A combination of 7 gene polymorphisms for guiding medication for hypertension, a kit and its application

Abstract

The present invention relates to the field of gene detection. Specifically, the present invention provides a combination of 7 gene polymorphisms for guiding the use of drugs for hypertension, a kit and its application. The present invention has been verified by a large-scale prospective multicenter clinical evidence-based study, and a new combination of 7 gene sites related to antihypertensive drugs for kit detection has been determined. And based on the fluorescent Taqman-MGB probe technology, a one-step detection scheme is adopted to detect the site combination. It has been verified by a large-scale prospective clinical multicenter evidence-based study on the Chinese population that it has extremely high clinical value and effectiveness, and the operation steps are simple, the detection cost is low, the detection speed is fast, and it is suitable for clinical promotion and application.

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and in particular, to a combination of seven gene polymorphisms for guiding medication for hypertension, a kit and applications thereof. Background Art

[0002] Hypertension is the major chronic disease with the largest number of patients in the world and the leading cause of cardiovascular and cerebrovascular events. The number of people with hypertension in my country has reached 270 million, with a national hypertension prevalence of 27.5% and a hypertension prevalence of 59.2% in the elderly over 60 years old. The average control rate of hypertension in my country is only 16.8%, and there are large differences between different regions. Data show that the current single-drug efficacy of antihypertensive drugs is only about 50%, and among patients who have failed treatment, 81.5% use a single-drug treatment regimen. Different populations show significant individual differences in the therapeutic effects and toxic and side effects of different antihypertensive drugs. The influencing factors of this difference include age, complications, nutritional status, genetic background, drug interactions and environment, among which the influence of genetic background accounts for about 60% of the factors in drug treatment decision-making. For example, the 16th intron of the ACE gene presents an insertion (I) / deletion (D) polymorphism due to the insertion or deletion of a 287bp DNA fragment, thus forming three genotypes: deletion homozygous (DD), insertion homozygous (II) and heterozygous (DI). This gene polymorphism can significantly affect the level of ACE in the body (DD type is the highest, DI type is the second, and II type is the lowest), thereby affecting the efficacy of ACEI drugs, and different genotypes show different sensitivities to different ACEI drugs; for example, amlodipine is mainly metabolized by the CYP3A5 enzyme, and the CYP3A5 gene variation will affect the metabolic activity of the CYP3A5 enzyme on amlodipine, thereby affecting the efficacy of amlodipine. Therefore, through a combination of a gene polymorphism (gene locus) that is scientific and effective, and a convenient and efficient detection kit technology and method for analysis and operation, to detect gene polymorphisms related to antihypertensive drugs, analyze the genetic differences in drug sensitivity, drug transporters, and drug metabolism rates in patients, and help doctors quickly determine the most suitable antihypertensive drug type and dose for individual patients, thereby improving drug efficacy, shortening drug trial cycles, and reducing the incidence of adverse reactions and complications. This is not only the development trend of clinical individualized medicine, but also a practical need for the clinical promotion of new precision medical technologies, and will also inevitably produce huge comprehensive social benefits and health economic benefits.

[0003] The existing technical solutions for detecting antihypertensive drug-related gene polymorphisms are mainly based on chip method, sequencing method, PCR method, nucleic acid mass spectrometry and other technologies, and the types of antihypertensive drugs and drug-related gene loci included are not the same. However, due to three problems, the clinical application and promotion of these technical solutions are largely restricted: First, the gene loci detected by most existing technical solutions cannot cover the five major categories of antihypertensive drugs commonly used in clinical practice. Antihypertensive drugs lower blood pressure by acting on the renin-angiotensin system, blocking presynaptic membrane β receptors, inhibiting renin release, reducing cardiac output, diuresis and sodium excretion, and blocking calcium channels on cell membranes. According to the different mechanisms of drug action, they are divided into angiotensin converting enzyme inhibitors (ACEI), angiotensin receptor antagonists (ARB), β-blockers, calcium channel blockers (CCB), diuretics, etc. The "National Primary Hypertension Prevention and Control Management Guidelines 2020 Edition" issued by the National Center for Cardiovascular Diseases pointed out that primary health institutions should be equipped with the above five major categories of antihypertensive drugs, and the gene loci detected by most existing technical solutions cannot effectively cover the above five major categories of antihypertensive drugs. Second, some detection technology schemes were designed and developed a long time ago, and many new results on genetic polymorphisms closely related to antihypertensive drugs in recent years have not been included in them. In addition, there is a general lack of large-scale prospective clinical multicenter evidence-based research data on the Chinese population to support the clinical value of relevant genetic polymorphism detection in improving the control rate of hypertension. Third, the existing technical schemes each have their own advantages but also have defects to varying degrees, such as high detection cost, long detection time, and complicated operation process.

[0004] In January 2014, Xiangya Hospital of Central South University and Hunan Honghao Gene Biotechnology Co., Ltd. jointly developed the first hypertension personalized medication gene typing test kit (gene chip method), including CYP2D6*10, CYP2C9*3, ADRB1(1165G>C), AGTR1(1166A>C), ACE(I / D) a total of five gene loci. At the same time, Wuxi Ruiqi Gene Biotechnology Co., Ltd. (National Medical Device Registration No. 20183400390), Wuhan Youzhiyou Medical Technology Co., Ltd. (National Medical Device Registration No. 20223400374), and Beijing Anzhiyin Biotechnology Co., Ltd. (National Medical Device Registration No. 20233401460) developed hypertension medication gene polymorphism detection kits based on these five gene loci in 2018, 2022, and 2023, respectively, using different technical methods.

[0005] In the ten years from 2014 to now, pharmacogenomics has developed rapidly, and a large number of new research results have emerged. Technical Solution 1 was developed early and did not include the latest research results, resulting in the lack of some very important genetic polymorphisms related to antihypertensive drugs, which limited the clinical application effect of Technical Solution 1. For example, the "Guidelines for Rational Use of Hypertension Drugs (2nd Edition)" issued by the Expert Committee on Rational Use of Drugs of the National Health Commission (formerly the Expert Committee on Rational Use of Drugs of the National Health and Family Planning Commission) in 2017 clearly stated that the CACNA1C gene encodes one of the subunits of the L-type calcium channel and is the target of dihydropyridine calcium channel blockers. Studies have shown that certain site polymorphisms of the CACNA1C gene are related to the antihypertensive effect of amlodipine, and individuals with different genotypes have different blood pressure reductions after taking amlodipine. Technical Solution 1 does not include this gene, so it is impossible to carry out personalized medication guidance for dihydropyridine calcium channel blockers; for example, ADD1 (rs4961), which is related to the antihypertensive effect of diuretics and has a level of evidence of 2B in the International Pharmacogenomics Database (PharmGKB), is also not included. The Guidelines for Rational Medication Use for Hypertension (2nd Edition) pointed out that in terms of the overall medication use of community hypertension patients included in the project management from 2005 to 2010, the use of diuretics accounted for the highest proportion (56.0%). Since the ADD1 (rs4961) gene polymorphism has a high guiding significance for the personalized use of diuretics, the absence of this site will inevitably limit its clinical application in the personalized use of diuretics, an important category of antihypertensive drugs with the largest proportion of use; finally, the combination of 5 gene polymorphisms detected by technical solution 1 can only guide the three types of drugs among the five major categories of antihypertensive drugs, namely angiotensin converting enzyme inhibitors (ACEI), angiotensin receptor antagonists (ARB), and β-receptor blockers, while calcium channel blockers (CCB) and diuretics-related gene sites are not among them. Therefore, based on the fact that the detection of antihypertensive drug-related gene sites by technical solution 1 is incomplete and not new, and the coverage of drug types is incomplete, its clinical application value is greatly reduced. At the same time, due to the lack of evidence-based data from large-scale prospective clinical multicenter studies in the Chinese population, the evidence-based evidence supporting the combination of gene polymorphisms detected by technical solution 1 to improve the control rate of hypertension treatment in clinical practice also restricts the promotion of technical solution 1 in clinical application to a certain extent. Summary of the invention

[0006] In order to overcome the defects of the prior art, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides a combination of 7 gene polymorphisms for guiding the use of hypertension medication, wherein the combination of 7 gene polymorphisms consists of CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T).

[0008] The second aspect of the present invention provides a use of a detection reagent for the combination of the above seven gene polymorphisms for guiding the use of hypertension medication in the preparation of a kit, wherein the reagent is used to detect the above seven gene polymorphisms.

[0009] In one embodiment, the detection reagent includes primers and / or probes, etc.

[0010] In one embodiment, the use of the kit comprises:

[0011] The sample genotyping is determined based on the Ct values ​​of the wild-type and mutant fluorescence channels of the same gene locus. If the test result shows a typical S-type amplification curve and the Ct value is less than the judgment value, it is judged as positive; NoCT means no amplification, atypical S-type amplification curve, and the Ct value is greater than the judgment value, which is judged as negative, and the Ct judgment value is 40. The typing results of each gene locus are as follows Figure 3 shown.

[0012] The genotyping results are as follows:

[0013] When the internal reference Ct value is ≤36, the FAM channel Ct value is ≤40, the VIC channel Ct value is greater than 40 or NoCT is displayed, the genotype is: CYP2D6*10 T / T, ADRB1 C / C, CACNA1C T / T, CYP3A5*3 G / G;

[0014] When the internal reference Ct value is ≤36, the VIC channel Ct value is ≤40, the FAM channel Ct value is greater than 40 or NoCT is displayed, the genotype is: CYP2D6*10 C / C, ADRB1 G / G, CACNA1C G / G, CYP3A5*3 A / A;

[0015] When the internal reference Ct value is ≤36, the FAM channel Ct value is ≤40, and the VIC channel Ct value is ≤40, the genotype is: CYP2D6*10C / T, ADRB1 C / G, CACNA1C G / T, CYP3A5*3 A / G;

[0016] When the internal reference Ct value is ≤36, the ROX channel Ct value is ≤40, and the CY5 channel Ct value is greater than 40 or displays NoCT, the genotype is: ACE D / D, CYP2C9*3 A / A, ADD1 G / G;

[0017] When the internal reference Ct value is ≤36, the CY5 channel Ct value is ≤40, and the ROX channel Ct value is greater than 40 or displays NoCT, the genotype is: ACE I / I, CYP2C9*3 C / C, ADD1 T / T;

[0018] When the internal reference Ct value is ≤36, the ROX channel Ct value is ≤40, and the CY5 channel Ct value is ≤40, the genotype is: ACE D / I, CYP2C9*3 A / C, ADD1 G / T;

[0019] According to the genotyping results of the kit and referring to the annotations of drug-related gene variations in the international pharmacogenomics database (PharmGKB), corresponding drug usage recommendations are given for the kit test results according to the drugs, gene loci, test results and result interpretation.

[0020] The third aspect of the present invention provides a kit for guiding the use of hypertension medication, which comprises reagents for detecting CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T).

[0021] In one embodiment, the reagents are primers and / or probes.

[0022] In a preferred embodiment, the kit includes a PCR reaction solution, a one-step treatment solution, an enzyme mixture, a positive control and a negative control.

[0023] In a most preferred embodiment, the kit comprises:

[0024] Reaction solution 1#: Contains primer-probe mixture for detecting CYP2D6 (c.100C>T) and ACE (I / D);

[0025] Primer pair for detecting CYP2D6 (c.100C>T): SEQ ID NO.1 and SEQ ID NO.2;

[0026] SEQ ID NO. 1 is the upstream primer of CYP2D6 (c.100C>T):

[0027] 5'-GCCCATTTGGTAGTGAGGCAGGTA-3';

[0028] SEQ ID NO. 2 is the downstream primer of CYP2D6 (c.100C>T):

[0029] 5'-AGCAGTAGGTGTGTTCTGGAAGTC-3';

[0030] Specific probes for detecting CYP2D6 (c.100C>T): SEQ ID NO. 3 and SEQ ID NO. 4;

[0031] SEQ ID NO. 3 is a wild-type fluorescent probe of CYP2D6 (c.100C>T):

[0032] 5′-fluorophore- CTACCCACCAGGCC-MGB-NFQ-3′;

[0033] SEQ ID NO. 4 is a CYP2D6 (c.100C>T) mutant fluorescent probe:

[0034] 5′-fluorophore- CGCTACTCACCAGGC-MGB-NFQ-3′;

[0035] Primer pair for detecting ACE (I / D): SEQ ID NO. 5 and SEQ ID NO. 6;

[0036] SEQ ID NO. 5 is the upstream primer of ACE (I / D):

[0037] 5'-TGGAGACCACTCCCATCCTT-3';

[0038] SEQ ID NO. 6 is the ACE (I / D) downstream primer:

[0039] 5'- CCCTTAGCTCACCTCTGCTTG -3';

[0040] Detection of ACE (I / D) specific probes: SEQ ID NO. 7 and SEQ ID NO. 8;

[0041] SEQ ID NO. 7 is a wild-type fluorescent probe of ACE (I / D):

[0042] 5′-fluorophore- TTGAGACGGAGTCTC -MGB-NFQ-3′;

[0043] SEQ ID NO. 8 is an ACE (I / D) mutant fluorescent probe:

[0044] 5′-Fluorophore- CACTTTTATGTGGTTTC -MGB-NFQ-3′;

[0045] Reaction solution 2#: Contains primer-probe mixture for detecting ADRB1 (c.1165G>C) and CYP2C9*3 (c.1075A>C);

[0046] Primer pair for detecting ADRB1 (c.1165G>C): SEQ ID NO .9 and SEQ ID NO .10;

[0047] SEQ ID NO. 9 is the upstream primer of ADRB1 (c.1165G>C):

[0048] 5′- AGCCCCGACTTCCGCA -3′;

[0049] SEQ ID NO. 10 is the downstream primer of ADRB1 (c.1165G>C):

[0050] 5′- GTCTCCGTGGGTCGCGT-3′;

[0051] Detection of ADRB1 (c.1165G>C) specific probes: SEQ ID NO. 11 and SEQ ID NO. 12;

[0052] SEQ ID NO. 11 is a wild-type fluorescent probe of ADRB1 (c.1165G>C):

[0053] 5′-fluorophore- CCTTCCAGCGACTGC-MGB-NFQ-3′;

[0054] SEQ ID NO. 12 is a fluorescent probe for ADRB1 (c.1165G>C) mutant:

[0055] 5′-Fluorophore- TCCAGGGACTGCTC -MGB-NFQ-3′;

[0056] Primer pair for detecting CYP2C9*3 (c.1075A>C): SEQ ID NO .13 and SEQ ID NO .14;

[0057] SEQ ID NO. 13 is the upstream primer of CYP2C9*3 (c.1075A>C):

[0058] 5'- CCACATGCCCTACACAGATGC -3';

[0059] SEQ ID NO. 14 is the downstream primer of CYP2C9*3 (c.1075A>C):

[0060] 5'- CTTACCTTGGGAATGAGATAGTTT -3';

[0061] Detection of CYP2C9*3 (c.1075A>C) specific probes: SEQ ID NO. 15 and SEQ ID NO. 16;

[0062] SEQ ID NO. 15 is a wild-type fluorescent probe of CYP2C9*3 (c.1075A>C):

[0063] 5′-Fluorophore-ATACATTGACCTTCTCC-MGB-NFQ-3′;

[0064] SEQ ID NO. 16 is a CYP2C9*3 (c.1075A>C) mutant fluorescent probe:

[0065] 5′-Fluorophore- ATACCTTGACCTTCTC -MGB-NFQ-3′;

[0066] Reaction solution #3: Contains primer-probe mixture for detecting CACNA1C (c.50-1658T>G) and ADD1 (c.1378G>T);

[0067] Primer pair for detecting CACNA1C (c.50-1658T>G): SEQ ID NO. 17 and SEQ ID NO. 18;

[0068] SEQ ID NO. 17 is the upstream primer of CACNA1C (c.50-1658T>G):

[0069] 5'-GTGCACATGGACCAGAAAAGG -3';

[0070] SEQ ID NO. 18 is the downstream primer of CACNA1C (c.50-1658T>G):

[0071] 5'-CACTTCAGCTGCCCAGAGACT-3';

[0072] Detection of CACNA1C (c.50-1658T>G) specific probes: SEQ ID NO. 19 and SEQ ID NO. 20;

[0073] SEQ ID NO. 19 is a wild-type fluorescent probe of CACNA1C (c.50-1658T>G):

[0074] 5′-fluorophore- ATGACCCCCAAGGC -MGB-NFQ-3′;

[0075] SEQ ID NO. 20 is a CACNA1C (c.50-1658T>G) mutant fluorescent probe:

[0076] 5′-fluorophore- ATGACCCCCAAGGC -MGB-NFQ-3′;

[0077] Primer pair for detecting ADD1 (c.1378G>T): SEQ ID NO .21 and SEQ ID NO .22;

[0078] SEQ ID NO. 21 is the upstream primer of ADD1 (c.1378G>T):

[0079] 5'- GGAGAAGACAAGATGGCTGAACT -3';

[0080] SEQ ID NO. 22 is the downstream primer of ADD1 (c.1378G>T):

[0081] 5'-GTTCGTCCACACTTAGTCTTCG -3';

[0082] Detection of ADD1 (c.1378G>T) specific probes: SEQ ID NO. 23 and SEQ ID NO. 24;

[0083] SEQ ID NO. 23 is ADD1 (c.1378G>T) wild-type fluorescent probe:

[0084] 5′-Fluorophore-CGAGGAAGGGCAGAAT -MGB-NFQ-3′;

[0085] SEQ ID NO. 24 is a mutant fluorescent probe of ADD1 (c.1378G>T):

[0086] 5′-fluorophore- CCGAGGAATGGCAGAAT -MGB-NFQ-3′;

[0087] Reaction solution 4#: Contains primer-probe mixture for detecting CYP3A5*3 (c.219-237A>G) and internal reference β-actin;

[0088] Primer pair for detecting CYP3A5*3 (c.219-237A>G): SEQ ID NO .25 and SEQ ID NO .26;

[0089] SEQ ID NO. 25 is the upstream primer of CYP3A5*3 (c.219-237A>G):

[0090] 5'-TGTACCACCCAGCTTAACGA-3';

[0091] SEQ ID NO. 26 is the downstream primer of CYP3A5*3 (c.219-237A>G):

[0092] 5'-TCACACAGGAGCCACCCAAG -3';

[0093] Detection of CYP3A5*3 (c.219-237A>G) specific probes: SEQ ID NO. 27 and SEQ ID NO. 28;

[0094] SEQ ID NO. 27 is a wild-type fluorescent probe of CYP3A5*3 (c.219-237A>G):

[0095] 5′-Fluorophore- CAGGGAAGAGATATTGAAAG -MGB-NFQ-3′;

[0096] SEQ ID NO. 28 is a CYP3A5*3 (c.219-237A>G) mutant fluorescent probe:

[0097] 5'-Fluorophore-ACAGGGAAGAGATACTGAAA-MGB-NFQ-3'

[0098] Detection of internal reference β-actin primer pair: SEQ ID NO. 29 and SEQ ID NO. 30;

[0099] SEQ ID NO. 29 is the internal reference β-actin upstream primer:

[0100] 5'-CCCTCGCTGTCCACCTTCCA -3';

[0101] SEQ ID NO. 30 is the internal reference β-actin downstream primer:

[0102] 5'-CTAAGTCATAGTCCGCCTAGAAGCA -3';

[0103] Detection of internal reference β-actin specific probe: SEQ ID NO .31;

[0104] SEQ ID NO. 31 is an internal reference β-actin fluorescent probe:

[0105] 5′-Fluorophore- CCCCTCCATCGTC -MGB-NFQ-3′;

[0106] One-step treatment solution: One-step treatment solution is a treatment solution for quickly obtaining peripheral blood genomic DNA. It is a mixed solution prepared from 0.1% sodium dodecyl sulfate (SDS), 15% potassium iodide (KI) and 0.2% sodium hydroxide (NaOH);

[0107] Enzyme mixture: The enzyme mixture is a reaction solution that has been pre-mixed with 40 portions of TaqDNA polymerase, including TaqDNA polymerase, UNG enzyme, dNTP, MgCl2, PCR buffer, etc.

[0108] Positive control: The positive control of the kit is a mixture of mutant plasmids and wild-type plasmid DNA of seven gene sites: CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T);

[0109] Negative control: The negative control is ultrapure water without target gene and internal reference gene.

[0110] Compared with the prior art, the present invention has the following significant improvements:

[0111] The present invention adopts the research method of gene detection data of Chinese hypertension patients, takes into account the economical applicability of clinical application on the basis of scientificity, and verifies it through large-scale prospective multi-center clinical evidence-based research, and determines the new combination of 7 gene sites related to antihypertensive drugs for kit detection. And based on the fluorescent Taqman-MGB probe technology, a one-step detection scheme is adopted to detect the site combination. The purpose of the present invention is to provide a gene polymorphism detection solution for individualized hypertension medication that comprehensively covers 5 major clinical categories of antihypertensive drugs, verifies its clinical value and effectiveness through large-scale prospective clinical multi-center evidence-based research on the Chinese population, has simple operation steps, low detection cost, fast detection speed, and is suitable for clinical promotion and application. The technical problems solved by the technical solution of the present invention mainly include: (1) by testing 700,000+50,000 biomarkers for each sample from more than 1,000 samples, a new combination of gene loci covering five major categories of antihypertensive drugs was determined; (2) a large-scale prospective clinical multicenter evidence-based study of nearly 3,000 Chinese people was conducted on the determined new combination of gene loci, verifying the clinical value and effectiveness of the new combination of gene loci of the present invention for antihypertensive drugs in improving the control rate of hypertension; (3) the one-step sample processing technology is used, and the sample processing can be completed in only 1 minute, which solves the problems of cumbersome sample processing steps, complex operation, long cycle, and high cost of traditional fluorescent PCR kits, and significantly improves the detection efficiency and convenience of clinical practice; (4) the fluorescent Taqman-MGB probe technology is used for multiple fluorescence detection, which improves the detection efficiency, shortens the detection cycle, and improves the detection accuracy, etc., further improving the clinical practicality of the technical solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0113] Figure 1 Flow chart for site screening;

[0114] Figure 2 Provide technical routes for multi-center clinical cohort studies on personalized medication for hypertension;

[0115] Figure 3 Typing results for each gene locus;

[0116] Figure 4 The comparison between the detection result of the kit of the present invention and the sequencing result, where *Hom: homozygous mutation; Het: heterozygous mutation. **Experimental method: Sanger sequencing method. DETAILED DESCRIPTION

[0117] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0118] Example 1 Prospective study and confirmation of gene loci combination for antihypertensive drug detection

[0119] The National Primary Hypertension Prevention and Control Management Guidelines 2020 stipulates that primary health institutions should be equipped with five major categories of antihypertensive drugs: ACEI, ARB, beta-blockers, CCB and diuretics. Among them, diuretics and calcium channel blockers (CCB) are the most commonly used first-line drugs in clinical practice, and their use in the community accounts for more than 50%. Therefore, it is one of the key contents of the present invention to include diuretics and calcium channel blockers in the detection scope and study and determine a new combination of detection gene loci that fully covers the five major categories of clinical first-line antihypertensive drugs. In view of the limitation of incomplete coverage of the five major categories of antihypertensive drugs in the prior art, the present invention determines 44 types (excluding compound preparations) of antihypertensive drugs in five categories (ACEI, ARB, beta-blocker, CCB and diuretics) according to the National Essential Medicines List (2023) and the National Primary Hypertension Prevention and Control Management Guidelines 2020, as shown in Table 1 for details.

[0120]

[0121] Based on Table 1, the ASA chip was used to study and determine the gene loci associated with 44 antihypertensive drugs in five categories. The ASA (Asian Screening Array) chip is a whole genome SNP chip developed by Illumina in the United States based on the whole genome sequencing data of 9000+ East Asians. The chip contains 700,000+50,000 biomarkers, including 9427 drug genome loci and 50,000 customized gene loci. According to the standard English names of the above five categories of antihypertensive drugs and the standard chemical names of the 44 antihypertensive drugs, a total of 102 corresponding detection gene loci were located in the 700,000+50,000 data of the ASA chip, as shown in Table 2.

[0122]

[0123] ASA chip was used to perform genetic testing on 1009 Chinese hypertensive patients, and the distribution frequencies of various genotypes of 102 gene loci corresponding to the five major categories of antihypertensive drugs in the Chinese hypertensive population were statistically analyzed. According to the statistical results, 11 gene loci (rs10264272, rs1529927, rs17268282, rs1801701, rs28371686, rs35742686, rs41303343, rs4648287, rs5030656, rs7297610, rs9332131) were found to have no mutant genotypes in the Chinese hypertensive population. After eliminating them, 91 gene loci corresponding to the five major categories of antihypertensive drugs were obtained. The frequencies of various genotypes of the 91 gene loci in the Chinese hypertensive population are shown in Table 3.

[0124]

[0125] At present, the genetic testing for guiding the use of chemical drugs in my country is charged in gene loci, and the fees for each gene locus in various parts of the country range from 120 to 460 yuan. Therefore, it is necessary to comprehensively reduce the dimensions from the aspects of clinical guidance significance and economic efficiency of the test to be suitable for clinical promotion and application. The present invention systematically analyzes the information such as the types of antihypertensive drugs covered by the above 91 gene loci, the mechanism of action of the drugs, the level of evidence, and the evidence score, as shown in Table 4.

[0126] Based on the above prospective statistical research, we have formulated the principles for optimizing dimensionality reduction of gene loci: ① Based on the genotyping results of real clinical hypertension patients detected in Table 3, select gene loci where both wild-type and mutant types are distributed in the hypertensive patient population; ② Select gene loci recommended by the consensus guidelines for hypertension medication at home and abroad; ③ Select the most representative gene loci (high evidence level, high evidence score) under the same mechanism of action of the same drug category; ④ The same gene locus can guide the clinical use of 2 or more drugs. Based on the above principles, we have preliminarily determined a new combination of 7 gene loci related to five major categories of first-line antihypertensive drugs. The site screening technology route is as follows: Figure 1 The specific information of the seven gene loci related to the five major types of antihypertensive drugs is shown in Table 5:

[0127]

[0128] Note: a: angiotensin converting enzyme inhibitors; b: angiotensin II receptor 1 antagonists; c: calcium channel blockers; d: PharmGKB evidence level; e: PharmGKB site clinical evidence score; Swissmedic: Swiss Medicines Agency; FDA: U.S. Food and Drug Administration; DPWG: Netherlands Pharmacogenetics Working Group; Guidelines for Rational Use of Hypertension Drugs: "Guidelines for Rational Use of Hypertension Drugs (2nd Edition)" issued by the Expert Committee on Rational Use of Drugs of the National Health and Family Planning Commission and the Hypertension Professional Committee of the Chinese Medical Doctor Association.

[0129] Example 2 Large-scale multicenter clinical evidence-based study verifies the effectiveness of seven gene polymorphisms in guiding individualized antihypertensive drug treatment

[0130] In order to further study and determine the clinical value of the new combination of 7 gene loci, the present invention carried out multicenter clinical evidence-based research in 21 tertiary hospitals in 12 cities including Changsha, Yueyang, Yongzhou, Yiyang, Xiangtan, Shaoyang, Loudi, Huaihua, Hengyang, Chenzhou, Changde and Zhuzhou in Hunan Province, and 12 tertiary hospitals in Fuzhou, Xiamen, Ningde, Nanping and Zhangzhou in Fujian Province. The technical route of the multicenter clinical cohort study on personalized medication for hypertension is as follows Figure 2 shown.

[0131] Clinical study inclusion criteria:

[0132] Inclusion criteria:

[0133] Patients who meet the diagnostic criteria for hypertension, are aged ≥18 years, have mild to moderate essential hypertension, are willing to accept follow-up observation, clearly understand and voluntarily participate in the study, and sign the informed consent form;

[0134] Exclusion criteria:

[0135] Patients with secondary hypertension, combined with liver and kidney dysfunction, current severe heart failure NYHF grade III or IV, diabetes, stroke, severe trauma and major surgery, pregnant or lactating women, and women of childbearing age who cannot take contraceptive measures.

[0136] Enrollment:

[0137] As of April 2024, a total of 2,680 cases met the requirements for enrollment and follow-up information collection, including 1,694 cases in the study group (1,000 males and 694 females) for antihypertensive drug gene testing, and 986 cases in the control group (578 males and 408 females). There was no statistically significant difference in age and gender distribution between the two groups (P>0.05).

[0138] The genotyping results of seven gene loci related to five major types of antihypertensive drugs in the study group are shown in Table 6:

[0139] The statistical results of a large-scale clinical multicenter evidence-based study on the Chinese population showed that there was no statistically significant difference in the average systolic and diastolic blood pressures between the study group and the control group at enrollment. After one month of treatment follow-up, the systolic and diastolic blood pressures of both groups decreased significantly. After the 1,694 cases in the study group were tested by the new combination of 7 gene loci of the technical solution of the present invention, individualized medication for hypertension was carried out according to the guidance of the test results. The hypertension treatment control rate reached 75.38%, which was significantly higher than the national average control rate of 16.8%, the original average control rate of 8.63% in Hunan Province, and the original average control rate of 20.1% in Fujian Province. The control group treatment control rate of 26.57% based on the clinical evidence-based study of the present invention was statistically significant (P < 0.05) (the control group also had a certain degree of improvement in treatment control rate because it passed strict inclusion and exclusion criteria, standardized medication regimens and incorporated refined blood pressure management). Specifically, the results of the new combination of 7 gene loci to improve the treatment control rate of hypertension are shown in Table 7:

[0140]

[0141] Note: * There is a significant difference between the two groups (P < 0.05); a There is a significant difference between the same group at different times (P < 0.05)

[0142] Based on the above-mentioned 2,680 cases (the largest sample size in the country to date) of clinical multicenter evidence-based research on personalized medication for hypertension in the Chinese population, the results showed that the new combination of 7 genetic polymorphism sites related to hypertension medication (CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), ADD1 (c.1378G>T)) detection kit proposed in the technical scheme of the present invention has clinical value in significantly improving the control rate of hypertension treatment.

[0143] Example 3 Preparation of a kit for detecting seven genetic polymorphisms related to hypertension medication in one step

[0144] 1. Preparation of the kit

[0145] The present invention comprises 7 gene polymorphisms related to antihypertensive drugs {CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), ADD1 (c.1378G>T)} and an internal reference β-actin detection reagent in a kit, amplification is performed through 4 PCR reaction buffers, each PCR reaction solution detects two gene polymorphisms, and 4 fluorescence channels are included. The genotypes of the 7 gene polymorphisms are judged by the fluorescence signals in the amplification process, thereby guiding the clinical use of antihypertensive drugs.

[0146] The kit contains 8 components: reaction solution 1#-4#, one-step treatment solution, enzyme mixture, positive control, and negative control.

[0147] Reaction solution 1#: Contains primer-probe mixture for detecting CYP2D6 (c.100C>T) and ACE (I / D);

[0148] Primer pair for detecting CYP2D6 (c.100C>T): SEQ ID NO.1 and SEQ ID NO.2;

[0149] SEQ ID NO. 1 is the upstream primer of CYP2D6 (c.100C>T):

[0150] 5'-GCCCATTTGGTAGTGAGGCAGGTA-3';

[0151] SEQ ID NO. 2 is the downstream primer of CYP2D6 (c.100C>T):

[0152] 5'-AGCAGTAGGTGTGTTCTGGAAGTC-3';

[0153] Specific probes for detecting CYP2D6 (c.100C>T): SEQ ID NO. 3 and SEQ ID NO. 4;

[0154] SEQ ID NO. 3 is a wild-type fluorescent probe of CYP2D6 (c.100C>T):

[0155] 5′-fluorophore- CTACCCACCAGGCC-MGB-NFQ-3′;

[0156] SEQ ID NO. 4 is a CYP2D6 (c.100C>T) mutant fluorescent probe:

[0157] 5′-fluorophore- CGCTACTCACCAGGC-MGB-NFQ-3′;

[0158] Primer pair for detecting ACE (I / D): SEQ ID NO. 5 and SEQ ID NO. 6;

[0159] SEQ ID NO. 5 is the upstream primer of ACE (I / D):

[0160] 5'-TGGAGACCACTCCCATCCTT-3';

[0161] SEQ ID NO. 6 is the ACE (I / D) downstream primer:

[0162] 5'- CCCTTAGCTCACCTCTGCTTG -3';

[0163] Detection of ACE (I / D) specific probes: SEQ ID NO. 7 and SEQ ID NO. 8;

[0164] SEQ ID NO. 7 is a wild-type fluorescent probe of ACE (I / D):

[0165] 5′-fluorophore- TTGAGACGGAGTCTC -MGB-NFQ-3′;

[0166] SEQ ID NO. 8 is an ACE (I / D) mutant fluorescent probe:

[0167] 5′-Fluorophore- CACTTTTATGTGGTTTC -MGB-NFQ-3′;

[0168] Reaction solution 2#: Contains primer-probe mixture for detecting ADRB1 (c.1165G>C) and CYP2C9*3 (c.1075A>C);

[0169] Primer pair for detecting ADRB1 (c.1165G>C): SEQ ID NO .9 and SEQ ID NO .10;

[0170] SEQ ID NO. 9 is the upstream primer of ADRB1 (c.1165G>C):

[0171] 5′- AGCCCCGACTTCCGCA -3′;

[0172] SEQ ID NO. 10 is the downstream primer of ADRB1 (c.1165G>C):

[0173] 5′-GTCTCCGTGGGTCGCGT-3′;

[0174] Detection of ADRB1 (c.1165G>C) specific probes: SEQ ID NO. 11 and SEQ ID NO. 12;

[0175] SEQ ID NO. 11 is a wild-type fluorescent probe of ADRB1 (c.1165G>C):

[0176] 5′-fluorophore- CCTTCCAGCGACTGC-MGB-NFQ-3′;

[0177] SEQ ID NO. 12 is a fluorescent probe for ADRB1 (c.1165G>C) mutant:

[0178] 5′-Fluorophore- TCCAGGGACTGCTC -MGB-NFQ-3′;

[0179] Primer pair for detecting CYP2C9*3 (c.1075A>C): SEQ ID NO .13 and SEQ ID NO .14;

[0180] SEQ ID NO. 13 is the upstream primer of CYP2C9*3 (c.1075A>C):

[0181] 5'- CCACATGCCCTACACAGATGC -3';

[0182] SEQ ID NO. 14 is the downstream primer of CYP2C9*3 (c.1075A>C):

[0183] 5'- CTTACCTTGGGAATGAGATAGTTT -3';

[0184] Detection of CYP2C9*3 (c.1075A>C) specific probes: SEQ ID NO. 15 and SEQ ID NO. 16;

[0185] SEQ ID NO. 15 is a wild-type fluorescent probe of CYP2C9*3 (c.1075A>C):

[0186] 5′-Fluorophore-ATACATTGACCTTCTCC-MGB-NFQ-3′;

[0187] SEQ ID NO. 16 is a CYP2C9*3 (c.1075A>C) mutant fluorescent probe:

[0188] 5′-Fluorophore- ATACCTTGACCTTCTC -MGB-NFQ-3′;

[0189] Reaction solution #3: Contains primer-probe mixture for detecting CACNA1C (c.50-1658T>G) and ADD1 (c.1378G>T);

[0190] Primer pair for detecting CACNA1C (c.50-1658T>G): SEQ ID NO. 17 and SEQ ID NO. 18;

[0191] SEQ ID NO. 17 is the upstream primer of CACNA1C (c.50-1658T>G):

[0192] 5'-GTGCACATGGACCAGAAAAGG -3';

[0193] SEQ ID NO. 18 is the downstream primer of CACNA1C (c.50-1658T>G):

[0194] 5'-CACTTCAGCTGCCCAGAGACT-3';

[0195] Detection of CACNA1C (c.50-1658T>G) specific probes: SEQ ID NO. 19 and SEQ ID NO. 20;

[0196] SEQ ID NO. 19 is a wild-type fluorescent probe of CACNA1C (c.50-1658T>G):

[0197] 5′-fluorophore- ATGACCCCCAAGGC -MGB-NFQ-3′;

[0198] SEQ ID NO. 20 is a CACNA1C (c.50-1658T>G) mutant fluorescent probe:

[0199] 5′-fluorophore- ATGACCCCCAAGGC -MGB-NFQ-3′;

[0200] Primer pair for detecting ADD1 (c.1378G>T): SEQ ID NO .21 and SEQ ID NO .22;

[0201] SEQ ID NO. 21 is the upstream primer of ADD1 (c.1378G>T):

[0202] 5'- GGAGAAGACAAGATGGCTGAACT -3';

[0203] SEQ ID NO. 22 is the downstream primer of ADD1 (c.1378G>T):

[0204] 5'-GTTCGTCCACACTTAGTCTTCG -3';

[0205] Detection of ADD1 (c.1378G>T) specific probes: SEQ ID NO. 23 and SEQ ID NO. 24;

[0206] SEQ ID NO. 23 is ADD1 (c.1378G>T) wild-type fluorescent probe:

[0207] 5′-Fluorophore-CGAGGAAGGGCAGAAT -MGB-NFQ-3′;

[0208] SEQ ID NO. 24 is a mutant fluorescent probe of ADD1 (c.1378G>T):

[0209] 5′-fluorophore- CCGAGGAATGGCAGAAT -MGB-NFQ-3′;

[0210] Reaction solution 4#: Contains primer-probe mixture for detecting CYP3A5*3 (c.219-237A>G) and internal reference β-actin;

[0211] Primer pair for detecting CYP3A5*3 (c.219-237A>G): SEQ ID NO .25 and SEQ ID NO .26;

[0212] SEQ ID NO. 25 is the upstream primer of CYP3A5*3 (c.219-237A>G):

[0213] 5'-TGTACCACCCAGCTTAACGA-3';

[0214] SEQ ID NO. 26 is the downstream primer of CYP3A5*3 (c.219-237A>G):

[0215] 5'-TCACACAGGAGCCACCCAAG -3';

[0216] Detection of CYP3A5*3 (c.219-237A>G) specific probes: SEQ ID NO. 27 and SEQ ID NO. 28;

[0217] SEQ ID NO. 27 is a wild-type fluorescent probe of CYP3A5*3 (c.219-237A>G):

[0218] 5′-Fluorophore- CAGGGAAGAGATATTGAAAG -MGB-NFQ-3′;

[0219] SEQ ID NO. 28 is a CYP3A5*3 (c.219-237A>G) mutant fluorescent probe:

[0220] 5′-Fluorophore- ACAGGGAAGAGATACTGAAA -MGB-NFQ-3′;

[0221] Detection of internal reference β-actin primer pair: SEQ ID NO. 29 and SEQ ID NO. 30;

[0222] SEQ ID NO. 29 is the internal reference β-actin upstream primer:

[0223] 5'-CCCTCGCTGTCCACCTTCCA -3';

[0224] SEQ ID NO. 30 is the internal reference β-actin downstream primer:

[0225] 5'-CTAAGTCATAGTCCGCCTAGAAGCA -3';

[0226] Detection of internal reference β-actin specific probe: SEQ ID NO .31;

[0227] SEQ ID NO. 31 is an internal reference β-actin fluorescent probe:

[0228] 5′-Fluorophore- CCCCTCCATCGTC -MGB-NFQ-3′;

[0229] One-step treatment solution: As mentioned above, the one-step treatment solution is a treatment solution for quickly obtaining peripheral blood genomic DNA. It is a mixed solution prepared from 0.1% sodium dodecyl sulfate (SDS), 15% potassium iodide (KI) and 0.2% sodium hydroxide (NaOH).

[0230] Enzyme mixture: The enzyme mixture is a reaction solution that is pre-mixed with 40 parts of TaqDNA polymerase, including TaqDNA polymerase, UNG enzyme, dNTP, MgCl2, PCR buffer, etc.

[0231] Positive control: The positive control of the kit is a mixture of mutant plasmids and wild-type plasmid DNA of seven gene sites: CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T);

[0232] Negative control: The negative control is ultrapure water without target gene and internal reference gene.

[0233] 2. Reaction Procedure of the Kit

[0234] After multiple adjustments and optimizations of the denaturation time and annealing extension time, the final reaction program was determined to be 94 minutes on the machine (50°C 2 minutes + 95°C 5 minutes + 95°C 15 seconds / 60°C 40 seconds / 3 cycles + 95°C 15 seconds / 60°C 35 seconds / 45 cycles), and the program was verified multiple times on multiple devices. The specific program is as follows:

[0235] The PCR amplification reaction procedure of the kit is:

[0236] Decontamination: 50°C, 2 minutes;

[0237] Pre-denaturation: 95°C, 5 minutes;

[0238] The first stage consisted of three amplification cycles, whose conditions were: denaturation at 95°C for 15 seconds and 60°C for 40 seconds;

[0239] The second stage consisted of 45 amplification cycles with the following conditions: denaturation at 95°C for 15 seconds and 60°C for 35 seconds.

[0240] Set up fluorescence signal acquisition.

[0241] 3. Test kit result judgment

[0242] The sample genotyping is determined based on the Ct values ​​of the wild-type and mutant fluorescence channels of the same gene locus. If the test result shows a typical S-type amplification curve and the Ct value is less than the judgment value, it is judged as positive; NoCT means no amplification, atypical S-type amplification curve, and the Ct value is greater than the judgment value, which is judged as negative, and the Ct judgment value is 40. The typing results of each gene locus are as follows Figure 3 shown.

[0243] The genotyping results are as follows:

[0244] When the internal reference Ct value is ≤36, the FAM channel Ct value is ≤40, the VIC channel Ct value is greater than 40 or NoCT is displayed, the genotype is: CYP2D6*10 T / T, ADRB1 C / C, CACNA1C T / T, CYP3A5*3 G / G;

[0245] When the internal reference Ct value is ≤36, the VIC channel Ct value is ≤40, the FAM channel Ct value is greater than 40 or NoCT is displayed, the genotype is: CYP2D6*10 C / C, ADRB1 G / G, CACNA1C G / G, CYP3A5*3 A / A;

[0246] When the internal reference Ct value is ≤36, the FAM channel Ct value is ≤40, and the VIC channel Ct value is ≤40, the genotype is: CYP2D6*10C / T, ADRB1 C / G, CACNA1C G / T, CYP3A5*3 A / G;

[0247] When the internal reference Ct value is ≤36, the ROX channel Ct value is ≤40, and the CY5 channel Ct value is greater than 40 or displays NoCT, the genotype is: ACE D / D, CYP2C9*3 A / A, ADD1 G / G;

[0248] When the internal reference Ct value is ≤36, the CY5 channel Ct value is ≤40, and the ROX channel Ct value is greater than 40 or displays NoCT, the genotype is: ACE I / I, CYP2C9*3 C / C, ADD1 T / T;

[0249] When the internal reference Ct value is ≤36, the ROX channel Ct value is ≤40, and the CY5 channel Ct value is ≤40, the genotype is: ACE D / I, CYP2C9*3 A / C, ADD1 G / T;

[0250] According to the genotyping results of the kit, referring to the annotations of drug-related gene variations in the international pharmacogenomics authority database (PharmGKB), corresponding drug use recommendations are given for the kit test results according to the drugs, gene loci, test results, and result interpretations. The detailed results are shown in Table 8 below;

[0251]

[0252] The technical solution of this embodiment is based on multiplex fluorescence PCR technology, and uses the TaqMan-MGB probe method for genotyping. Multiple detection is achieved by marking the probes for detecting different alleles with different fluorescent modifications, which saves detection costs while shortening the detection time, and improves detection efficiency and practicality. The primers and probes of this technical solution are the core raw materials in the kit, and the quality of the primers and probes plays an extremely critical role in the accuracy of the detection of sample gene sites. For the 7 gene sites determined in the above embodiment, we refer to the gene site nucleotide sequence and 1 internal standard gene (β-actin) nucleotide sequence published by the National Genome Science Data Center, and design them according to the TaqMan primer probe design principle, using professional primer probe design software Primer Premier 5 and Oligo 7, and design primer probe sequences in the 300bp region upstream and downstream of each detection gene site, and screen out the required primer probe combination through software analysis. The specific primer probe sequence is shown in Table 9 below.

[0253]

[0254] On this basis, we further improved the one-step nucleic acid treatment technology of the kit: the conventional one-step treatment solution of the kit is composed of sodium hydroxide solution, SDS, and sodium iodide solution. Based on the basic principle that high-concentration sodium hydroxide (NaOH) solution can denature proteins and destroy cell membrane structure; SDS can destroy cell membranes and denature proteins and precipitate; sodium iodide NaI can quickly lyse cells. We replaced the commonly used NaI with potassium iodide KI, and established a one-step extraction solution prepared by a mixed solution of KI, NaOH, and SDS, taking advantage of the similar chemical properties of potassium iodide KI and NaI, the stability of its solution compared with NaI, and the low price, so as to quickly obtain peripheral blood genomic DNA. This method removes the components of red blood cells and components such as white blood cell membrane proteins as much as possible, and directly lyses the cell membrane and nuclear membrane in a short time through the one-step treatment solution, so that the DNA is released without being destroyed. This method has fewer steps, a short time, less DNA loss, and a relatively high DNA yield. The extract components are cheap, stable in nature, relatively safe and non-toxic, and do not require special experimental conditions and proteinase K. It can be prepared in general laboratories and can be used to quickly release genomic DNA in samples. It can reduce the number of DNA extraction steps and the use of DNA extraction reagents, saving operation time and detection costs.

[0255] 4. Verification of the accuracy of the test results of the kit

[0256] Eight whole blood specimens covering all types of gene loci detected by the kit were selected for detection using the kit of the present invention, and were sent to Beijing Macromicro Biotechnology Co., Ltd. for Sanger sequencing to determine the specificity of the method.

[0257] The verification results show that ( Figure 4 ) were compared with the first-generation Sanger sequencing results, and the results of the present invention were completely consistent with those of the gold standard first-generation sequencing.

[0258] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of a reagent for detecting a combination of seven gene polymorphisms in the preparation of a kit for guiding medication for hypertension, characterized in that: The reagent includes primers and probes for detecting polymorphisms of 7 loci, namely, CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T), and does not include primers and probes for detecting polymorphisms of other gene loci, wherein the sequences of the primers and probes for the polymorphisms of the 7 loci are as follows: Primer pair for detecting CYP2D6 (c.100C>T): SEQ ID NO.1 and SEQ ID NO.2; Specific probes for detecting CYP2D6 (c.100C>T): SEQ ID NO.3 and SEQ ID NO.4; Primer pair for detecting ACE (I / D): SEQ ID NO.5 and SEQ ID NO.6; Detection of ACE (I / D) specific probes: SEQ ID NO.7 and SEQ ID NO.8; Primer pair for detecting ADRB1 (c.1165G>C): SEQ ID NO.9 and SEQ ID NO.10; Detection of ADRB1 (c.1165G>C) specific probes: SEQ ID NO.11 and SEQ ID NO.12; Primer pair for detecting CYP2C9*3 (c.1075A>C): SEQ ID NO.13 and SEQ ID NO.14; Detection of CYP2C9*3 (c.1075A>C) specific probes: SEQ ID NO.15 and SEQ ID NO.16; Primer pair for detecting CACNA1C (c.50-1658T>G): SEQ ID NO.17 and SEQ ID NO.18; Detection of CACNA1C (c.50-1658T>G) specific probes: SEQ ID NO.19 and SEQ ID NO.20; Primer pair for detecting ADD1 (c.1378G>T): SEQ ID NO.21 and SEQ ID NO.22; Detection of ADD1 (c.1378G>T) specific probes: SEQ ID NO.23 and SEQ ID NO.24; Primer pair for detecting CYP3A5*3 (c.219-237A>G): SEQ ID NO.25 and SEQ ID NO.26; Detection of CYP3A5*3 (c.219-237A>G) specific probes: SEQ ID NO.27 and SEQ ID NO.28; Detection of internal reference β-actin primer pair: SEQ ID NO.29 and SEQ ID NO.30; Detection of internal reference β-actin specific probe: SEQ ID NO.31; The method of using the kit includes: The sample genotype is determined according to the Ct values ​​of the wild-type and mutant fluorescence channels of the same gene locus. If the test result shows a typical S-shaped amplification curve and the Ct value is less than the judgment value, it is judged as positive; NoCT means no amplification, atypical S-shaped amplification curve, and the Ct value is greater than the judgment value, both of which are judged as negative, and the Ct judgment value is 40.

2. A kit for guiding medication for hypertension, the kit comprising: 1) Reaction solution 1#: Contains primer-probe mixture for detecting CYP2D6 (c.100C>T) and ACE (I / D): Primer pair for detecting CYP2D6 (c.100C>T): SEQ ID NO.1 and SEQ ID NO.2; Specific probes for detecting CYP2D6 (c.100C>T): SEQ ID NO.3 and SEQ ID NO.4; Primer pair for detecting ACE (I / D): SEQ ID NO.5 and SEQ ID NO.6; Detection of ACE (I / D) specific probes: SEQ ID NO.7 and SEQ ID NO.8; 2) Reaction solution 2#: Contains primer-probe mixture for detecting ADRB1 (c.1165G>C) and CYP2C9*3 (c.1075A>C): Primer pair for detecting ADRB1 (c.1165G>C): SEQ ID NO.9 and SEQ ID NO.10; Detection of ADRB1 (c.1165G>C) specific probes: SEQ ID NO.11 and SEQ ID NO.12; Primer pair for detecting CYP2C9*3 (c.1075A>C): SEQ ID NO.13 and SEQ ID NO.14; Detection of CYP2C9*3 (c.1075A>C) specific probes: SEQ ID NO.15 and SEQ ID NO.16; 3) Reaction solution #3: Contains primer-probe mixture for detecting CACNA1C (c.50-1658T>G) and ADD1 (c.1378G>T): Primer pair for detecting CACNA1C (c.50-1658T>G): SEQ ID NO.17 and SEQ ID NO.18; Detection of CACNA1C (c.50-1658T>G) specific probes: SEQ ID NO.19 and SEQ ID NO.20; Primer pair for detecting ADD1 (c.1378G>T): SEQ ID NO.21 and SEQ ID NO.22; Detection of ADD1 (c.1378G>T) specific probes: SEQ ID NO.23 and SEQ ID NO.24; 4) Reaction solution 4#: Contains primer-probe mixture for detecting CYP3A5*3 (c.219-237A>G) and internal reference β-actin: Primer pair for detecting CYP3A5*3 (c.219-237A>G): SEQ ID NO.25 and SEQ ID NO.26; Detection of CYP3A5*3 (c.219-237A>G) specific probes: SEQ ID NO.27 and SEQ ID NO.28; Detection of internal reference β-actin primer pair: SEQ ID NO.29 and SEQ ID NO.30; Detection of internal reference β-actin specific probe: SEQ ID NO.

31.

3. The kit according to claim 2, characterized in that The kit includes a PCR reaction solution, a one-step treatment solution, an enzyme mixture, a positive control and a negative control, wherein: The one-step treatment solution is a mixed solution prepared from 0.1% sodium dodecyl sulfate (SDS), 15% potassium iodide (KI) and 0.2% sodium hydroxide (NaOH); The enzyme mixture contains TaqDNA polymerase, UNG enzyme, dNTP, MgCl2 and PCR buffer; The positive control of the kit is a mixture of mutant plasmids and wild-type plasmid DNA of seven gene loci: CYP2D6 (c.100C>T), CYP2C9*3 (c.1075A>C), ADRB1 (c.1165G>C), ACE (I / D), CACNA1C (c.50-1658T>G), CYP3A5*3 (c.219-237A>G), and ADD1 (c.1378G>T); The negative control was ultrapure water without target gene and internal reference gene.

Images