Application of circNfix as a biomarker in the detection, diagnosis or prognosis of acute kidney injury in sepsis

Abstract

The present invention provides the use of circNfix as a biomarker in the detection, diagnosis or prognosis of acute kidney injury in sepsis, belonging to the field of molecular biology technology. The present invention provides the use of circNfix as a biomarker in the preparation of a reagent or kit for the detection, diagnosis or prognosis of acute kidney injury in sepsis, and the use of a circNfix overexpression preparation in the preparation of a drug for the treatment of acute kidney injury in sepsis. circNfix is ​​highly conserved between humans and mice and is significantly downregulated in the renal cortex of SAKI mice and LPS-treated TECs; knocking down circNfix can activate inflammatory damage in TECs, and exogenous overexpression of circNfix can reduce kidney damage and inflammatory response in SAKI mice and improve renal function. Clarifying the mechanism of action of circNfix in SAKI has great theoretical value and clinical practical significance.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology technology, and in particular to the use of circNfix as a biomarker in the detection, diagnosis or prognosis of sepsis-induced acute kidney injury. Background Art

[0002] Acute kidney injury (AKI) is a clinical syndrome characterized by a rapid decline in renal function, resulting from a variety of etiologies. Sepsis is a major cause of AKI. Compared with non-septic AKI, septic acute kidney injury (SAKI) has a significantly higher mortality rate, and SAKI can significantly increase the risk of chronic kidney disease after discharge from the hospital. Due to its complex etiology and incompletely understood molecular mechanisms, current clinical treatment for SAKI is primarily symptomatic, lacking effective and specific treatments. Consequently, the mortality rate of SAKI patients remains high, necessitating the development of targeted therapeutic agents and methods. Further elucidating the pathogenesis of SAKI and designing potential new targets to mitigate renal damage will help overcome the bottleneck in the prevention and treatment of SAKI and generate significant social and economic benefits.

[0003] Regarding the pathogenesis of SAKI, it is currently believed that the occurrence of SAKI is related to multiple factors such as inflammatory damage, oxidative stress, autophagy and apoptosis. Among them, inflammatory damage is the fundamental mechanism of the occurrence and development of SAKI. Recent studies have shown that damage to renal tubular epithelial cells (TECs) plays an important role in the occurrence and development of SAKI. TECs are not only passive victims of inflammatory factors, but also drivers of renal inflammatory damage. In addition to being directly damaged by the inflammatory response and causing cell apoptosis, inflammatory signals in damaged TECs are activated, thereby amplifying the renal inflammatory response and causing more TECs to apoptosis, thus forming a vicious cycle. TECs drive the progression of SAKI through inflammatory damage and apoptosis. Alleviating inflammatory damage to TECs may be a potential target for the treatment of SAKI.

[0004] Circular RNA (circRNA), a newly discovered class of noncoding RNA, is a covalently structured endogenous RNA primarily produced by alternative splicing of pre-mRNA precursors. This is the opposite of the forward splicing of linear mRNAs, where exons or introns cyclize to form a complete circular structure. Compared to microRNAs (miRNAs) and long noncoding RNAs (lncRNAs), circRNAs possess high expression abundance, stable structures, and disease specificity. These characteristics make circRNAs more promising as novel biomarkers or potential therapeutic targets than linear miRNAs and lncRNAs, offering promising clinical translational applications as diagnostic markers and even drug design targets. CircRNA expression is often tissue- and cell-specific, allowing interventions to precisely target pathological changes in specific target cells. Consequently, research on circRNAs has become a hot topic in the biomedical field in recent years. Summary of the Invention

[0005] The present invention aims to provide the use of circNfix as a biomarker in the detection, diagnosis or prognosis of sepsis-induced acute kidney injury.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides the use of circNfix as a biomarker in the preparation of a reagent or kit for detecting, diagnosing or prognosing sepsis-induced acute kidney injury.

[0008] The nucleotide sequence of mouse circNfix is ​​shown in SEQ ID NO.1:

[0009] GATGAGTTCCACCCGTTTATCGAGGCGCTGCTGCCTCACGTCCGAGCCTTCTCCTACACCTGGTTCAACCTGCAGGCGCGGAAGCGCAAGTACTTCAAGAAGCACGAGAAGCGGATGTCAAAGGACGAGGAGCGCGCAGTGAAGGACGAGCTGCTGGGCGAGAAGCCTGAGATCAAGCAGAAGTGGGCATCCCGGCTGTTGGCCAAGCTGCGCAAAGACATCCGGCCCGAGTTCCGCGAGGACTTTGTGCTAACCATCACGGGCAAGAAGCCCCCCTGCTGCGTGCTTTCCAACCCCGACCAGAAGGGCAAGATCCGGCGGATTGACTGCCTGCGCCAGGCTGACAAGGTGTGGCGGCTGGACCTGGTCATGGTGATTTTGTTTAAAGGGATCCCTTTGGAAAGTACTGATGGGGAGCGGCTCTACAAGTCGCCCCAGTGCTCGAACCCCGGCCTGTGTGTCCAGCCACATCACATTGGAGTCACAATCAAAGAACTGGACCTTTATCTGGCTTACTTTGTCCACACTCCGG。

[0010] The nucleotide sequence of human circNfix is shown in SEQ ID NO.2:

[0011] .

[0012] Preferably, the reagent or kit is used to detect the expression level of circNfix in serum or blood samples.

[0013] Preferably, the expression level of circNfix is ​​decreased in tubular epithelial cells of septic acute kidney injury.

[0014] The present invention also provides a use of a PCR primer pair in preparing a reagent or kit for detecting, diagnosing or prognosing acute kidney injury caused by sepsis, wherein the primer pair is a mouse circNfix primer or a human circNfix primer;

[0015] The sequence of the forward primer of the mouse circNfix primer is shown in SEQ ID NO.3, and the sequence of the reverse primer is shown in SEQ ID NO.4;

[0016] The sequence of the forward primer of the human circNfix primer is shown in SEQ ID NO.5, and the sequence of the reverse primer is shown in SEQ ID NO.6.

[0017] The present invention also provides use of a circNfix overexpression preparation in preparing a medicament for treating sepsis-induced acute kidney injury.

[0018] Preferably, the circNfix overexpression preparation is a substance that can increase the expression level of circNfix.

[0019] Compared with other existing technologies, the present invention has the following beneficial effects:

[0020] This study established a cecal ligation and puncture (CLP)-induced septic acute kidney injury (SAKI) mouse model and used high-throughput microarrays to detect and analyze circRNAs expressed in the renal cortex in SAKI for the first time. Among the differentially expressed circRNAs, circNfix was found to be highly conserved between humans and mice, significantly downregulated in the renal cortex of SAKI mice and in LPS-treated TECs, and mainly localized in the cytoplasm of TECs. It has the characteristics of resistance to nuclease degradation and stable expression.

[0021] Knockdown of circNfix activates inflammatory damage in TECs. CircNfix acts as a molecular scaffold to promote the binding of YTHDF2 to HECTD1, leading to the ubiquitination and degradation of YTHDF2. Reduced YTHDF2 levels inhibit activation of the NF-κB signaling pathway, alleviating apoptosis and proinflammatory responses. Exogenous overexpression of circNfix can alleviate kidney damage and inflammation in SAKI mice and improve renal function. Therefore, circNfix triggers inflammatory damage in TECs in SAKI and is an ideal target for SAKI intervention. Furthermore, circNfix is ​​highly conserved between human and mouse sequences and has significant clinical translational value. Clarifying the mechanism of action of circNfix in SAKI has significant theoretical and clinical implications. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Figure 3: Differential circRNA expression profiles in the renal cortex of SAKI mice. A: Boxplot showing the expression distribution of circRNAs in the renal cortex of CLP and sham-operated mice. B: Heatmap showing cluster analysis of differentially expressed circRNAs in the renal cortex of CLP mice.

[0023] Figure 2 Schematic diagram of the screening process for candidate circRNA molecules. A: Screening process for candidate circRNA molecules; B: Screening results for candidate circRNA molecules.

[0024] Figure 3Expression levels of circNfix and its parent gene, Nfix mRNA, were detected in the renal tissue of SAKI mice and in human and mouse cell lines treated with inflammatory factors. A: Schematic diagram of the primer design strategy for the linear gene (Nfix mRNA) and circular gene (circNfix); B: qRT-PCR results show the expression of circNfix and Nfix mRNA in the renal cortex of CLP and sham mice; C: qRT-PCR results show the expression of circNfix and Nfix mRNA in HK2 cells treated with LPS (10 μg / mL) or TNF-α (10 ng / mL). **P < 0.01, ***P < 0.001.

[0025] Figure 4 ISH assays were used to detect the expression and localization of circNfix in mouse kidney and TECs. A: ISH assays were used to detect the expression and localization of circNfix in mouse kidney using paraffin sections; B: Fluorescence in situ hybridization assays were used to detect the cellular localization of circNfix in TECs treated with LPS and TNF-α.

[0026] Figure 5 Figure 2: Effects of circNfix knockdown on the NF-κB signaling pathway. A: Western blot analysis showing the effect of circNfix knockdown on p65 phosphorylation; B: Statistical results of the effect of circNfix knockdown on p65 phosphorylation; C: Immunofluorescence analysis showing the effect of circNfix overexpression on p65 nuclear translocation; D: Nuclear-cytoplasmic fractionation combined with Western blot analysis showing the effect of circNfix on p65 protein content in the nucleoplasm; E: Luciferase reporter gene analysis showing the effect of circNfix knockdown on NF-κB transcriptional activity. **P < 0.01, ***P < 0.001.

[0027] Figure 6 Figure 2: Effects of circNfix overexpression on the NF-κB signaling pathway. A: Western blot analysis of the effect of circNfix overexpression on p65 phosphorylation; B: Statistical results of the effect of circNfix overexpression on p65 phosphorylation; C: Immunofluorescence analysis of the effect of circNfix overexpression on p65 nuclear translocation; D: Nuclear-cytoplasmic fractionation combined with Western blot analysis of the effect of circNfix on the nuclear and cytoplasmic p65 protein content; E: Luciferase reporter gene analysis of the effect of circNfix overexpression on NF-κB transcriptional activity. **P < 0.01, ***P < 0.001.

[0028] Figure 7Figure 3: circNfix pull-down efficiency and Coomassie staining of interacting proteins. A: RNA pull-down results using the sense probe and the antisense probe, respectively. B: RNA pull-down products were run on SDS-PAGE, followed by Coomassie staining of the gel. **P < 0.01.

[0029] Figure 8 Protein spectrum identification results. A: Protein spectrum results show proteins bound by circNfix and proteins bound by the negative control group; B: Protein spectrum secondary peak diagram shows the specific amino acid peptides bound by circNfix and YTHDF2.

[0030] Figure 9 Results of an RNA pull-down combined with immunoblotting assay for circNfix binding to YTHDF2. A: YTHDF1 / 2 / 3 protein expression in the circNfix RNA pull-down assay; B: circNfix content in the YTHDF1 / 2 / 3 co-precipitated complex. **P < 0.01.

[0031] Figure 10 Figure 4: Effects of circNfix knockdown or overexpression on YTHDF2 protein and transcript levels. A: Western blot analysis of the effects of circNfix knockdown or overexpression on YTHDF2 protein levels in HK2 cells. EF: qRT-PCR analysis of the effects of circNfix knockdown or overexpression on YTHDF2 mRNA levels. ***P < 0.001.

[0032] Figure 11 Figure 4: Effects of circNfix overexpression on YTHDF2 protein levels. AB: Immunoblotting analysis of the effects of circNfix overexpression combined with MG132 treatment on YTHDF2 protein levels in HK2 cells. C: Immunoprecipitation analysis of the effect of circNfix on YTHDF2 ubiquitination in LPS-treated HK2 cells. **P < 0.01, ***P < 0.001.

[0033] Figure 12Figure 1: HECTD1 regulates YTHDF2 ubiquitination. A: RNA pull-down combined with immunoblotting to detect the binding of circNfix to HECTD1; B: Co-IP assay to detect the binding of YTHDF2 to HECTD1; C-D: Immunoblotting to detect the effect of HECTD1 knockdown on YTHDF2 protein levels; E: Immunoprecipitation assay to detect the effect of HECTD1 knockdown on YTHDF2 ubiquitination; F: Immunoprecipitation assay to detect the effect of HECTD1 knockdown on abrogating circNfix-mediated YTHDF2 ubiquitination. **P < 0.01.

[0034] Figure 13 Results from experiments demonstrating that the binding of HECTD1 to YTHDF2 depends on circNfix. A: Co-IP detection of the binding of HECTD1 to YTHDF2 in the presence of RNase A or RNase R; B: Quantitative analysis of the binding of HECTD1 to YTHDF2 in the presence of RNase A or RNase R.

[0035] Figure 14 Figure 4: Effects of circNfix and YTHDF2 knockdown on NF-κB signaling pathway activation and cell apoptosis. AB: Western blotting analysis of the effect of YTHDF2 knockdown on the phosphorylation ratio of p65 in circNfix-knockdown HK2 cells; C: Immunofluorescence analysis of the effect of YTHDF2 knockdown on p65 localization in circNfix-knockdown HK2 cells; D: Detection of NF-κB signaling pathway activity in HK2 cells; EF: Flow cytometry analysis of the effect of YTHDF2 knockdown on apoptosis in circNfix-knockdown HK2 cells. **P < 0.01, ***P < 0.001.

[0036] Figure 15 Figure 4: Effect of circNfix overexpression on renal cortical cell apoptosis in SAKI mice. AB: Immunoblotting analysis of the effects of circNfix overexpression on pro-apoptotic and anti-apoptotic molecules in the renal cortex of CLP mice; C: TUNEL staining showing the number of apoptotic TECs in the renal cortex of each group of mice. ***P < 0.001.

[0037] Figure 16 Figure 4: Effects of circNfix overexpression on renal inflammatory responses in SAKI mice. A and B: Immunoblotting to detect protein levels of proinflammatory cytokines (Il-1β, TNF-α) and chemokines (MCP-1) in the renal cortex of mice in each group. C: Immunohistochemistry to detect F4 / 80 expression in the renal cortex of mice in each group. ***P < 0.001.

[0038] Figure 17Effects of circNfix overexpression on renal function and renal injury in SAKI mice. A: Serum creatinine levels in mice; B: Renal pathological morphology in sham and CLP mice as shown by PAS staining; C: Renal tubular injury scores in sham and CLP mice. **P < 0.01. DETAILED DESCRIPTION

[0039] The technical solutions provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of protection of the present invention. The reagents and detection methods not mentioned in the following examples are all common reagents and detection methods in the art.

[0040] Example 1

[0041] The mouse cecal ligation and puncture (CLP) model, with pathophysiological changes and inflammatory mediator changes similar to those seen in humans, is widely recognized as a classic model for studying clinical sepsis. This study utilized a CLP-induced sepsis model in mice to identify SAKI-associated circRNAs using high-throughput methods and to further analyze the detailed molecular mechanisms by which circRNAs regulate the development and progression of SAKI.

[0042] 1. Research Methods

[0043] 1. A SAKI mouse model (cecal ligation and puncture method) was established, and RNA was extracted from the mouse renal cortex for circRNA expression profile chip detection and transcriptome analysis.

[0044] 2. Through conservation analysis of human and mouse sequences, the research object circNfix was identified.

[0045] 3. The expression levels of circNfix and its parent gene Nfix mRNA in the renal tissue of SAKI mice and human and mouse cell lines treated with inflammatory factors were studied by qRT-PCR.

[0046] 4. RNA in situ hybridization was used to detect the expression localization of circNfix in mouse kidney tissue sections, and RNA fluorescence in situ hybridization and cell nucleocytoplasmic separation-qPCR experiments were used to determine the nuclear / cytoplasmic expression ratio of circNfix.

[0047] 5. Knockdown or overexpress circNfix, and detect the activation of NF-κB signaling pathway and cell apoptosis by circNfix through immunoblotting, cell immunofluorescence, and luciferase reporter gene assay.

[0048] 6. Identify circNfix-binding proteins by RNA pull-down, Coomassie blue staining and protein profiling.

[0049] 7. Use RNA immunoprecipitation experiments and RNA pull-down to verify the binding of circNfix and YTHDF2.

[0050] 8. Co-IP experiments were used to detect whether YTHDF2 binds to the E3 ubiquitin ligase HECTD1, and to verify whether the expression of circNfix affects the binding between YTHDF2 and HECTD1.

[0051] 9. The effects of circNfix on renal inflammation and renal function in SAKI mice were detected by injecting adeno-associated virus carrying the circNfix sequence into the tail vein of mice.

[0052] 2. Test process:

[0053] 1. CLP Group: C57BL / 6J mice were weighed and recorded, and anesthetized with an intraperitoneal injection of 1% sodium pentobarbital. The abdominal wall was shaved with an electric shaver and disinfected with 75% alcohol. A midline incision was made, the abdominal wall opened, and the peritoneal cavity exposed. The cecum was gently dissected and exposed using blunt forceps. The cecal contents were gently pushed toward the distal end of the cecum. A 4-0 silk suture was then placed proximally at the 3 / 4 length of the cecum. A single through-puncture was then made with a 21G needle from the ligature to the midpoint of the distal cecum, carefully avoiding blood vessels. Finally, each puncture site was gently squeezed to expel a half-grain-sized amount of cecal contents, and the cecum was repositioned. The abdominal cavity was closed and sutured layer by layer. Each mouse was given a subcutaneous injection of 0.9% NaCl solution at a dose of 5 mL / 100 g body weight for fluid resuscitation. After surgery, the mice were placed in a constant temperature metal bath (37-38°C). After the mice woke up, they were returned to the cages. The conditions of the mice were observed and recorded every few hours.

[0054] Sham-operated group (Sham) mice: The cecum of C57BL / 6J mice was not ligated or punctured, and the remaining procedures were the same as those of CLP-SAKI mice.

[0055] Fresh renal cortical tissues from three mice in the CLP and sham groups were sent to Shanghai Kangcheng Biotechnology Co., Ltd. for circRNA chip detection and analysis (Mouse circular RNAArray V2.0; chip specifications: 8×15K; total number of probes: 14,236; Mouse circular RNAs). The experimental process is as follows: total RNA extraction from the samples; RNA quality testing: NanoDrop ND-1000 UV spectrophotometer to detect the purity and concentration of total RNA, and formaldehyde denaturing agarose gel electrophoresis to detect RNA integrity and gDNA contamination; RNase R treatment; cDNA synthesis; labeling; chip hybridization and scanning; data analysis and report compilation.

[0056] Fresh renal cortical tissue from three mice each in the CLP and sham groups was sent to Wuhan Kangce Technology Co., Ltd. for transcriptome sequencing analysis. The procedure was briefly described as follows: Total RNA was extracted from the renal cortical tissue. After RNA quality control, oligo dT was used to enrich for poly(A)-tailed mRNAs and some lncRNAs. The enriched mRNA / lncRNAs were fragmented and reverse transcribed, ligated with common sequencing adapters, and amplified by PCR to generate sequencing libraries. Transcriptome sequencing of the mRNA was performed using the Illumina Novaseq 6000 sequencing platform. Sequencing data were aligned, and differentially expressed genes were identified using criteria of a Corrected P value < 0.01 and a Log2Fold change > 1 or < -1. Gene oncogene annotation and KEGG pathway analysis were performed on differentially expressed genes using a P value < 0.05 to understand their functional roles and the major biochemical metabolic and signal transduction pathways they participate in. Finally, gene enrichment analysis was performed using GO and KEGG as background data sets. Enriched biological processes (BP) with P < 0.05 were considered significantly enriched. The association between gene expression profiles and phenotypes and whether the expression levels were statistically significant were analyzed.

[0057] Draw according to the test results Figure 1 , Figure 1 A shows that the distribution of circRNA expression profiles among the six samples is almost the same, but Figure 1 B shows that there are significant differences in the expression of circRNA between the CLP-SAKI group and the Sham group, suggesting that circRNA is involved in the occurrence and development of SKA.

[0058] 2. According to Figure 2The flowchart shown in A was used to screen candidate circRNA molecules. The specific process was as follows: 197 differentially expressed circRNAs (fold change ≥ 2, P < 0.05) identified in the renal cortex of SAKI mice were further screened to identify candidate research molecules. The screening process was as follows: (1) Using P < 0.05 and fold change ≥ 3.0 as the criteria, 30 differentially expressed circRNAs were screened; (2) Based on whether they were included in the circBase database, 7 circRNAs were screened; (3) Based on the degree of human-mouse homology, circNfix was screened as the circRNA with the highest homology (96%), as shown in Figure 3. Figure 2 As shown in B. Therefore, circNfix was selected as a candidate research molecule.

[0059] 3. According to Figure 3 The strategy shown in Figure A was used to design primers for the linear gene (Nfix mRNA) and the circular gene (circNfix). The primer sequences are shown in Table 1. Using the designed primers, circNfix (mouse) and Nfix mRNA (mouse), qRT-PCR was used to detect the expression of circNfix and Nfix mRNA in the renal cortex of CLP and sham mice. The qRT-PCR reaction system consisted of 5 μL of 2× Taq Pro Universal SYBR qPCR Master Mix, 0.5 μL of template DNA, 1 μL of primers, a total volume of 10 μL, and 3.5 μL of ddH2O. The qRT-PCR reaction procedure was as follows: Stage 1: initial denaturation, 95°C, 30 s, 1 cycle; Stage 2: cycling, 95°C, 5 s → annealing and extension, 60°C, 30 s, 40 cycles; Stage 3: melting curve analysis, 95°C, 15 s → 60°C, 60 s → 95°C, 15 s.

[0060] Specifically, by designing opposing primers targeting the circNfix circularization site and performing sequence alignment, it was discovered that circNfix is ​​formed by independent reverse splicing of exon 2 of the Nfix precursor pre-mRNA into a loop. Sanger sequencing of the circNfix PCR amplification product revealed that the fragment amplified by the opposing primers contained the linker sequence "TCCGGGATGAG" formed by reverse splicing of circNfix. Using forward and reverse primers for circNfix (mouse), it was found that the forward primer could amplify the circNfix sequence in both genomic DNA (gDNA) and reverse-transcribed cDNA, but the reverse primer could only amplify the circNfix sequence in cDNA. These results indicate that circNfix possesses the characteristics of a "head-to-tail" circRNA and is a transcriptional product, not present in genomic DNA.

[0061] The expression of circNfix and Nfix mRNA in the renal cortex of mice in the CLP and Sham groups is shown in Figure 2 Figure 3 As shown in B, at the same time, the expression of circNfix and Nfix mRNA in HK2 cells treated with LPS (10 μg / mL) or TNF-α (10 ng / mL) was detected, and the results were shown in Figure 3 As shown in C. It shows that the reverse splicing product of Nfix pre-mRNA (circNfix) is expressed in a decreased manner in both in vivo and in vitro TECs injury models, suggesting that circNfix may play a unique role in the damage process of TECs in SAKI.

[0062] Table 1 Primer sequences

[0063]

[0064] 4. To further clarify the expression localization of circNfix, in situ hybridization (ISH) experiments were performed on paraffin sections of mouse kidney tissue and cell immunofluorescence FISH experiments of TECs were performed: circRNA-specific probes and FITC-conjugated anti-digoxigenin antibodies were used to detect probe signals (Roche), and laser confocal fluorescence microscopy was used to detect the subcellular localization of circRNA.

[0065] Among them, the FISH probe sequence of circNfix (Mouse) is: TCCACACTCCGGGATGAGTTCCACCC (SEQ ID NO. 11);

[0066] The FISH probe sequence of CircNfix (Human) is: TCCACACTCCGGGAT GAGTTCCACCC (SEQ ID NO. 12);

[0067] The digoxigenin-labeled circNfix probe sequence is: TCCACACTCCGGGATGAGTTCCACCC (SEQ ID NO. 13).

[0068] The results of ISH experiments on paraffin sections are as follows Figure 4 As shown in A, circNfix expression is reduced in the renal cortex of CLP mice and is mainly located in the cytoplasm of TECs. Figure 4 As shown in Figure B, circNfix is ​​primarily expressed in the cytoplasm of TECs and is downregulated in TECs stimulated with LPS (10 μg / mL) or TNF-α (10 ng / mL). circNfix is ​​primarily localized in the cytoplasm of TECs and HK2 cells and is downregulated after inflammation, suggesting that the circNfix sequence is well conserved between humans and mice and is downregulated in TECs of SAKI mice.

[0069] 5. In order to clarify the role of circNfix in TECs, circNfix was knocked down and overexpressed respectively.

[0070] Specific knockdown of circNfix was performed by designing a specific siRNA sequence targeting the circNfix cyclization site (reverse splicing region) (sequence: CCACACUCCGGGAUGAGUUTT, SEQ ID NO. 14; synthesized and knocked down by Shanghai Jima Pharmaceutical Technology Co., Ltd.). After knockdown, the activation function of circNfix on the NF-κB signaling pathway was detected by immunoblotting, cell immunofluorescence, and luciferase reporter gene assays. The immunoblotting results are shown in Figure 2. Figure 5 As shown in AB, knockdown of circNfix significantly enhanced the phosphorylation ratio of p65 in normal or LPS-treated HK2 cells. Figure 5 As shown in C, it is shown that knocking down circNfix can promote the translocation of p65 into the nucleus. The results of nuclear cytoplasm fractionation experiment combined with immunoblotting are shown in Figure 5 As shown in D, knockdown of circNfix promoted the translocation of p65 into the nucleus in control or LPS-treated HK2 cells. Figure 5 As shown in Figure E, knockdown of circNfix promoted the transcriptional activity of the NF-κB signaling pathway.

[0071] Overexpression of circNfix was performed by transiently transfecting TECs with a circRNA overexpression plasmid designed by Shanghai Jikai Biotechnology Co., Ltd. After overexpression, the activation function of circNfix on the NF-κB signaling pathway was detected by immunoblotting, cell immunofluorescence, and luciferase reporter gene assays. Figure 6 As shown in AB, overexpression of circNfix significantly reduced the phosphorylation ratio of p65 in HK2 cells treated with LPS. Figure 6 As shown in C, overexpression of circNfix can inhibit the translocation of p65 into the nucleus. The results of nuclear cytoplasm fractionation combined with immunoblotting are shown in Figure 6 As shown in D, overexpression of circNfix reduced the nuclear translocation of p65 in LPS-treated HK2 cells. The results of the luciferase reporter gene experiment are shown in Figure 6 As shown in E, overexpression of circNfix inhibits the transcriptional activity of the NF-κB signaling pathway.

[0072] 6. To clarify the mechanism of action of circNfix in regulating the NF-κB signaling pathway, we explored whether circNfix can exert its effect by directly binding to proteins. We used a biotinylated probe targeting the reverse splicing sequence of circNfix (Sense probe: GTGGAACTCATCCCGGAGTG, SEQ ID NO.15) and its negative control (Antisense probe: CACTCCGGGATGAGTTCCAC, SEQ ID NO.16) to perform RNA pull-down experiments on circNfix, and the proteins pulled down by the RNA pull-down experiments were separated by SDS-PAGE and then analyzed by mass spectrometry. Figure 7 As shown in A, it shows that the positive chain probe can bind to circNfix very significantly, while the antisense chain probe cannot bind to circNfix. Subsequently, the protein obtained by RNA pull-down was subjected to SDS-PAGE separation experiment, and then stained with Coomassie Brilliant Blue to show different protein bands. The results are shown in Figure 7 As shown in B.

[0073] After staining the SDS gel with Coomassie brilliant blue, different protein bands were displayed. The SDS gel region where the specific bands were located was cut and sent for protein spectrum detection. The protein spectrum detection results were as follows: Figure 8 As shown in the figure, a total of 66 circNfix-binding proteins were identified. Among all circNfix-interacting proteins, YTHDF2 was the protein with the highest confidence in binding to circNfix. Therefore, it is speculated that circNfix may exert its effect by binding to YTHDF2.

[0074] 7. To further verify the reliability of the binding between YTHDF2 and circNfix, RNA pull-down combined with immunoblotting experiments were performed. The test results are as follows: Figure 9 As shown in A, circNfix binds to YTHDF2, while the other two molecules of the YTHDF family, YTHDF1 and YTHDF3, cannot bind to circNfix. Figure 9 As shown in Figure B, the complex bound to YTHDF2 contains circNfix, whereas the complexes bound to YTHDF1 and YTHDF3 do not contain circNfix. These results suggest that circNfix exerts its effects by binding to YTHDF2.

[0075] 8. To further clarify the changes in post-translational modifications caused by the binding of circNfix to YTHDF2, the results of immunoblotting assay were as follows: Figure 10 As shown in Figures A and B, knockdown of circNfix promoted YTHDF2 protein expression, while overexpression of circNfix inhibited LPS-induced upregulation of YTHDF2 expression. However, neither knockdown nor overexpression of circNfix affected YTHDF2 mRNA levels. These results suggest that circNfix regulates YTHDF2 protein expression at the post-translational modification level.

[0076] Next, based on overexpression of circNfix and LPS treatment of HK2, MG132 (a specific proteasome inhibitor) was used in combination, and the protein level of YTHDF2 was detected by immunoblotting. The results are as follows Figure 11 As shown in AB, it was shown that the combined use of proteasome inhibitor MG132 can offset the inhibitory effect of overexpression of circNfix on YTHDF2 protein expression. Figure 11 As shown in Figure C, overexpression of circNfix promoted the ubiquitination of YTHDF2, while the circNfix mutant had no such effect. These results suggest that circNfix regulates YTHDF2 protein expression by promoting the ubiquitin-dependent proteasomal degradation pathway of YTHDF2.

[0077] The steps for the YTHDF2 ubiquitination assay are as follows: HK2 cells transfected with the plasmid were treated with MG132 (10 μM for 6 hours). Cells were lysed with IP lysis buffer and cellular proteins were harvested. 2 μg of YTHDF2 antibody was added to 1 mg of cell lysate and mixed on a microfuge at 4°C overnight. The next day, Protein A / G magnetic beads were added to the reaction mixture and mixed at room temperature for 4 hours. The beads were washed five times with IP lysis buffer and then collected on a magnetic stand. IP lysis buffer and loading buffer were then added and reacted at 100°C for 5 minutes. YTHDF2, β-actin, and ubiquitin were then detected by immunoblotting.

[0078] To further identify the regulatory proteins involved in circNfix-regulated YTHDF2 ubiquitination, the 66 circNfix-binding proteins identified by protein profiling were analyzed again, such as Figure 8 As shown in A, among all RNA-binding proteins, HECTD1 is the only E3 ubiquitination ligase. RNA pull-down combined with immunoblotting detection is shown in Figure 12 As shown in A, it shows that circNfix can bind to HECTD1. The Co-IP detection results are shown in Figure 12 As shown in B, it is shown that YTHDF2 can bind to HECTD1. Figure 12 As shown in CD, the protein level of YTHDF2 was significantly reduced in TECs with HECTD1 knockdown. Figure 12 As shown in E, knockdown of HECTD1 can reduce the ubiquitination level of YTHDF2. Figure 12 As shown in Figure F, knockdown of HECTD1 abolished the effect of circNfix on YTHDF2 ubiquitination. These results further confirmed that HECTD1 is an E3 ubiquitin ligase that regulates the ubiquitination and degradation of YTHDF2 protein in HK2 cells.

[0079] Further Co-IP experiments (such as Figure 13 AB) found that adding the endogenous nuclease, ribonuclease A (RNaseA), to the immunoprecipitated complex effectively blocked the binding of HECTD1 to YTHDF2. However, using the exoribonuclease, ribonuclease R (RNase R), which only digests linear RNA but not circRNA, failed to inhibit the binding of HECTD1 and YTHDF2 in the immunoprecipitated complex, suggesting that the interaction between the two proteins depends on circNfix.

[0080] In order to verify whether the regulatory effect of circNfix on the NF-κB signaling pathway is dependent on YTHDF2, a "Rescue" experiment was set up: YTHDF2 was further knocked down in HK2 cells that had circNfix knocked down. The results of immunoblotting and immunofluorescence detection are shown in Figure 2. Figure 14 AC shows that knockdown of YTHDF2 can reduce the phosphorylation and nuclear translocation of p65 caused by knockdown of circNfix; the results of luciferase reporter gene experiments are shown in Figure 14 As shown in D, knockdown of YTHDF2 reversed the increased activity of the NF-κB signaling pathway caused by knockdown of circNfix; the results of flow cytometry and quantitative analysis are shown in Figure 14 Figures EF and EF showed that knockdown of YTHDF2 reduced the increased apoptosis of HK2 cells caused by knockdown of circNfix. These results indicate that circNfix inhibits the activity of the NF-κB signaling pathway by reducing the expression of YTHDF2, and the activation of the NF-κB signaling pathway caused by circNfix downregulation is dependent on YTHDF2.

[0081] 9. To explore the effect of circNfix on SAKI mice, AAV9 recombinant adeno-associated virus vector was used to mediate circNfix (AAV9 virus vector construction and AAV9 virus packaging were assisted by Shanghai Jikai Biotechnology Co., Ltd.) in mice to overexpress circNfix and evaluate the effect of circNfix in the SAKI mouse model. Figure 15 As shown in AB, the results of immunoblotting showed that overexpression of circNfix in vivo could reduce the levels of pro-apoptotic proteins (C-Casp3, Bax) and increase the levels of anti-apoptotic proteins (Bcl-2) in the renal cortex tissue of SAKI mice. TUNEL staining was further performed on the renal tissue sections of each group of mice. Figure 15 As shown in C, in vivo overexpression of circNfix can reduce the number of apoptotic cells in the kidney tissue of CLP-induced SAKI mice.

[0082] In order to investigate the effect of overexpression of circNfix on the inflammatory response in the kidney tissue of SAKI mice, the renal cortical tissue proteins of each group of mice were detected by immunoblotting. Figure 16 As shown in Figures AB, overexpression of circNfix in vivo can reduce the protein levels of proinflammatory cytokines (Il-1β, Tnf-α) and chemokines (MCP-1) in the renal cortex tissue of SAKI mice. Figure 16 As shown in C, in vivo overexpression of circNfix reduced the expression of F4 / 80 in the renal cortex tissue of CLP mice.

[0083] Further testing showed that overexpression of circNfix in vivo could significantly reduce the serum creatinine level in SAKI mice. Figure 17 As shown in A. The PAS staining results are as follows Figure 17 As shown in Figures BC, in vivo overexpression of circNfix ameliorates renal pathological morphology and tubular damage in SAKI mice. These results indicate that overexpression of AAV9-circNfix in SAKI mice can alleviate cell apoptosis, inflammatory response, and renal damage in SAKI mice, thereby improving renal function.

[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of AAV9-circNfix in the preparation of a drug for treating acute kidney injury caused by sepsis, wherein the circNfix is ​​a mouse circNfix or a human circNfix, the nucleotide sequence of the mouse circNfix is ​​shown in SEQ ID NO.1, and the nucleotide sequence of the human circNfix is ​​shown in SEQ ID NO.2.

Images