A recombinant Escherichia coli strain producing α-amino acid ester acyltransferase and its construction method and application

Abstract

The present invention discloses a recombinant Escherichia coli producing α-amino acid ester acyltransferase, a construction method and an application thereof, and belongs to the field of biotechnology. The recombinant Escherichia coli is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, a deposit date of March 22, 2024, and a deposit number of CGMCC No. 30105. The recombinant Escherichia coli constructed by the present invention can produce α-amino acid ester acyltransferase, and the enzyme is used to catalyze the synthesis of glutathione, with a conversion rate of up to 82.59%, which is of great significance to the industrial development of biosynthesis of glutathione.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a recombinant Escherichia coli producing alpha-amino acid ester acyltransferase, a construction method and application thereof. Background Art

[0002] The molecular formula of glutamine is C5H 10 N2O3 is a basic amino acid that constitutes protein. It is white crystals or crystalline powder at room temperature and has no odor.

[0003] Timely supplementation of exogenous glutamine helps athletes maintain the level of glutathione in liver tissue after exercise, enhances its ability to resist oxidative damage, and reduces lipid peroxidation in liver tissue, thereby protecting liver tissue from free radical damage; secondly, glutamine is an indispensable conditional amino acid in the stress process. However, the limited solubility and instability of glutamine hinder its addition to currently available nutritional preparations. A large amount of experimental data proves that when stable and highly soluble glutamine dipeptide is used, its nutritional support has a positive effect on the body's nitrogen excretion, immune status, intestinal integrity, morbidity, and rehabilitation outcomes, and the glutamine-containing dipeptide supplied parenterally can be quickly cleared and will not accumulate in tissues. Glutamine can not only correct the adverse effects on the body caused by the lack of traditional amino acid solutions, but stable glutamine-containing preparations can also provide sufficient amino acid nutrition in routine clinical settings. The common glutamine preparation is alanine-glutamine (alanyl-glutamine). On the one hand, it can increase the solubility of glutamine and improve its utilization efficiency; on the other hand, alanine-glutamine can be decomposed into alanine and glutamine in the body. Not only can glutamine function normally in the body, but the alanine decomposed from it can also relieve the symptoms of hypoglycemia and improve the body's energy level.

[0004] Common methods for synthesizing glutathione include chemical synthesis and biological synthesis. The chemical synthesis method has a relatively complex synthesis process, low yield, low atomic utilization rate, and difficulty in treating wastewater after the reaction, which is not conducive to the large-scale industrial application of glutathione synthesis. Compared with chemical synthesis, the advantages of synthesizing glutathione using biological methods, i.e., whole-cell methods, include the following: (1) the reaction is carried out in one step, with few side reactions and relatively simple separation and purification; (2) green synthesis, high atomic utilization rate, and strong economy; (3) wastewater treatment after product purification is simple, which is conducive to large-scale application. Therefore, in-depth research on the biosynthesis of glutathione is of great significance to the industrial development of biological and synthetic glutathione in order to improve synthesis efficiency and save production costs. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant Escherichia coli producing α-amino acid ester acyltransferase and a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art. The recombinant Escherichia coli constructed by the present invention can produce α-amino acid ester acyltransferase, and the enzyme is used to catalyze the synthesis of alanine dipeptide, and the conversion rate can reach up to 82.8%.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a recombinant Escherichia coli EAET-EY01 (Escherichia coli) producing α-amino acid ester acyltransferase, which is deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the deposit date is March 22, 2024, and the deposit number is CGMCC No. 30105.

[0008] The present invention also provides a method for constructing the recombinant Escherichia coli EAET-EY01, comprising the following steps: connecting the α-amino acid ester acyltransferase gene EAET-EY01 to an expression vector to construct a recombinant plasmid, transforming the recombinant plasmid into competent Escherichia coli, and obtaining the recombinant Escherichia coli EAET-EY01 after screening and verification;

[0009] The nucleotide sequence of the α-amino acid ester acyltransferase gene EAET-EY01 is shown in SEQ ID NO.6.

[0010] Furthermore, the expression vector is pET-22b-(+).

[0011] Furthermore, the competent Escherichia coli is competent Escherichia coli BL21 (DE3).

[0012] The present invention also provides a gene encoding an α-amino acid ester acyltransferase, and the nucleotide sequence of the gene encoding is shown in SEQ ID NO.6.

[0013] The present invention also provides an α-amino acid ester acyltransferase, the amino acid sequence of which is shown in SEQ ID NO.7.

[0014] The present invention also provides an application of the recombinant Escherichia coli EAET-EY01 or the encoding gene in preparing α-amino acid ester acyltransferase.

[0015] The present invention also provides an application of the recombinant Escherichia coli EAET-EY01, the encoding gene or the α-amino acid ester acyltransferase in synthesizing alanine dipeptide.

[0016] The present invention also provides a method for producing alanine dipeptide by using an enzyme method, comprising: using alanine methyl ester hydrochloride and glutamine as substrates, utilizing the α-amino acid ester acyltransferase to carry out a catalytic reaction, and preparing the alanine dipeptide.

[0017] The present invention also provides a method for producing alanine dipeptide using a whole cell method, comprising: using alanine methyl ester hydrochloride and glutamine as substrates, utilizing the whole cells of the recombinant Escherichia coli EAET-EY01 to carry out a catalytic reaction, and preparing the alanine dipeptide.

[0018] The present invention discloses the following technical effects:

[0019] The invention constructs a recombinant Escherichia coli EAET-EY01 that produces α-amino acid ester acyltransferase. The α-amino acid ester acyltransferase produced by the strain can be used to synthesize alanine dipeptide, and the highest conversion rate can reach 82.59%.

[0020] The invention discloses a method for producing glutathione using an enzyme method or a whole-cell method. The entire catalytic reaction is carried out at room temperature and pressure, which is environmentally friendly; no toxic or harmful organic solvents are used, thereby reducing environmental pollution; the entire catalytic process is a one-step reaction, with a high conversion rate, concise purification steps, simple procedures, and better savings in production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 Schematic diagram of the process for constructing recombinant Escherichia coli EAET-EY01;

[0023] Figure 2 The invention relates to the process of synthesizing alanyl-glutathione using α-amino acid ester acyltransferase produced by recombinant Escherichia coli EAET-EY01;

[0024] Figure 3 This is the peak diagram of the liquid chromatography of the standard product of propylglutathione;

[0025] Figure 4 The peak diagram of the liquid chromatography of the reaction of alanine methyl ester and glutamine catalyzed by the recombinant Escherichia coli EAET-EY01; DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] In the following examples or comparative examples: Escherichia coli DH5α and Escherichia coli BL21 (DE3) were purchased from Quanshijin Biotechnology Co., Ltd.; the vector pET-22b-(+) was purchased from Novagen Co., Ltd.

[0032] The components and concentrations of SE medium were as follows: glycerol 10 g / L, tryptone 10 g / L, yeast extract 10 g / L, and CaCl2·2H2O 1 g / L.

[0033] The specific determination method of enzyme activity is as follows: prepare 10mL of 200mmol / L AlaOMe.HCl and 200mmol / L Gln with boric acid buffer, adjust the pH to 8.5 with NaOH, add 1mL of enzyme solution, react at 25°C for 5min, draw 1ml of reaction solution, heat in a 65°C water bath for 10min, and detect the concentration of alanine dihydrogen phosphate by high performance liquid chromatography. At 25°C, the amount of enzyme required to catalyze the substrate to produce 1μmol alanine dihydrogen phosphate per minute in 1mL of substrate reaction solution is defined as one enzyme activity unit (U).

[0034] Example 1

[0035] A variety of α-amino acid ester acyltransferase genes were searched from NCBI, and a gene (BAK64661.1) from Empedobacter brevis was obtained after comparison. The EAET gene was synthesized after codon optimization. According to the sequences of the EAET gene and the pET-22b-(+) plasmid, primers were designed using primer premier 5.0. The forward primer was 5'-CGGGGATCCGATGAAGAACACCATCTCCTG-3' (SEQ ID NO.1), and the reverse primer was 5'-CCGCTCGAGATCTTTCAGAACAGAAAATTC-3' (SEQ ID NO.2). By PCR amplification technology, a truncated gene clone fragment EAET-DW01 (SEQ ID NO.5) containing BamH I and Hind III restriction sites was obtained. The above gene clone fragment EAET-DW01 was digested with double enzymes (BamH I and Hind III). III restriction site) was connected to the pET-22b-(+) plasmid to obtain the recombinant plasmid pET-22b-(+)-EAET-DW01, and the recombinant plasmid was introduced into BL21(DE3) competent cells, the plasmid was extracted, and the plasmid was used as a template to mutate the 330 amino acid site using a forward primer (SEQ ID NO.3: 5'-TACCACGGTGGTTGGGTTCGTTCTAAT-3') and a reverse primer (SEQ ID NO.4: 5'-AACCCAACCACCGTGGTACCACGGACCC-3'), so that the codon encoding phenylalanine was mutated to a codon encoding tyrosine, and the mutated gene EAET-EY01 (SEQ ID NO.6), introduced into DMT competent medium to extract plasmid and sequence verification, after verification, the plasmid was introduced into BL21 (DE3) competent medium, and screened on ampicillin resistance plate to obtain recombinant α-amino acid ester acyltransferase recombinant Escherichia coli pET-22b-(+)-EAET-EY01, strain number EAET-EY01, deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, the deposit date is March 22, 2024, and the deposit number is CGMCC No.30105. The flow diagram of the construction of recombinant Escherichia coli EAET-EY01 is as follows Figure 1 shown.

[0036] The nucleotide sequence of EAET-DW01 (SEQ ID NO.5):

[0037]

[0038] The nucleotide sequence of EAET-EY01 (SEQ ID NO.6):

[0039] GTGAAGAAACTGACGCTGAAAGTCACGCTGCTGACCCTGCTGCTGGGTTCTACTGTTGGTTTCGCACAAGATGCTAAAGCAGATTCTGCTTACGTACGTGATAACTACGAGAAGATCGAGCAGGTCATCCCTATGCGTGATGGTACTAAACTGTTCACCGCTATCTACCAGCCAAAGGACAAGACCAAACAGTATCCGGTCCTGCTGAACCGTACCCCTTATACTGTCGCACCTTACGGTGTTAACGAATACAAGAAATCCCTGGGTAACTTCCCTACCGAGATGCGTGAGGGCTTTATCTTCGTGTACCAAGACGTTCGTGGCAAATGGATGTCTGAAGGTGAATTTGAAGACGTGCGCCCTATCAACCCAAGCAAATCCAAGAAGGCAATCGACGAAAGCACCGACACCTTCGACACTCTGGAATGGCTGGCTAAAAACCTGAAGAACTACACCAAGAAAGCTGGCATCTACGGTATCTCCTACCCAGGTTTCTATTCCACCATGAGCCTGGTTAACTCCCACCCAACTCTGAAAGCAGTGTCTCCACAGGCACCAGTTACTAACTGGTTCCTGGGCGATGATTTCCATCATAACGGTGTGCTGTTCCTGAACGATTCTTTCTCCTTCATGACCTTCTTCGGTGTGAAACGTCCGCAGCCGATTACTCCGGATAAAGGTCCGAAACGCTTTGAATACCCGATCAAAGACAACTACCGTTTCTACGCAAGCGGTTCTGTGAAAGAACTGAAAGACAAATACCTGCAAGACAACATCAAATTCTACAACGACCTGTTCGCGCACCCGGACTACGACCAGTTCTGGCAGGATCGTAACGTGCTGCCGCATCTGACTAACGTGCAGCCGGCAGTAATGACCGTTGGTGGTTTCTTTGATGCTGAAGATGTATACGGCGCTTTCGAAACTTACAAAGCGATCGAGAAACAGAACCCGAAAGCGACTAACATCATGGTTGCGGGTCCGTGG TAC(The bold underlined part is the sequence corresponding to the mutation, where the codon originally encoding phenylalanine mutated to a codon encoding tyrosine).

[0040] Example 2

[0041] The recombinant Escherichia coli EAET-EY01 was inoculated into 50 mL LB medium containing 100 μg / mL ampicillin and cultured at 37°C, 220 rpm for 14-16 h until the absorbance OD 600 2.5-3.0, take 2 mL of seed solution to 200 mL of SE medium, and culture at 37°C, 220 rpm for 4 h until the absorbance OD 600 The concentration of IPTG inducer was 1.5, and the concentration of IPTG inducer was 0.6mmol / mL. The fermentation was induced at 15℃ for 12h, and the supernatant was removed and washed by shaking with distilled water. The cells were centrifuged again to obtain the cells. The boric acid buffer with pH=9 was added to prepare the cells into a 0.1g / mL whole cell suspension with an enzyme activity of 150U / mL.

[0042] Example 3

[0043] The recombinant Escherichia coli EAET-EY01 was inoculated into 50 mL LB medium containing 100 μg / mL ampicillin and cultured at 37°C, 220 rpm for 14-16 h until the absorbance OD 600 2.5-3.0, take 2 mL of seed solution to 200 mL of SE medium, and culture at 37°C, 220 rpm for 4 h until the absorbance OD 600 The concentration of the induction agent was 1.5, and the concentration of IPTG inducer was 0.6mmol / mL. The fermentation was induced at 15℃ for 12h, and the supernatant was removed at 8000rpm at 4℃ for 15min. The supernatant was added and washed with distilled water and centrifuged again to obtain the bacteria. The boric acid buffer with pH=9 was added to prepare the bacteria into a 0.1g / mL whole cell suspension with an enzyme activity of 148U / mL. An ice water bath was added, and ultrasonic disruption was performed for 20min. The supernatant was obtained by centrifugation, i.e., the crude enzyme solution with an enzyme activity of 142U / mL.

[0044] The amino acid sequence of the α-amino acid ester acyltransferase expressed by the recombinant Escherichia coli EAET-EY01 (SEQ ID NO.7) is as follows:

[0045] .

[0046] Example 4

[0047] A mixed solution of 300 mM L-AlaOMe and 180 mM L-Gln was prepared using a boric acid buffer solution at pH = 9, the pH of the substrate solution was adjusted to 8.5 using a 20% mass fraction NaOH solution, the whole cell suspension prepared in Example 2 was added to make the enzyme activity in the reaction system 20 U / mL, and the mixture was stirred at 27°C for 50 min to catalyze the synthesis of alanyl-glutathione (the catalytic synthesis process is shown in Figure 2 ), the conversion rate was 82.59%.

[0048] Example 5

[0049] A mixed solution of 300 mM L-AlaOMe and 180 mM L-Gln was prepared using a boric acid buffer solution at pH = 9, the pH of the substrate solution was adjusted to 8.5 using a 20% by mass NaOH solution, the crude enzyme solution prepared in Example 3 was added to make the enzyme activity in the reaction system 20 U / mL, and the mixture was stirred at 27°C for 50 min to catalyze the synthesis of glutathione with a conversion rate of 80.55%.

[0050] Example 6

[0051] 20 mL of a mixed solution of 300 mM L-AlaOMe and 180 mM L-Gln substrates was prepared using a boric acid buffer solution, the pH of the substrate solution was adjusted to 8.5 using a 20% mass fraction NaOH solution, the crude enzyme solution prepared in Example 3 was added, and the pH of the reaction solution was maintained within 8.5±0.05. When the pH of the reaction solution no longer changed, it indicated that the reaction was complete. The reaction was terminated by heating at 65° C. for 10 min, the reaction solution was diluted 4 times using a boric acid buffer solution, the precipitate was removed by centrifugation, and the supernatant was filtered using a 0.22 μm filter membrane. The filtered supernatant was detected by high performance liquid chromatography (detection conditions: the chromatographic column was an amide column (4.6 mm×250 mm, 5 μm); the mobile phase was 0.05 M KH2PO4 (pH 4.0): acetonitrile = 35:65; the flow rate was 1 mL / min, and the detection wavelength was 214 nm). The liquid chromatographic peak diagram of the reaction solution is as shown in FIG. Figure 4 As shown; 8g / L propylglutathione standard solution was prepared using boric acid buffer and also tested by high performance liquid chromatography. The liquid chromatogram of propylglutathione standard was as shown Figure 3 shown.

[0052] Comparative Example 1

[0053] Same as Example 5, except that the crude enzyme solution prepared in Example 3 is replaced by the crude enzyme solution prepared by the following method:

[0054] The recombinant Escherichia coli EAET-DW01 was constructed using the EAET-DW01 gene, and then fermented to produce α-amino acid ester acyltransferase to obtain a crude enzyme solution with an enzyme activity of 122U / mL. The construction method and enzyme production fermentation method refer to patent document CN107603936A.

[0055] The conversion rate of propylglutathione prepared in this comparative example is 61.69%.

[0056] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant Escherichia coli strain EAET-EY01 producing α-amino acid ester acyltransferase, characterized in that: It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit date of March 22, 2024 and the deposit number CGMCC No. 30105; The recombinant Escherichia coli EAET-EY01 contains the α-amino acid ester acyltransferase gene EAET-EY01; the nucleotide sequence of the α-amino acid ester acyltransferase gene EAET-EY01 is shown in SEQ ID NO.6, and the encoded amino acid sequence is shown in SEQ ID NO.

7.

2. A gene encoding an α-amino acid ester acyltransferase, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO.

6.

3. An α-amino acid ester acyltransferase, characterized in that Its amino acid sequence is shown in SEQ ID NO.

7.

4. Use of the recombinant Escherichia coli EAET-EY01 according to claim 1 or the encoding gene according to claim 2 in the preparation of α-amino acid ester acyltransferase.

5. Use of the recombinant Escherichia coli EAET-EY01 according to claim 1, the encoding gene according to claim 2 or the α-amino acid ester acyltransferase according to claim 3 in synthesizing alanine dipeptide.

6. A method for producing glutathione using an enzymatic method, characterized in that: include: Alanine methyl ester hydrochloride and glutamine are used as substrates, and the α-amino acid ester acyltransferase described in claim 3 is used to carry out a catalytic reaction to prepare the alanine glutamine dipeptide.

7. A method for producing alanylglutamine using a whole cell method, characterized in that: include: Alanine methyl ester hydrochloride and glutamine are used as substrates, and the whole cells of the recombinant Escherichia coli EAET-EY01 according to claim 1 are used for catalytic reaction to prepare the alanine-glutamine dipeptide.

Images