing oligonucleotide chain II (MCC-Oligo-I) solution for later use.

[0055] Step (2), introduction of sulfhydryl groups into the antibody:

[0056] 1) Pass the commercially available Antibody II through a 50 kDa ultrafiltration column to remove sodium azide from the antibody protection solution to prevent it from affecting subsequent reactions;

[0057] 2) Take 50 μg of antibody II treated in step 1) and add 20 μL of 0.5 mM 2-iminothiolane hydrochloride (2-IT) to it. Incubate at room temperature for 1 hour. After 1 hour, pass it through a 50 kDa ultrafiltration column to obtain the desalted antibody II to be conjugated with the sulfhydryl group introduced.

[0058] In step (3), 20 μg of the antibody II to be coupled prepared in step (2) was added to 3 μL of the oligonucleotide chain II solution containing a maleimide group prepared in step (1). After incubation at room temperature for 1 hour, 10 μL of a 10 mM N-acetylmaleimide (NEM) aqueous solution was added to block the remaining sulfhydryl groups on the antibody. After standing at room temperature for 2 hours, the solution was passed through a YM-50 centrifugal filter column to remove the uncoupled oligo DNA and obtain the final proximity probe II. It can be seen that the proximity probe II is formed by coupling the antibody II containing a sulfhydryl group and the oligonucleotide chain II containing a maleimide group at the 3' end.

[0059] In the second step, proximity probes I and II were each diluted to 1 μg / mL in antibody diluent (PBS containing 0.05% (v / v) Tween-20). The diluted proximity probes I and II were then mixed to prepare a proximity probe mixture. The concentration of proximity probe I in the proximity probe mixture was 500 ng / mL, and the concentration of proximity probe II in the proximity probe mixture was 500 ng / mL.

[0060] In the third step, 50 μL of the sample to be tested was taken, and 50 μL of the proximity probe mixture was added to the sample to be tested. After oscillation and mixing, the mixture was quickly centrifuged for 3-5 seconds and incubated at room temperature for 1 hour to prepare an incubation solution.

[0061] Step 4: Prepare the PCR reaction system.

[0062] Different PCR reaction systems are configured for different detection purposes.

[0063] In the first case, when detecting proteins in samples, the configured PCR reaction system is shown in Table 1 below:

[0064] Table 1:

[0065] Components Volume (μL) Linker (10 μM) 2.0 T4 DNA Ligase (600U / μL) 2.0 Forward primer (10μM) 3.5 Reverse primer (10μM) 3.5 Taqman Probe (10μM) 1.5 dNTPs (20mM) 0.5 ATP (10mM) 2.0 Buffer 15.0 Taq DNA polymerase (5U / μL) 0.5 20mg / mL BSA 1.0 10% Tween-20 1.0 <![CDATA[ddH2O]]> 12.5 total 45.0

[0066] The linker in the PCR reaction system is shown in SEQ ID NO.3, the forward primer is shown in SEQ ID NO.4, the reverse primer is shown in SEQ ID NO.5, and the Taqman probe is shown in SEQ ID NO.6. The 5' end of the Taqman probe is labeled with a FAM fluorescent reporter group.

[0067] In the second case, when detecting DNA in a sample, the configured PCR reaction system is shown in Table 2 below:

[0068] Table 2:

[0069] Components Volume (μL) Forward primer (10μM) 3.5 Reverse primer (10μM) 3.5 Taqman Probe (10μM) 1.5 dNTPs (20mM) 0.5 Buffer 15.0 Taq DNA polymerase (5U / μL) 0.5 20mg / mL BSA 1.0 10% Tween-20 1.0 <![CDATA[ddH2O]]> 18.5 total 45.0

[0070] The forward primer in the PCR reaction system is shown in SEQ ID NO.7, the reverse primer is shown in SEQ ID NO.8, and the Taqman probe is shown in SEQ ID NO.9. The 5' end of the Taqman probe is labeled with a HEX fluorescent reporter group.

[0071] In the third case, when detecting RNA in a sample, the configured PCR reaction system is shown in Table 3 below:

[0072] Table 3:

[0073] Components Volume (μL) Forward primer (10μM) 3.5 Reverse primer (10μM) 3.5 Taqman Probe (10μM) 1.5 dNTPs (20mM) 0.5 Buffer 15.5 Taq DNA polymerase (5U / μL) 0.75 MMLV ReverseTranscriptase 0.4 20mg / mL BSA 1.0 10% Tween-20 1.0 <![CDATA[ddH2O]]> 17.35 total 45.0

[0074] The forward primer in the PCR reaction system is shown in SEQ ID NO.10, the reverse primer is shown in SEQ ID NO.11, and the Taqman probe is shown in SEQ ID NO.12. The 5' end of the Taqman probe is labeled with a HEX fluorescent reporter group.

[0075] Step 5: Prepare PCR premix.

[0076] There are three scenarios. For the first scenario, when detecting protein in the sample, calculate the total amount of PCR mix required based on the number of reaction wells in the plate (PCR mix refers to the volume of the PCR reaction system obtained in step 4 multiplied by the number of wells). The PCR mix is ​​then evenly distributed into a 96-well plate (45 μL per well). Add 5 μL of incubation solution, mix thoroughly, and run a ligation reaction in the PCR amplification module of the digital PLA detector to prepare the PCR master mix. During the ligation reaction, the temperature for the ligation step is 37°C for 30 minutes, and the temperature for the inactivation step is 65°C for 10 minutes.

[0077] For the second case of detecting DNA in the sample, calculate the total amount of PCR mix required based on the number of reaction wells in the well plate, divide the PCR mix evenly into 96-well plates (45 μL per well), and then add 5 μL of incubation solution to prepare the PCR premix.

[0078] For the third scenario, when detecting RNA in a sample, calculate the total amount of PCR mix required based on the number of reaction wells in the plate. Then, aliquot the PCR mix into a 96-well plate (45 μL per well). Add 5 μL of incubation solution and mix thoroughly. Run a reverse transcription reaction in the PCR amplification module of a digital PLA reader to prepare the PCR master mix. The reverse transcription reaction is performed at 37°C for 30 minutes, and the inactivation step is performed at 70°C for 10 minutes.

[0079] Step 6: Generate microdroplets.

[0080] like Figure 3 As shown, the microfluidic chip 1 is provided with a sample channel 1-1, an oil phase channel 1-2, a sample inlet 1-3, an oil phase inlet 1-4, an outlet 1-5, and a collection chamber 1-6. The oil phase channel 1-2 is generally rectangular, and the sample channel 1-1 is generally linear. The sample channel 1-1 crosses one side of the oil phase channel 1-2. The oil phase inlet 1-4 is connected to the other side of the oil phase channel 1-2 through a channel. The sample inlet 1-3 is connected to one end of the sample channel 1-1, and the other end of the sample channel 1-1 is connected to the collection chamber 1-6. The outlet 1-5 is connected to the collection chamber 1-6 through a channel. The collection chamber 1-6 is provided with a microdam array.

[0081] Prepare two micro-syringe pumps, one of which contains the PCR premix and the other contains the oil phase.

[0082] One micro-injection pump works to inject the PCR premix from the sample injection port 1-3 of the microfluidic chip, and another micro-injection pump works to inject the oil phase from the oil phase injection port 1-4. The oil phase flows in the oil phase channel 1-2, and the PCR premix flows in the sample channel 1-1. At the cross structure, Figure 3 As shown, the PCR premix in the sample channel 1-1 is cut into nanoliter-scale microdroplets (about 50 μm in diameter) by the shear force of the flowing fluid under the action of the oil phase sandwich flow on both sides. The independent microdroplets are continuously transported to the collection chamber 1-6 one by one, so that tens of thousands of emulsion droplets can be formed within a certain period of time.

[0083] Because the distance between the microdams in collection chambers 1-6 is less than 25 μm (i.e., smaller than the radius of the microdroplets), the microdroplets are trapped at the microdams, with microdroplet 2 remaining there. All the microdroplets aggregate and concentrate in collection chambers 1-6, and the oil phase flows through collection chambers 1-6 and is discharged through outlet 1-5.

[0084] Then, the sample inlet 1-3, the oil phase inlet 1-4 and the outlet 1-5 were sealed with a PDMS cover.

[0085] The oil phase can specifically be fluorocarbon oil HFE7500, FC40, silicone oil PMX-200, 5225C; mineral oil n-tetradecane, n-dodecane, diethylhexyl carbonate, etc.

[0086] It should be noted that dividing the PCR premix into tens of thousands of microdroplets by using a microfluidic chip is only one specific implementation method. The PCR premix can also be divided into tens of thousands of microdroplets and carried by other methods.

[0087] Step 7: Transfer the microfluidic chip with tens of thousands of microdroplets to the PCR amplification module in the digital PLA detector to perform PCR amplification reaction. Figure 4 .

[0088] The conditions for the PCR amplification reaction are shown in Table 4 below: the amplification enzyme was thermally activated at 95°C for 10 min, and after thermal activation, 35 PCR cycles were performed.

[0089] Table 4:

[0090]

[0091] After the PCR amplification reaction is completed, the microfluidic chip is removed from the PCR amplification module.

[0092] Completing QPCR or PCR cyclic amplification reactions inside the microdroplets achieves signal amplification, which is beneficial for accurate quantification of protein concentration or other molecular concentrations.

[0093] Step 8. Prepare a laser confocal microscope, turn on the laser confocal microscope, set the excitation light wavelength, and select the corresponding filter.

[0094] Place the microfluidic chip under a laser confocal microscope.

[0095] In visual mode, adjust the objective lens magnification and locate the microdroplets you want to examine under the microscope. Switch to scanning mode and adjust the scanning parameters. Select an appropriate image resolution, scan the area where the microdroplets are located, and save the image.

[0096] In the ninth step, the image is computationally processed, with the data processing unit calculating the number of protein, DNA, or RNA molecules. For example, the data processing unit counts the number of positive and negative droplets, and then calculates the number of protein, DNA, or RNA molecules based on the number of positive and negative droplets (for example, using the statistical principles of Poisson distribution to calculate the number of molecules), thereby achieving single-molecule detection. Positive and negative droplets can be identified based on the type and intensity of the fluorescent signal; for example, if the fluorescent signal is green, positive droplets will appear bright green, while negative droplets will appear relatively dark.

[0097] When the test sample contains protein, the number of protein molecules is calculated. When the test sample contains DNA, the number of DNA molecules is calculated. When the test sample contains RNA, the number of RNA molecules is calculated.

[0098] Regarding protein detection, a group of different concentrations of cytokine IL-6 protein were prepared, with the concentrations being 20.0pg / mL, 2.0pg / mL, 0.20pg / mL, and 0.02pg / mL. According to the above operation procedures, we tested the protein content in the samples. The results are as follows Figure 5 and Figure 6 , it can be seen that the present invention can detect protein content as low as 0.02 pg / mL. Figure 6 A nonlinear curve fitting was performed between the signal value and concentration in the OriginLab data analysis software. The fitting equation was y = A2 + (A1-A2) / (1 +(x / x0)^p), where A1 was 302.05444 ± 105.70969, A2 was 10536.11394 ± 1280.66581, x0 was 4.63512 ± 1.61857, and p was 1.02129 ± 0.21446. The Reduced Chi-Sqr of the obtained equation was 18095.1227, the R square (COD) was 0.99965, and the adjusted R square was 0.99859.

[0099] It should be noted that dividing the PCR premix into tens of thousands of microdroplets is merely an example. The PCR premix can also be divided into thousands of microdroplets, or even hundreds of thousands of microdroplets. The specific number of microdroplets can be determined by matching the number of droplets with the laser confocal microscope for scanning and image acquisition.

[0100] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0101] The sequences in Table 5 are, in order, oligonucleotide chain I, oligonucleotide chain II, linker required for detecting protein concentration, Forward Primer required for detecting protein concentration, Reverse primer required for detecting protein concentration, Taqman probe required for detecting protein concentration, Forward primer required for detecting DNA concentration, Reverse primer required for detecting DNA concentration, Taqman probe required for detecting DNA concentration, Forward primer required for detecting RNA concentration, Reverse primer required for detecting RNA concentration, and Taqman probe required for detecting RNA concentration.

[0102] Table 5 Sequence

[0103] name Sequence (5'-3') Number of bases SEQ ID NO. Oligo-1 5'-NH2-TTTTTTTGGTTCCGGGACTAGCTATTCTCTACTCTCGTACAGTCCGT -3' 46 1 Oligo-2 5'- TACCTTGATTACCTATTAGCAGAGTGGAGGCAGAAGACGCCGCAACCTATTACTTTTTTT -NH2-3' 60 2 Linker sequence 1-2 5'-AATCAAGGTAACGGACTGTA-3'spacer C3 20 3 Forward Primer 1-2 GGTTCCGGGACTAGCTATTCTCT 23 4 Reverse Primer 1-2 AGTAATAGGTTGCGGCGTCTTC 22 5 Taqman Probe 5'-FAM-CTATTAGCAGAGTGGAGGC-3'MGB 19 6 DNA-Forward Primer CGGCATCATCCCCATCTTC 19 7 DNA-Reverse Primer TGGTCACTCTGCCCTGGAA 19 8 DNA-Probe 5'-HEX-CACCACCAACTACGC-3'MGB 15 9 RNA-Forward Primer GCCTGCCGTGTGAACCAT 18 10 RNA-Reverse Primer GCTTACATGTCTCGATCCCACTT 23 11 RNA-Probe 5’-HEX- ACTTTGTCACAGCCCAAGA-3’MGB 19 12

Claims

1. A single-molecule detection and analysis method for detecting low-abundance biomarker proteins based on proximity ligation, characterized in that: The following steps are involved: The first step is to prepare an proximity probe pair, which consists of an proximity probe I and an proximity probe II; the proximity probe I is formed by coupling an antibody I containing a thiol group and an oligonucleotide chain I containing a maleimide group at the 5' end, and the nucleotide sequence of the oligonucleotide chain I is shown in SEQ ID NO.1; the proximity probe II is formed by coupling an antibody II containing a thiol group and an oligonucleotide chain II containing a maleimide group at the 3' end, and the nucleotide sequence of the oligonucleotide chain II is shown in SEQ ID NO.2; the antibody I and the antibody II are monoclonal antibodies that specifically recognize cytokines, and the two have different antigenic determinants; The second step is to dilute the proximity probe I and the proximity probe II respectively with an antibody diluent, and then mix the diluted proximity probe I and the proximity probe II evenly to prepare a proximity probe mixed solution, wherein the concentration of the proximity probe I in the proximity probe mixed solution is 500 ng / mL, and the concentration of the proximity probe II in the proximity probe mixed solution is 500 ng / mL; The third step is to take a sample to be detected, wherein the volume ratio of the proximity probe mixture to the sample to be detected is 1:1, and the proximity probe mixture is added to the sample to be detected, and incubated to prepare an incubation solution; The fourth step is to prepare a PCR reaction system, which includes 2.0 μL linker, 2.0 μL T4 DNA Ligase, 3.5 μL Forward primer, 3.5 μL Reverse prime, 1.5 μL Taqman Probe, 0.5 μL dNTP, 2.0 μL ATP, 15.0 μL Buffer, 0.5 μL Taq DNA polymerase, 1.0 μL BSA, 1.0 μL Tween-20, and 12.5 μL ddH2O; the linker is shown in SEQ ID NO.3, the Forward primer is shown in SEQ ID NO.4, the Reverse primer is shown in SEQ ID NO.5, and the Taqman Probe is shown in SEQ ID NO.6, and the 5' end of the Taqman Probe is labeled with a FAM fluorescent reporter group; Step 5: Mix the PCR reaction system and the incubation solution in the well plate. The volume ratio of the incubation solution to the PCR reaction system is 1:

9. After mixing, run the ligation reaction in the PCR amplification module to obtain the PCR premix. During the ligation reaction: the temperature of the ligation process is 37°C and the duration is 30 minutes. The temperature of the inactivation process is 65°C and the duration is 10 minutes. The sixth step is to divide the PCR premix into numerous microdroplets through a microfluidic chip, wherein the diameter of the microdroplets is 50 um; the microfluidic chip is provided with a sample channel, an oil phase channel, a sample injection port, an oil phase injection port, an outlet, and a collection chamber, wherein the oil phase channel is rectangular as a whole, the sample channel is linear as a whole, the sample channel crosses one side of the oil phase channel, the oil phase injection port is connected to the other side of the oil phase channel through a channel, the sample injection port is connected to one end of the sample channel, the other end of the sample channel is connected to the collection chamber, the outlet is connected to the collection chamber through a channel, and the collection chamber is provided with a microdam array; The PCR premix is ​​injected from the sample injection port of the microfluidic chip through a microinjection pump, and the oil phase is injected from the oil phase injection port through another microinjection pump, the PCR premix is ​​divided into a plurality of microdroplets and distributed in the collection chamber, and the oil phase flows through the collection chamber and is discharged from the outlet; the sample injection port, the oil phase injection port and the outlet are sealed with a cover plate made of PDMS; Step 7: Perform PCR amplification reaction on the numerous microdroplets. The conditions of the PCR amplification reaction are: thermal activation of the amplification enzyme at 95°C for 10 minutes, and after thermal activation, 35 PCR cycles. Step 8, collecting images of numerous microdroplets after the amplification reaction by laser confocal microscopy; The ninth step is to perform computational processing on the image, distinguish the micro-droplets in the image into positive droplets and negative droplets, and then calculate the number of molecules to be measured based on the number of positive droplets and negative droplets.

Images