HPV nucleic acid detection kit and its preparation method and application

Abstract

The present invention relates to an HPV nucleic acid detection kit and a preparation method and application thereof. The inventor designs a dual probe detection combination of a U probe and a B probe designed for an HPV gene sequence, and based on this, develops a multiple nucleic acid detection kit and a PCR melting curve method for detecting multiple targets in a single tube. By introducing an L-type primer and a universal primer system: the uniformity of amplification is ensured; the difference between different amplicons in the amplification product caused by the difference in amplification efficiency between specific primers is eliminated. This method has a short operation time, and the detection can be completed within 3 hours. The lid does not need to be opened during the detection process, which can reduce PCR product contamination, and the detection specificity is high, which can reduce nonspecific amplification in the PCR reaction, improve the methodological detection sensitivity, and the result is easy to interpret.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a HPV nucleic acid detection kit and a preparation method and application thereof. Background Art

[0002] Human papillomavirus (HPV) is a major pathogen that causes benign genital lesions and cervical cancer in women. HPV can be divided into low-risk, medium-risk, and high-risk types according to the risk of cervical cancer. Persistent or repeated infection with high-risk HPV is the main cause of cervical cancer and high-grade cervical intraepithelial lesions (CIN2 / 3).

[0003] According to the CFDA's classification of human papillomavirus (HPV), 18 medium- and high-risk types of HPV include: 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 73, and 82; low-risk types of HPV include 6, 11, 40, 42, 43, 81, 83, etc. There are many HPV pathogen detection technologies, the main methods are acetic acid staining screening, iodine test screening, Pap smear, liquid-based cytology, colposcopy, histological testing, molecular testing, etc. However, clinical characteristics and routine laboratory tests require professional doctors to interpret, and it takes a long time.

[0004] Patent CN111020061B discloses a kit and method for detecting human papillomavirus using high-throughput sequencing, which can detect up to 40 types of HPV at the same time. By interpreting the number of reads of the test results, it can avoid missing low-abundance types due to the suppression of low-abundance types by high-abundance types, but it requires a lot of manpower and material resources to operate, and the operator needs a rich experimental foundation. The entire experimental process is time-consuming, and the results also require professional bioinformatics analysis and other limitations.

[0005] Patent CN103184294A discloses a multiplex detection method and kit for simultaneously detecting HPV16 and HPV18 using PCR. Two pairs of specific primers and two Taqman primer probes are designed for the DNA sequences of HPV16 and 18, respectively, and the probes are labeled with different fluorescent groups, so as to accurately detect and distinguish HPV16 and 18 infections in the same amplification tube. However, it has the limitation of low throughput due to the limitation of the number of fluorescent channels detected by the real-time fluorescent PCR instrument, which makes it difficult to meet the various HPV detection needs.

[0006] Patent CN101487042A discloses a method and kit for multiple detection of HPV by using a solid phase carrier substrate and oligonucleotide probes of various HPV subtypes to prepare a DNA microarray chip. By designing a specific type of primer probe and combining it with the chip to form an array, the effect of high-throughput detection of HPV types can be achieved. However, the method is limited by the high cost and high process requirements caused by the use of the chip.

[0007] A large number of literature and patents at home and abroad have reported that the use of molecular detection technology, especially PCR detection technology, has significant advantages such as rapid detection, simple operation, and good specificity. The real-time fluorescence quantitative PCR method is a commonly used nucleic acid detection method in molecular biology. Compared with the ordinary PCR method, it is easy to operate and widely used. During the PCR amplification of the target gene of the sample to be tested, the fluorescence signal generated by the reaction system is monitored in real time by the instrument to detect the PCR process in real time. Ordinary PCR amplification technology requires electrophoresis analysis of the product after the amplification is completed. The analysis process is cumbersome and time-consuming. At the same time, the opening of the PCR product may cause contamination of the laboratory environment.

[0008] The methods for achieving fluorescent signals are mainly divided into two categories: probe method and dye method. The probe method adds oligonucleotide probes labeled with fluorescent groups to the reaction system, and the signal release of the probe is used to achieve specific detection of the target sequence; the dye method adds double-stranded DNA fluorescent dyes to the reaction system, and the fluorescent dyes bind to the minor groove of the DNA double strand to achieve detection of the target sequence.

[0009] In the real-time detection mode, the detection of the target sequence and PCR amplification are carried out simultaneously without the need for additional steps. Therefore, the real-time detection mode is simple and direct. However, the maximum number of target sequences that can be detected in a single-tube detection in this mode is limited by the number of fluorescence detection channels of the real-time PCR instrument, which generally does not exceed 6. Therefore, based on the advantages of simple and direct methodology, it is necessary to improve the real-time fluorescence quantitative PCR method in order to detect more target genes in a single-tube detection.

[0010] As mentioned in the review, although a variety of human papillomavirus detection methods have been reported, they all have their own limitations. Therefore, there is still a need to develop a more rapid, simple, sensitive, specific, and low-cost high-throughput human papillomavirus nucleic acid detection method. Summary of the invention

[0011] Based on this, one of the objectives of the present invention is to provide a dual probe combination for multiple nucleic acid detection.

[0012] Including the following technical solutions:

[0013] A double probe combination for multiple nucleic acid detection, comprising a U probe and a B probe for a target gene sequence, wherein the U probe is composed of: a 5' terminal region, a stem loop region, and a 3' terminal region from the 5' end to the 3' end; the B probe is composed of: a 5' terminal region and a 3' terminal region from the 5' end to the 3' end; the 5' terminal region sequence of the U probe is a sequence complementary to a specific target gene sequence, the 3' terminal region sequence is a unique sequence in nature, the stem loop region sequence is 5 bp-45 bp in length, and the 5' end of the stem loop region sequence is A fluorescent quenching group is modified, and a fluorescent reporter group is modified at the 3' end of the stem-loop sequence; the 3' end sequence of the B probe is a sequence complementary to the target gene sequence, and the 5' end sequence is a unique sequence in nature that is reversely complementary to the 3' end sequence of the U probe; when the U probe and the B probe are simultaneously bound to the target fragment, the distance between the 3' end of the 5' end sequence of the U probe and the 5' end of the 5' end sequence of the B probe is 5 bp to 15 bp; the unique sequence in nature is a sequence that does not hybridize with the target gene sequence.

[0014] Another object of the present invention is to provide the use of the above-mentioned dual probe combination in the preparation of a kit or a detection reagent of the kit.

[0015] Another object of the present invention is to provide a multiple nucleic acid detection kit, which includes an amplification primer set for a target nucleic acid sequence and the above-mentioned double probe combination.

[0016] Another object of the present invention is to provide the use of the above-mentioned multiple nucleic acid detection kit in human papillomavirus detection.

[0017] Another object of the present invention is to provide a method for detecting human papillomavirus.

[0018] Including the following technical solutions:

[0019] Obtaining nucleic acid from a biological sample to be tested;

[0020] The above-mentioned multiple nucleic acid detection kit is used to perform PCR detection on the above-mentioned biological sample nucleic acid.

[0021] The inventors of the present invention have conducted in-depth research on the genetic information of human papillomavirus (HPV) and designed a dual detection probe combination of a U probe and a B probe for the HPV gene sequence. Through the precise design of the U probe and B probe structures, when detecting a specific HPV type, the 3' end of the U probe and the 5' end of the B probe are reversely complementary. At the same time, the 5' end of the U probe needs to match the template and the 3' end of the B probe needs to match the template in order to successfully detect, thereby sufficiently ensuring the detection specificity. Combined with the optimization screening of the specific distance between the U probe and the B probe, it was found that when the U probe and the B probe bind to the target fragment at the same time, the distance between the 3' end of the 5' end sequence of the U probe and the 5' end of the 5' end sequence of the B probe is 5bp to 10bp, the probe detection performance is optimal. At the same time, when the relative position of the quenching group and the fluorescent group on the U probe is 10bp to 45bp, it can effectively avoid the poor quenching effect caused by the relative position of the quenching group and the fluorescent group being too far apart, that is, the background fluorescence becomes stronger, resulting in a worse real detection effect. The above detection system effectively overcomes the limitations of traditional real-time fluorescence quantitative PCR typing, realizes single-tube multiple typing through special signals and melting curve analysis, and greatly improves the detection specificity through matching with the template and complementarity between the U probe and the B probe.

[0022] Based on this, a multiple nucleic acid detection kit and a PCR melting curve method for detecting multiple targets in a single tube were developed. By introducing L-type primers and universal primer systems, the uniformity of amplification was ensured; the differences in different amplicons in the amplified products caused by the differences in amplification efficiency between specific primers were eliminated. This method has a short operation time and can complete the detection within 3 hours. The lid does not need to be opened during the detection process, which can reduce PCR product contamination. It has high detection specificity, can reduce nonspecific amplification in PCR reactions, improve the sensitivity of methodological detection, and the results are easy to interpret. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The schematic diagram is a schematic diagram of the design principle of the primer and probe structure in the HPV nucleic acid detection kit of the present invention.

[0024] Figure 2 This is a graph showing the results of detecting HPV16 type samples using the kit of the present invention in Example 2.

[0025] Figure 3 This is a graph showing the results of detecting HPV18 type samples using the kit of the present invention in Example 2.

[0026] Figure 4 This is a graph showing the results of detecting HPV52 type samples using the kit of the present invention in Example 2.

[0027] Figure 5This is a graph showing the results of detecting HPV58 type samples using the kit of the present invention in Example 2.

[0028] Figure 6 This is a result diagram of detecting multiple samples using the kit of the present invention in Example 2, that is, in the FAM channel, specific HPV16, HPV18, HPV58, and HPV52 type melting peaks can be detected simultaneously.

[0029] Figure 7 This is a schematic diagram of HPV16 type sample detection when the relative position of the U probe and the B probe is 5 bp in Example 4.

[0030] Figure 8 This is a schematic diagram of HPV16 type sample detection when the relative position of the U probe and the B probe is 10 bp in Example 4.

[0031] Fig. 9 This is a schematic diagram of HPV16 type sample detection when the relative position of the U probe and the B probe is 15 bp in Example 4.

[0032] Fig.10 This is a schematic diagram of detecting HPV16 type samples when the relative position of the quenching group and the fluorescent group on the U probe is 5 bp in Example 5.

[0033] Fig.11 This is a schematic diagram of detecting HPV16 type samples when the relative position of the quenching group and the fluorescent group on the U probe is 10 bp in Example 5.

[0034] Fig.12 This is a schematic diagram of detecting HPV16 type samples when the relative position of the quenching group and the fluorescent group on the U probe is 25 bp in Example 5.

[0035] Fig.13 This is a schematic diagram of detecting HPV16 type samples when the relative position of the quenching group and the fluorescent group on the U probe is 45 bp in Example 5. DETAILED DESCRIPTION

[0036] The experimental methods in the following examples where specific conditions are not specified are generally carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0037] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0038] Furthermore, as used herein, the term "or" is an inclusive "or" symbol, and is equivalent to the term "and / or" unless the context clearly dictates otherwise.

[0039] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0040] The present invention is further described in detail below with reference to specific embodiments.

[0041] Some embodiments of the present invention provide a dual probe combination for multiple nucleic acid detection, which includes a U probe and a B probe for a target gene sequence, wherein the composition of the U probe from the 5' end to the 3' end is: a 5' end region, a stem-loop region, and a 3' end region; the composition of the B probe from the 5' end to the 3' end is: a 5' end region and a 3' end region; the 5' end region sequence of the U probe is a sequence complementary to the specific target gene sequence, the 3' end region sequence is a unique sequence in nature, the stem-loop region sequence is 10-45 bp in length, and the stem-loop region sequence is 10-45 bp in length. The 5' end of the sequence is modified with a fluorescent quenching group, and the 3' end of the stem-loop sequence is modified with a fluorescent reporter group; the 3' end sequence of the B probe is a sequence complementary to the target gene sequence, and the 5' end sequence is a unique sequence in nature that is reversely complementary to the 3' end sequence of the U probe; when the U probe and the B probe are simultaneously bound to the target fragment, the distance between the 3' end of the 5' end sequence of the U probe and the 5' end of the 5' end sequence of the B probe is 5 bp to 15 bp; the unique sequence in nature is a sequence that does not hybridize with the target gene sequence.

[0042] In some embodiments, when the U probe and the B probe bind to the target fragment simultaneously, the distance between the 3' end of the 5' terminal sequence of the U probe and the 5' end of the 5' terminal sequence of the B probe is 5 bp to 10 bp.

[0043] In some embodiments, the distance between the 5' end and the 3' end of the stem-loop sequence of the U probe is 5 bp to 45 bp. More preferably, it is 10 bp to 45 bp, at which time the distance between the fluorescent quencher group modified at the 5' end of the stem-loop sequence of the U probe and the fluorescent reporter group modified at the 3' end is most appropriate, thereby effectively avoiding the poor quenching effect caused by the relative position of the quencher group and the fluorescent group being too far apart, that is, the background fluorescence becomes stronger, resulting in poor real detection effect.

[0044] Some embodiments of the present invention also provide the use of the above dual probe combination in preparing a kit or a detection reagent of the kit.

[0045] Some embodiments of the present invention further provide a multiple nucleic acid detection kit, which includes an amplification primer set for a target nucleic acid sequence and the above-mentioned double probe combination.

[0046] In some of the embodiments, the above-mentioned amplification primer set includes an L primer pair, and each L primer in the L primer pair is composed of: 5' terminal region, 3' terminal region from 5' end to 3' end; the 5' terminal region sequence length is 15 to 25 bp; the 3' terminal region is a sequence complementary to the specific target gene sequence.

[0047] In some of the embodiments, the amplification primer set further includes a universal primer pair, and further, each universal primer in the universal primer pair is reverse complementary to the 5' end region sequence of each L primer in the L primer pair.

[0048] In some embodiments, the above-mentioned multiple nucleic acid detection kit includes any at least one of the following components: the first group: L primer pair, U probe and B probe for HPV16, wherein the L primer pair sequence is shown in SEQ ID NO.1 to SEQ ID NO.2, the U probe sequence is shown in SEQ ID NO.3, and the B probe sequence is shown in SEQ ID NO.4; the second group: L primer pair, U probe and B probe for HPV18, wherein the L primer pair sequence is shown in SEQ ID NO.5 to SEQ ID NO.6, the U probe sequence is shown in SEQ ID NO.7, and the B probe sequence is shown in SEQ ID NO.8; the third group: L primer pair, U probe and B probe for HPV58, wherein the L primer pair sequence is shown in SEQ ID NO.9 to SEQ ID NO.10, the U probe sequence is shown in SEQ ID NO.11, and the B probe sequence is shown in SEQ ID NO.12; the fourth group: L primer pair, U probe and B probe for HPV52, wherein the L primer pair sequence is shown in SEQ ID NO.13 to SEQ ID NO. The U probe sequence is shown in SEQ ID NO.14, the B probe sequence is shown in SEQ ID NO.15, and the B probe sequence is shown in SEQ ID NO.16. In some embodiments, the multiple nucleic acid detection kit further includes a universal primer pair, and further, the universal primer pair sequence is shown in SEQ ID NO.47 to SEQ ID NO.48.

[0049] Some embodiments of the present invention also provide the use of the above-mentioned multiple nucleic acid detection kit in human papillomavirus detection.

[0050] Some embodiments of the present invention also provide a method for detecting human papillomavirus.

[0051] Including the following technical solutions:

[0052] Obtaining nucleic acid from a biological sample to be tested;

[0053] The above-mentioned multiple nucleic acid detection kit is used to perform PCR detection on the above-mentioned biological sample nucleic acid.

[0054] In some of the embodiments, the reaction products obtained by the PCR detection are subjected to melting curve analysis to determine the types of human papillomavirus nucleic acid sequences present in the reaction system, thereby achieving multiple nucleic acid detection.

[0055] In some embodiments, the reaction procedure of the PCR detection is touchdown PCR.

[0056] In some embodiments, the biological sample is selected from serum, plasma, whole blood, fresh tissue, formalin-fixed paraffin-embedded tissue, urine, bacterial culture, virus culture, cell line culture, and artificially synthesized plasmid.

[0057] In some embodiments, the biological sample nucleic acid is RNA, the reaction system further includes reverse transcriptase, and the reaction procedure further includes reverse transcription PCR.

[0058] Example 1 Primer probe composition for HPV detection

[0059] For the HPV to be detected, relevant professional literature was consulted, the conserved segments of the virus were determined based on literature research, at least one specific target gene sequence was selected, and the primer design software Primer Premier 5.0 was used to design the upstream oligonucleotide primer L-type primer-F (LF primer), the downstream oligonucleotide primer L-type primer-R (LR primer), the U-type probe (U probe) sequence target gene region, the Bridge probe (B probe) sequence target gene region, and the universal primer based on the selected specific target gene sequence.

[0060] Among them, LF and LR respectively contain sequences complementary to the specific target gene sequence and a unique sequence in nature (universal primer), the U probe is divided into two parts: a specific target sequence and a unique sequence in nature, the target gene region of the U probe is complementary to the specific target sequence, and its 3' end is connected to an artificially introduced sequence (stem loop region and 3' end), and the B probe is divided into two parts: a specific target sequence and a unique sequence in nature, the target gene region of the B probe is complementary to the specific target sequence, and its 5' end is connected to an artificially introduced sequence, and the unique sequence in nature in the B probe is complementary to the unique sequence in nature located at the 3' end of the U probe. Different nucleic acids are detected by the specific target sequences in the U probe and the B probe, and multiple melting curves are analyzed by designing the unique sequences in nature in the U probe and the B probe.

[0061] L primer: It consists of 2 parts. The 5' end is a 15-25 base sequence that is unique in nature and serves as a universal primer, and the 3' end is a sequence that is complementary to the specific target gene sequence.

[0062] U probe: provides a fluorescent signal release system to achieve melting curve analysis. It consists of two parts, the 5' end is a sequence complementary to the specific target gene sequence, and the 3' is a unique sequence in nature (stem loop region and 3' end), and then modified C3 is closed to prevent non-specific extension. A fluorescent quenching group is used at the 5' end of the unique sequence in nature to provide a quenching function, and a fluorescent reporter group is used in the middle position to play a role in fluorescence analysis. The relative position of the quenching group and the fluorescent group is 10bp-45bp, and in the present invention, the fluorescent reporter group includes but is not limited to FAM, HEX, ROX, VIC, CY5, TAMRA, TET, CY3 and JOE, and the fluorescent quenching group includes but is not limited to BHQ1 and BHQ2.

[0063] B probe: It consists of 2 parts. The 5' end is a unique sequence in nature, which is complementary to the unique sequence in nature in the U probe; the 3' end is a sequence complementary to the specific target gene sequence.

[0064] U probe and B probe: The relative position of the two probes is 5-10bp.

[0065] Universal primers: After the third cycle of touchdown PCR amplification, all PCR products generated in the first two cycles can be amplified to ensure uniform amplification of each target.

[0066] The reaction process of the above primer probes when testing the sample to be tested is as follows:

[0067] (1) contacting the nucleic acid of the sample to be tested with the upstream and downstream primers described in (1), the U probe, the B probe and a DNA polymerase having 5'-3' exonuclease activity, and placing them in a PCR operation system, wherein the U probe is cleaved by the DNA polymerase to produce a free 3' terminal region, and the B probe is cleaved by the DNA polymerase to leave a 5' terminal region complementary to the U probe;

[0068] (2) The U probe is a fluorescent probe, with a complementary sequence to the specific target gene sequence at the 5' end and a unique sequence in nature at the 3' end. It is then modified with C3 to block nonspecific extension. A fluorescent quencher group is used at the 5' end of the unique sequence in nature to provide a quenching function, and a fluorescent reporter group is used in the middle to play a role in fluorescence analysis. Under natural conditions or when matching with the template, the fluorescent signal emitted by the reporter group is absorbed by the quencher group due to the principle of energy resonance transfer, and no fluorescent signal is generated.

[0069] (3) After enzyme cleavage, the 5' end region of probe B is complementary to a portion of the unique sequence of probe U in nature and undergoes an extension reaction under the action of nucleic acid polymerase.

[0070] (4) Since the PCR product produced in step (3) is in a double-stranded state, the fluorescent group and the quenching group are separated to generate fluorescence, so a melting curve analysis can be performed. Based on the results of the melting curve analysis, it is confirmed whether each target nucleotide sequence to be tested is present in the sample, and then it is determined whether the human papillomavirus corresponding to each target nucleic acid sequence is present in the sample to be tested.

[0071] Example 2 A HPV typing test kit

[0072] According to the primer-probe system for HPV detection described in Example 1, a kit capable of simultaneously detecting HPV16, HPV18, HPV58, and HPV52 was prepared, wherein the PCR primer-probe sequences are shown in Table 2-1 below, and the amplification sequence information for determining the Tm value is shown in Table 2-2 below:

[0073] Table 2-1

[0074]

[0075]

[0076]

[0077] Among them, "LF" represents the upstream primer, "LR" represents the downstream primer, "TF" represents the upstream universal primer, "TR" represents the downstream universal primer, "U" represents the probe with a fluorescent group, and "B" represents the probe connecting the template and the "U" probe.

[0078] Table 2-2

[0079] SEQ ID NO. Type Sequence 5'-3' Tm 17 16 tcgactcgtacttccgttggacgtagaaccataacaggtagtg 83.94 18 18 cgtccacttcaggttacgtaatgttagctcgttcaccgttggttgatgtttag 83.98 19 58 tcgcaaagtgtcataacgctagagctacaaggatcgggtgcatcgtataagagtt 83.99 20 52 tcgcaggatctttggccctcgactgcccaatccgtgtctggtattacg 83.86

[0080] The real-time fluorescence quantitative PCR reaction system is prepared as shown in Table 2-3 below:

[0081] Table 2-3

[0082]

[0083]

[0084] After the reaction system is prepared, it is shaken and mixed, centrifuged, and then loaded onto a macrostone (SLAN-96S) machine.

[0085] The PCR reaction program was set according to Table 2-4:

[0086] Table 2-4

[0087]

[0088] Result interpretation criteria:

[0089] The results of the Tm value detection are automatically interpreted by the Macrostone (SLAN-96S) software. The detection of different HPV types depends on the corresponding fluorescence and specific Tm value.

[0090] Result analysis:

[0091] The above kit was used to test 30 samples using the above test method. The test results are shown in the figure below. Figure 2-5 It can be seen that the kit of the present invention can accurately detect samples of HPV16, HPV18, HPV58, and HPV52 types.

[0092] Example 3 Probe sequence optimization

[0093] In order to further study the effect of the probe sequence on the detection performance of the kit, U probe and B probe sequences were designed for detecting HPV16, HPV18, HPV58, and HPV52, respectively, as shown in Table 3-1 below (wherein the primer sequences are the same as those in Example 2):

[0094] 3-1

[0095]

[0096]

[0097] The above kit was used to test 30 samples using the detection method described in Example 2. The test results are shown in the figure Figure 6 It can be seen that in the FAM channel, the specific HPV16, HPV18, HPV58, and HPV52 type melting peaks can be detected simultaneously in a single tube, indicating that the kit of the present invention can effectively detect multiple HPV samples. Further analysis found that the amplification sequence information that determines the Tm value is shown in Table 3-2 below:

[0098] Table 3-2

[0099] SEQ ID NO. Type Sequence 5'-3' Tm 29 16 tcgactctacttgttggacgtagaaccataacaggtagtg 71.97 30 18 cgtacttcagttagtaatgttatactgttcacgttggttgatgtttag 76.21 31 58 tgcgcaaagtgtcataacgctagagctacaaggatcgggtgcatcgtataagagtt 81.11 32 52 tcgcagcatctttcctcgagctgcccaatccgtgtctggtattacg 85.31

[0100] Combined with Table 3-2 above, it can be seen that the above test results can detect specific HPV16, HPV18, HPV58, and HPV52 type melting peaks simultaneously in a single tube. Therefore, in a multiple sample detection system, the probe sequence designed in this embodiment is more conducive to multiple sample detection.

[0101] Example 4: Testing the Relative Positions of U Probe and B Probe in a Single Sample

[0102] In order to further explore the influence of the relative positions of the U probe and the B probe on the detection performance in the detection system for a single type, the primer probe design of the detection system for detecting HPV16 type alone is taken as an example, wherein the PCR primer probe sequence is shown in Table 4-1 below (wherein the primer sequence is the same as that in Example 2):

[0103] Table 4-1

[0104]

[0105] In the table, the “-” after the “-” indicates the position and name of the modifying group.

[0106] The above kit was used to test 30 samples using the detection method described in Example 2. The test results are shown in the figure below. Figure 7-9 As shown, it can be seen that HPV16 type-specific melting peaks can be generated in the FAM channel, but the melting peaks at the relative positions of 5 bp and 10 bp are higher than the melting peak at the relative position of 15 bp. Example 5 Relative positions of the quenching group and the fluorescent group on the U probe in a single sample test

[0107] In order to further explore the influence of the relative position of the quenching group and the fluorescent group on the U probe in the detection system for a single type (i.e., the distance between the 5' end and the 3' end of the stem-loop sequence of the U probe) on the detection performance, the primer probe design of the detection system for detecting HPV16 type alone is taken as an example, wherein the PCR primer probe sequence is shown in Table 5-1 below (wherein the primer sequence is the same as that in Example 2):

[0108] Table 5-1

[0109]

[0110]

[0111] Note: The "-" after the table indicates the position and name of the modification group, and the bases in the sequence table with italic fonts indicate the connection position of the quenching group, and the bases in italic bold fonts indicate the connection position of the fluorescent group.

[0112] The above kit was used to test 30 samples using the detection method described in Example 4. The test results are shown in the figure below. Figure 10-13 As shown, it can be seen that HPV16 type-specific melting peaks can be generated in the FAM channel, but the melting peaks at relative positions of 10bp, 25bp and 45bp have higher and consistent peak heights, and are higher than the melting peak at a relative position of 5bp.

[0113] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. Sequence Listing <110> Guangzhou Jinqirui Biotechnology Co., Ltd. <120> HPV nucleic acid detection kit and its preparation method and application <160> 48 <170> SIPOSequenceListing 1.0 <210> 1 <211> 36 <212> DNA <213> Artificial Sequence <400> 1 aaaatcgttg atagaattac accggacaga gcccat 36 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <400> 2 ggatataata gctgctatat cggtagatta tggtttctga g 41 <210> 3 <211> 67 <212> DNA <213> Artificial Sequence <400> 3 aaccttttgt tgcaagtgtg actctcgact cgtacttccg ttggacgtag aaccataaca 60 ggtagtg 67 <210> 4 <211> 47 <212> DNA <213> Artificial Sequence <400> 4 cactacctgt tatggttcta cgtccttgtg cgtacaaagc acacacg 47 <210> 5 <211> 41 <212> DNA <213> Artificial Sequence <400> 5 aaaatcgttg atagaattac gacgagccga accacaacgt c 41 <210> 6 <211> 43 <212> DNA <213> Artificial Sequence <400> 6 ggatataata gctgctatat cctggatcag ccattgttgc tta 43 <210> 7 <211> 76 <212> DNA <213> Artificial Sequence <400> 7 agctcagcag acgaccttcg agccgtccac ttcaggttac gtaatgttag ctcgttcacc 60 gttggttgat gtttag 76 <210> 8 <211> 46 <212> DNA <213> Artificial Sequence <400> 8 ctaaacatca accaacggtg aacctgtttc tgaacaccct gtcctt 46 <210> 9 <211> 41 <212> DNA <213> Artificial Sequence <400> 9 aaaatcgttg atagaattac ggacagggcg ctgtgcagtg t 41 <210> 10 <211> 42 <212> DNA <213> Artificial Sequence <400> 10 ggatataata gctgctatat ctccatctgg cctgtccaag cc 42 <210> 11 <211> 78 <212> DNA <213> Artificial Sequence <400> 11 tgagaggaaa caacccaacg ctatcgcaaa gtgtcataac gctagagcta caaggatcgg 60 gtgcatcgta taagagtt 78 <210> 12 <211> 49 <212> DNA <213> Artificial Sequence <400> 12 aactcttata cgatgcaccc gatcttttag atttacatcc tgaaccaac 49 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <400> 13 aaaatcgttg atagaattac ggacaagcag aacaagccac 40 <210> 14 <211> 43 <212> DNA <213> Artificial Sequence <400> 14 ggatataata gctgctatat cgttgtttat agccgtgcac agc 43 <210> 15 <211> 69 <212> DNA <213> Artificial Sequence <400> 15 acggctatgc attcatagca ctcgcaggat ctttggccct cgactgccca atccgtgtct 60 ggtattacg 69 <210> 16 <211> 46 <212> DNA <213> Artificial Sequence <400> 16 cgtaatacca gacacggatt gggccttcgt actctacagc agatgc 46 <210> 17 <211> 43 <212> DNA <213> Artificial Sequence <400> 17 tcgactcgta cttccgttgg acgtagaacc ataacaggta gtg 43 <210> 18 <211> 53 <212> DNA <213> Artificial Sequence <400> 18 cgtccacttc aggttacgta atgttagctc gttcaccgtt ggttgatgtt tag 53 <210> 19 <211> 55 <212> DNA <213> Artificial Sequence <400> 19 tcgcaaagtg tcataacgct agagctacaa ggatcgggtg catcgtataa gagtt 55 <210> 20 <211> 48 <212> DNA <213> Artificial Sequence <400> 20 tcgcaggatc tttggccctc gactgcccaa tccgtgtctg gtattacg 48 <210> 21 <211> 64 <212> DNA <213> Artificial Sequence <400> 21 aaccttttgt tgcaagtgtg actctcgact ctacttgttg gacgtagaac cataacaggt 60 agtg 64 <210> 22 <211> 42 <212> DNA <213> Artificial Sequence <400> 22 cctgttatgg ttctacgtcc ttgtgcgtac aaagcacaca cg 42 <210> 23 <211> 69 <212> DNA <213> Artificial Sequence <400> 23 agctcagcag acgaccttcg agccgtactt cagttagtaa tgttactgtt cacgttggtt 60 gatgtttag 69 <210> 24 <211> 46 <212> DNA <213> Artificial Sequence <400> 24 ctaaacatca accaacggtg aacctgtttc tgaacaccct gtcctt 46 <210> 25 <211> 79 <212> DNA <213> Artificial Sequence <400> 25 tgagaggaaa caacccaacg ctatgcgcaa agtgtcataa cgctagagct acaaggatcg 60 ggtgcatcgt ataagagtt 79 <210> 26 <211> 49 <212> DNA <213> Artificial Sequence <400> 26 aactcttata cgatgcaccc gatcttttag atttacatcc tgaaccaac 49 <210> 27 <211> 67 <212> DNA <213> Artificial Sequence <400> 27 acggctatgc attcatagca ctcgcagcat ctttcctcga gctgcccaat ccgtgtctgg 60 tattacg 67 <210> 28 <211> 46 <212> DNA <213> Artificial Sequence <400> 28 cgtaatacca gacacggatt gggccttcgt actctacagc agatgc 46 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <400> 29 tcgactctac ttgttggacg tagaaccata acaggtagtg 40 <210> 30 <211> 46 <212> DNA <213> Artificial Sequence <400> 30 cgtacttcag ttagtaatgt tactgttcac gttggttgat gtttag 46 <210> 31 <211> 56 <212> DNA <213> Artificial Sequence <400> 31 tgcgcaaagt gtcataacgc tagagctaca aggatcgggt gcatcgtata agagtt 56 <210> 32 <211> 46 <212> DNA <213> Artificial Sequence <400> 32 tcgcagcatc tttcctcgag ctgcccaatc cgtgtctggt attacg 46 <210> 33 <211> 67 <212> DNA <213> Artificial Sequence <400> 33 aaccttttgt tgcaagtgtg actctcgact cgtacttccg ttggacgtag aaccataaca 60 ggtagtg 67 <210> 34 <211> 47 <212> DNA <213> Artificial Sequence <400> 34 cactacctgt tatggttcta cgtccttcgg ttgtgcgtac aaagcac 47 <210> 35 <211> 67 <212> DNA <213> Artificial Sequence <400> 35 aaccttttgt tgcaagtgtg actctcgact cgtacttccg ttggacgtag aaccataaca 60 ggtagtg 67 <210> 36 <211> 47 <212> DNA <213> Artificial Sequence <400> 36 cactacctgt tatggttcta cgtccttgtg cgtacaaagc acacacg 47 <210> 37 <211> 67 <212> DNA <213> Artificial Sequence <400> 37 aaccttttgt tgcaagtgtg actctcgact cgtacttccg ttggacgtag aaccataaca 60 ggtagtg 67 <210> 38 <211> 47 <212> DNA <213> Artificial Sequence <400> 38 cactacctgt tatggttcta cgtcccgtac aaagcacaca cgtagac 47 <210> 39 <211> 97 <212> DNA <213> Artificial Sequence <400> 39 aaccttttgt tgcaagtgtg actctgacac tagcatcagc gagcacggac ttgctactgc 60 agtacgtacg atggacgtag aaccataaca ggtagtg 97 <210> 40 <211> 47 <212> DNA <213> Artificial Sequence <400> 40 cactacctgt tatggttcta cgtccttcgg ttgtgcgtac aaagcac 47 <210> 41 <211> 97 <212> DNA <213> Artificial Sequence <400> 41 aaccttttgt tgcaagtgtg actctgacac tagcatcagc gagcacggac ttgctactgc 60 agtacgtacg atggacgtag aaccataaca ggtagtg 97 <210> 42 <211> 47 <212> DNA <213> Artificial Sequence <400> 42 cactacctgt tatggttcta cgtccttgtg cgtacaaagc acacacg 47 <210> 43 <211> 97 <212> DNA <213> Artificial Sequence <400> 43 aaccttttgt tgcaagtgtg actctgacac tagcatcagc gagcacggac ttgctactgc 60 agtacgtacg atggacgtag aaccataaca ggtagtg 97 <210> 44 <211> 47 <212> DNA <213> Artificial Sequence <400> 44 cactacctgt tatggttcta cgtcccgtac aaagcacaca cgtagac 47 <210> 45 <211> 97 <212> DNA <213> Artificial Sequence <400> 45 aaccttttgt tgcaagtgtg actctgacac tagcatcagc gagcacggac ttgctactgc 60 agtacgtacg atggacgtag aaccataaca ggtagtg 97 <210> 46 <211> 47 <212> DNA <213> Artificial Sequence <400> 46 cactacctgt tatggttcta cgtcccgtac aaagcacaca cgtagac 47 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <400> 47 aaaatcgttg atagaattac 20 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <400> 48 ggatataata gctgctatat c 21

Claims

1. A dual-probe composition for multiple nucleic acid detection, characterized in that: The dual probe composition comprises an L primer pair, a U probe and a B probe for a target gene sequence, and the dual probe composition is selected from at least one of the following groups: The first group: L primer pair, U probe and B probe for HPV16, wherein the L primer pair sequence is shown in SEQ ID NO.1 to SEQ ID NO.2, the U probe sequence is shown in SEQ ID NO.3, and the B probe sequence is shown in SEQ ID NO.4; The second group: L primer pair, U probe and B probe for HPV18, wherein the L primer pair sequence is shown in SEQ ID NO.5 to SEQ ID NO.6, the U probe sequence is shown in SEQ ID NO.7, and the B probe sequence is shown in SEQ ID NO.8; The third group: L primer pair, U probe and B probe for HPV58, wherein the L primer pair sequence is shown in SEQ ID NO.9 to SEQ ID NO.10, the U probe sequence is shown in SEQ ID NO.11, and the B probe sequence is shown in SEQ ID NO.12; The fourth group: L primer pair, U probe and B probe for HPV52, wherein the L primer pair sequence is shown in SEQ ID NO.13 to SEQ ID NO.14, the U probe sequence is shown in SEQ ID NO.15, and the B probe sequence is shown in SEQ ID NO.

16.

2. The dual-probe composition for multiple nucleic acid detection according to claim 1, characterized in that: The dual probe composition is the L primer pair, U probe and B probe of the first, second, third and fourth groups in claim 1.

3. Use of the dual probe according to claim 1 or 2 in preparing a human papillomavirus detection reagent.

4. A multiple nucleic acid detection kit, characterized in that: It comprises the dual-probe composition according to claim 1 or 2.

5. The multiple nucleic acid detection kit according to claim 4, characterized in that: It also includes a universal primer pair, and the sequence of the universal primer pair is shown as SEQ ID NO.47 to SEQ ID NO.

48.

6. Use of the multiple nucleic acid detection kit according to any one of claims 4 to 5 in the preparation of a human papillomavirus detection product.

7. A method for detecting human papillomavirus for non-disease diagnosis purposes, characterized in that: The steps include: Obtaining nucleic acid from a biological sample to be tested; The multiple nucleic acid detection kit according to any one of claims 4-5 is used to perform PCR detection on the nucleic acid of the above biological sample.

Images