A rhizosphere fungus B-4 for promoting the growth of Bletilla striata and its application

Abstract

The invention relates to a rhizosphere fungus B‑4 for promoting the growth of Bletilla striata and an application thereof. A rhizosphere fungus B‑4 (Myrmecridium schulzeri B‑4) is separated and screened from rhizosphere soil of a medicinal plant Bletilla striata for the first time. The strain has a strong growth-promoting effect on the growth of Bletilla striata, bringing broad application prospects for the production of Bletilla striata.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial application, and particularly relates to a rhizosphere fungus B-4 for promoting the growth of Bletilla striata and an application thereof. Background Art

[0002] In recent years, more and more studies have confirmed the importance of rhizosphere microorganisms to the production of Chinese medicinal materials. Rhizosphere microorganisms and medicinal plants have gradually formed a complex interactive relationship in the long-term interaction process. Rhizosphere microorganisms can directly act on medicinal plants, promote or inhibit their growth, and affect the yield and quality of medicinal plants. The long-term and large-scale application of chemical fertilizers in the cultivation of Chinese medicinal materials will cause problems such as soil compaction, fertilizer waste, reduced fertilizer efficiency, and reduced quality and yield. Therefore, studying the symbiotic effects between rhizosphere microorganisms and medicinal plants and using microbial agents closely related to plant growth are important ways to effectively solve the above problems.

[0003] Bletilla striata (Thunb.) Rchb.F. is a perennial herbaceous plant of the Orchidaceae family. It is a plant with rich medicinal and ornamental value. Its dried tuber is used as a medicine for Bletilla striata, which has the effects of astringent hemostasis, swelling and muscle regeneration. It is often used for hemoptysis, vomiting blood, traumatic bleeding, sores, swelling, skin cracks, etc. It is a prescription medicinal material for various Chinese patent medicines such as Bletilla striata granules, Weikangling and Bletilla striata granules. In recent years, due to excessive excavation, wild resources of Bletilla striata are scarce, and it has now been listed as one of the key protected wild medicinal materials by the state. At present, the basic source of Bletilla striata medicinal materials is artificial planting, and the yield and quality of artificially planted Bletilla striata are uneven. Most orchid plants have an interactive relationship with microorganisms, and rhizosphere microorganisms can promote plant growth by helping the roots of orchid plants absorb nutrients from the soil. The inventor found that rhizosphere microorganisms have a significant effect on the growth and development of Bletilla striata. Therefore, providing a strain that can promote the growth of Bletilla striata is of great significance to the production of Bletilla striata. Summary of the invention

[0004] The invention aims to provide a Bletilla striata rhizosphere fungus B-4.

[0005] Another object of the present invention is to provide an application of a Bletilla striata rhizosphere fungus B-4 in the preparation of ecological planting products.

[0006] Another object of the present invention is to provide an application of a Bletilla striata rhizosphere fungus B-4 in the preparation of a product promoting the growth of Bletilla striata.

[0007] The bletilla striata rhizosphere fungus B-4 described in the present invention is classified and named Myrmecridium schulzeri B-4, and was deposited in the China Center for Type Culture Collection on September 12, 2023, with the deposit number of CCTCC NO:M 20231686.

[0008] The invention discloses an application of the bletilla striata rhizosphere fungus B-4 in the preparation of ecological planting products.

[0009] Preferably, the Bletilla striata rhizosphere fungus B-4 described in the present invention is used in products that promote the growth of Bletilla striata.

[0010] The present invention has the following beneficial effects:

[0011] 1. The present invention is the first to isolate and screen a rhizosphere fungus B-4 (Myrmecridium schulzeri B-4) from the rhizosphere soil of the medicinal plant Bletilla striata. The strain can be used in promoting the application of ecological planting products, especially has a strong growth-promoting effect on all aspects of the growth of Bletilla striata, bringing broad application prospects for the yield and quality control of Bletilla striata.

[0012] 2. The experiment confirmed that after the B-4 strain was inoculated on the modified CAS agar / siderophore detection medium, an orange halo appeared around the strain on the 10th day, indicating that B-4 has a certain ability to synthesize iron carriers. The fungus B-4 fermentation liquid mixed with CAS color solution showed a dark green reaction, and the sterile culture liquid mixed with CAS showed a light blue reaction (such as Figure 3 This indicates that fungus B-4 has the ability to synthesize siderophores.

[0013] 3. The SU of strain B-4 was 0.857, indicating that this strain was a siderophore-producing strain.

[0014] 4. After 90 days of planting, the growth indicators of Bletilla striata after inoculation of B-4 fermentation liquid in the soil were significantly higher than those of the control group in terms of plant height, leaf length, root length, tuber length, number of new roots and fresh weight of the whole plant. The results showed that rhizosphere fungus B-4 can promote the growth and development of Bletilla striata.

[0015] Storage information description:

[0016] The isolated strain was named Myrmecridium schulzeri B-4.

[0017] Preservation unit: China Center for Type Culture Collection (CCTCC for short).

[0018] Storage address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072.

[0019] Date of preservation: September 12, 2023.

[0020] Deposit number: CCTCC NO:M 20231686. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1Pictures of Bletilla striata growth (A: control group, B: B-4 treated group).

[0022] Figure 2 Colony morphology of rhizospheric fungus B-4 of Bletilla striata.

[0023] Figure 3 Qualitative determination of IAA in the fermentation broth of active strain B-4 of rhizospheric fungus of Bletilla striata.

[0024] Figure 4 Detection of the iron carrier synthesis ability of the active strain of Bletilla striata rhizospheric fungus B-4.

[0025] Figure 5 Phylogenetic relationships of rhizospheric fungi of Bletilla striata and its similar fungi.

[0026] Figure 6 Schematic diagram of potted inoculation experiment

[0027] Figure 7 Morphological diagram of Bletilla striata after potted plant inoculated with B-4 fermentation liquid

[0028] Figure 8 Comparative analysis of growth indexes of Bletilla striata after inoculation with B-4 fermentation liquid DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described in detail below through specific embodiments.

[0030] Example 1: Isolation, screening and identification of strains

[0031] 1. Isolation of strains

[0032] Test materials: The rhizosphere soil of Bletilla striata was collected from the test site.

[0033] Culture medium: 1000mL potato dextrose agar medium (PDA medium) contains 200g potato, 20g glucose, 15g agar, 100mg / L streptomycin 1mL, and the pH value of the culture medium is natural pH. 1000mL modified CAS agar / siderophore detection medium: weigh 166.24g CAS agar (30.24g piperazine diethanol sulfonic acid (100g glucose, 20g peptone, 0.5g magnesium sulfate heptahydrate, 0.5g calcium chloride, 15g agar powder), 10×CAS detection solution (0.06g CAS, 0.0027g FeCl3·6H2O, 0.073g HDTMA). 1000mL MS culture medium: weigh 4.74g MS culture medium powder, 20g sucrose, dissolve in 1000mL pure water, and adjust pH=5.84~5.88.

[0034] Rhizosphere soil: The rhizosphere soil was taken from the roots of Bletilla striata planted in sandy loam for 2 years. The top 2-3 cm of soil and weeds were removed. After the Bletilla striata was uprooted, the large pieces of soil attached to the roots were gently shaken off, leaving only about 1-2 mm of soil tightly attached to the roots. After rapid transportation to the laboratory at 4°C, the rhizosphere soil was gently brushed off with a soft brush. The taken rhizosphere soil was evenly mixed and divided into 3 portions, quickly frozen with liquid nitrogen and stored in a -80°C refrigerator.

[0035] Soil suspension: weigh about 1g of rhizosphere soil from Bletilla striata and put it into a 20mL sterile conical flask, add 9mL of sterile water, and shake in a shaking incubator at 28℃ for 30min to make a soil suspension. Pipette 0.5mL of soil suspension into a centrifuge tube containing 4.5mL of sterile water to make a 10% concentration. -1 Soil suspension was diluted to 10 -2 , 10 -3 , 10 -4 50 μL of soil suspension of different concentrations was evenly spread on the PDA plate medium, and cultured in a constant temperature incubator at 28°C for 3 to 7 days, during which the growth of the colony was observed.

[0036] Isolation and purification of strains: Observe the growth of colonies in the culture medium coated with soil suspension. Once fungal colonies grow, use a sterile toothpick to pick up the hyphae at the edge of a single colony and inoculate it into a new PDA plate culture medium for cultivation. Repeat the transfer until a single colony appears.

[0037] The isolated rhizosphere fungi were inoculated into PDA plates and cultured at 28°C for 3 to 7 days before use.

[0038] 2. Screening

[0039] Symbiotic culture of sterile Bletilla striata seedlings and rhizospheric fungi was used to conduct a preliminary screening of the life-promoting properties of the rhizospheric fungi of the Bletilla striata.

[0040] Fungal fermentation liquid: The isolated rhizosphere fungi of Bletilla striata were inoculated into 150 mL of PDA liquid and cultured in a constant temperature shaking incubator at 28°C and 180 rpm for 7 days. The fungal hyphae and the fermentation liquid were separated by sterile gauze, and the fermentation liquid was retained.

[0041] Prepare the MS liquid culture medium in advance, and put a circle of filter paper with a width of about 3 cm in a 250mL tissue culture bottle, close to the bottle wall. Each tissue culture bottle is filled with 50mL of culture medium and sterilized at 121°C for 20 minutes. Take a one-year-old Bletilla striata tissue culture seedling, cut off the leaves and roots of Bletilla striata with sterile scissors, wash away the residual culture medium with sterile water, and use sterile filter paper to absorb the water. Select Bletilla striata tubers of the same size, soak them in 75% alcohol for 1 minute, rinse them with sterile water 2 to 3 times, soak them in 0.1% HgCl solution for 4 minutes, and rinse them with sterile water 3 to 4 times. In the clean bench, use sandwich filter paper for culture, place the sterilized Bletilla striata tubers in the sandwich between the tissue culture bottle wall and the filter paper, and fix them. Inoculate 5 Bletilla striata tubers in each bottle, and finally add 3mL of strain fermentation liquid to each bottle. The control group (CK) adds sterile PDB culture medium cultured under the same conditions, and inoculates 10 bottles in each group. Place in a light culture room for cultivation, temperature 23 ~ 25 ℃, lighting time 8 ~ 12 hours per day, light intensity 2000 ~ 3000 Lux. Regularly observe the growth of Bletilla striata tissue culture seedlings. After 30 days of continuous cultivation, observe the growth of Bletilla striata tissue culture seedlings in the experimental group and the control group, and screen out fungi that can promote the growth of Bletilla striata. After 30 days of symbiotic cultivation, take out the Bletilla striata control seedlings and experimental seedlings, use filter paper to absorb water, and measure the plant height, number of new roots, and length of new roots of Bletilla striata (see Table 1, Figure 1 ).

[0042] Table 1 Growth indexes of Bletilla striata

[0043]

[0044] As a result, a growth-promoting fungal strain with strong anti-diabetes and growth-promoting effects was obtained, named B-4.

[0045] 3. Identification

[0046] (I) Morphological characteristics of strains

[0047] Observation of bacterial morphological characteristics: Inoculate the rhizosphere fungus strain B-4 to be identified on PDA medium and culture at 28°C. Observe its culture characteristics and color changes on the 3rd, 7th and 15th days. Observe the stable and mature color characteristics as its culture characteristics and as the basis for identification. Observe and record the color of aerial hyphae, and the size, color, tissue shape, surface shape, etc. of the colony as reference characteristics.

[0048] like Figure 2 As shown, the morphological characteristics of the colonies are: on the PDA culture medium, the colonies are round, the hyphae in the culture medium are waxy and radiating, and the aerial hyphae are white and cotton-like.

[0049] (II) ITS sequence and phylogenetic analysis of strains

[0050] Preparation of DNA template

[0051] Reagents: Lysis Buffer solution: Trish-HCl (12.44 g), NaCl (81.816 g), Na2EDTA (7.45 g), CTAB (20 g), DIECA (1 g), PVPK-30 (200 mg), β-mercaptoethanol (2 mL), constant volume 1000 mL, adjust pH = 8.0. PCI solution (25:24:1): balanced phenol (250 mL), chloroform (240 mL), isoamyl alcohol (10 mL). CI solution (24:1): chloroform (240 mL), isoamyl alcohol (10 mL).

[0052] DNA extraction

[0053] Take an appropriate amount of mycelium in a 2mL EP tube, add 1000μL Lysis Buffer solution, add a steel ball, grind in a sample tissue grinder for 5min, take it out and let it stand for 10min, centrifuge at 12000r / min for 10min. Take out the supernatant and add an equal volume of PCI solution, shake slowly for 2-3min, centrifuge at 12000r / min for 10min. Take out the supernatant and add an equal volume of CI solution for extraction, shake slowly for 2-3min, centrifuge at 12000r / min for 10min. Take out the supernatant in a 1.5mL EP tube, add 800mL of anhydrous ethanol, shake slowly for 2-3min, centrifuge at 12000r / min for 10min. Pour out the supernatant, add 750L75% ethanol, centrifuge at 12000r / min for 3min. Pour out the supernatant, dry at room temperature, and add 30-50μL ddH2O to dissolve.

[0054] (1) PCR instrument: C1000 Touch™ Thermal Cycler (BIO-RAD, USA).

[0055] (2) Amplification primers: ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0056] (3) Amplification system: The ITS sequence PCR amplification system is shown in Table 2.

[0057] The PCR reaction conditions are shown in Table 3.

[0058] Table 2 ITS sequence PCR amplification system

[0059]

[0060] Table 3 PCR reaction conditions

[0061]

[0062] Note: Step 2 was performed for 35 cycles.

[0063] Electrophoresis detection of PCR amplification products:

[0064] The electrophoresis conditions were 1% agarose gel (containing 0.8 g agarose, 90 mL TAE buffer), 1X TAE electrophoresis buffer, 360 V for 15 min, and 1 μL of PCR product was loaded, mixed with 1 μL Loading Buffer and then spotted.

[0065] Observe the results under the UV light of the gel imaging system, and use 2000 DNA Marker as the nucleic acid standard molecular weight reference to determine the length of the amplified fragment. The amplified product band should be at the position of 400-700bp of the standard.

[0066] PCR product purification and sequencing: performed by Shanghai Bioengineering.

[0067] Construction of phylogenetic tree:

[0068] Log in to NCBI, compare the fungal rDNA ITS sequence obtained by sequencing with the sequence in the GenBank database, record its accession number, most similar strain, similarity, etc., and download the rDNA ITS sequence of the strain, use MEGA7 to perform cluster analysis and construct a phylogenetic tree. The ITS sequence of B-4 is shown in the sequence table.

[0069] The rDNAITS sequence was compared with BLAST homology in GeneBank to obtain the representative strain with the highest similarity, and its accession number, most similar strain, similarity, etc. were recorded. The rDNAITS sequence of the strain was downloaded and a phylogenetic tree was constructed (such as Figure 5 The strains with the highest similarity to strain B-4 are shown in Table 3.

[0070] Table 4 The strains most similar to fungus B-4

[0071]

[0072] A 500-600 bp fragment was amplified from the genomic DNA of the strain using primers ITS1 and ITS4, and the sequencing results were compared using BLAST in GenBank.

[0073] The results showed that strain B-4 had high base sequence similarity with fungi in the genus Myrmecridium, so the reference strain sequence of the genus Myrmecridium was downloaded from GenBank for phylogenetic analysis, with Myrmecridium schulzeri (ON006785.1) in the genus Myrmecridium as the outgroup. In the constructed phylogenetic tree, B-4 and multiple strains of Myrmecridium schulzeri clustered together to form a terminal branch with a support strength of 98%.

[0074] The comparison of base similarity results showed that the base sequence similarity between B-4 and Myrmecridium fungi was more than 99%. Therefore, based on the comprehensive morphological and molecular biological characteristics, the B-4 strain was preliminarily identified as Myrmecridiumschulzeri.

[0075] Example 2: Detection of growth-promoting properties of active strains

[0076] (I) Detection of indoleacetic acid (IAA) synthesis ability of active strain B-4 fermentation broth

[0077] Accurately weigh 1 mg of IAA and add 10 mL of distilled water to dissolve it to obtain a 100 μg / mL IAA reference solution. Gradient dilution of the IAA reference solution is 10, 20, 30, 40, 50, 60, and 70 μg / mL. Mix the IAA solutions of each gradient with the Salkowski colorimetric solution at a volume ratio of 1:1, place them at room temperature away from light for 30 minutes, and then measure the OD530 of the IAA solutions of each concentration. Draw a standard curve with the concentration of IAA as the horizontal axis and the OD530 of the IAA solutions of each concentration as the vertical axis.

[0078] The activated B-4 strain was inoculated into PDA liquid medium for liquid fermentation for 10 days, the fermentation liquid of the strain was filtered, the mycelium was collected, 1g of fresh mycelium was added to 2mL of fermentation liquid for grinding, and centrifuged at 12000r / min for 10min. 100μL of the supernatant after grinding of each strain was placed on a white ceramic plate, and an equal amount of Salkowski colorimetric solution was added. After standing in the dark for 12h, the color change was observed. The sterile culture medium was used as a blank control, and 100μL of IAA standard solution (50μg / mL) plus an equal amount of Salkowski colorimetric solution was used as a positive control for color comparison. The same color as the standard solution is positive, indicating that the strain can secrete IAA (the darker the color, the more IAA is secreted), otherwise it is negative. The strains with the ability to secrete IAA were preliminarily screened. The grinding liquid of the strain with color change was centrifuged at 12000r / min for 10min, 1mL of supernatant was taken and sterilized by filtering through a 0.22μm microporous filter membrane, 1mL of Salkowski colorimetric solution was added, and the mixture was placed in the dark at room temperature for 12h. A blank PDA medium was used as a control group, and the OD530 of the strain was determined. The measurement was repeated 3 times, and the IAA content of the strain was calculated with reference to the standard curve. The unit of IAA content was μg / mL.

[0079] like Figure 3 As shown, in the positive control, 100 μL Salkowski colorimetric solution was added to the 50 μg / mL IAA solution, and after being placed in the dark for 12 hours, the color of the mixed solution changed from colorless to pink. The fermentation broth of fungus B-4 was centrifuged, and the supernatant was mixed with the Salkowski colorimetric solution. After being placed in the dark for 12 hours, the mixed solution had an obvious pink color change.

[0080] The fermentation liquid of fungus B-4 was taken for IAA content determination, and the result showed that the IAA content was 25.23ug / mL. The growth-promoting effect of IAA is mainly to promote cell growth, especially cell elongation, which can promote rooting of cuttings. In the fungus seedling symbiosis test, fungus B-4 showed obvious growth-promoting properties. In this test, strain B-4 has the ability to synthesize IAA, which is consistent with the results of previous fungal growth promotion tests.

[0081] (II) Detection of iron-loving ability of active strain B-4

[0082] Prepare 1000mL of modified CAS agar / siderophore detection medium, weigh 166.24g of CAS agar, add 900mL of pure water to dissolve, adjust pH to 6.8±0.2, sterilize at 121℃ for 20min, cool to 50-60℃, slowly add 100mL of CAS detection solution along the bottle wall, mix evenly without generating bubbles, and pour the plate. Inoculate the activated strain into the modified CAS agar / siderophore detection medium, culture at 28℃ for 10-15 days, and observe whether an orange halo is formed around the strain. Cultivate the fermentation broth of the strain, centrifuge the fermentation broth at 12000r / min for 10min, take 2mL of the supernatant, pass it through a 0.22μm microporous filter for sterilization, add 2mL of CAS detection solution, mix well and let it stand for 1h, detect its absorbance at 680nm as Ax, take another 2mL of uninoculated PDB culture medium and 2mL of CAS detection solution and mix them thoroughly as a control group, and detect its absorbance at 680nm as Ay. Calculate the concentration of synthetic iron carriers of the strain, expressed as iron carrier activity units (SU), SU = ((Ay-Ax) / Ay) × 100%. The larger the SU value, the stronger the ability to synthesize iron carriers. Ax / Ay represents the relative content of iron carriers in the culture fluid. The smaller the value, the higher the iron carrier content. Generally, the Ax / Ay of bacteria with high iron carrier production ability is less than 0.5.

[0083] CAS (Chrome azurol S) test solution is a complex composed of chrome azurol sulphonate (CAS), hexadecy-ltrimethyl-ammonium bromide (HDTMA) and iron ions, and is bright blue. When the iron ions in the blue test plate are taken away by the siderophore secreted by microorganisms, an orange halo will be formed around the colony where the microorganism grows. Therefore, CAS agar medium plates can be used for the detection of siderophore production by microorganisms.

[0084] In nature, iron exists mostly in the form of ferrous oxide and ferric hydroxide complexes, which are insoluble and difficult for organisms to utilize. Iron carriers are a class of small molecule metal ion chelates produced by microorganisms. + Has strong affinity.

[0085] After the B-4 strain was inoculated on the modified CAS agar / siderophore detection medium, an orange halo appeared around the strain on the 10th day, indicating that B-4 has a certain ability to synthesize siderophores. The fermentation liquid of fungus B-4 mixed with CAS color solution showed a dark green reaction, and the color of the sterile culture medium mixed with CAS showed a light blue reaction (such as Figure 4 This indicates that fungus B-4 has the ability to synthesize siderophores.

[0086] Table 5 Quantitative detection of siderophore production by strains

[0087]

[0088] As shown in Table 5, the SU of strain B-4 was 0.857, indicating that the strain was a siderophore-producing strain.

[0089] Example 3 Potted plant inoculation experiment

[0090] Experimental method: B-4 was inoculated in PDB medium, and vibrated at 28°C and 180rpm / min in a constant temperature shaking incubator for 7 days. The fermentation liquid was filtered with sterile gauze for later use. Each group was set up with 18 parallel pots, including 9 pots in the CK group and 9 pots in the strain treatment. The soil matrix was added to 2 / 3 of the pot in each pot. Take the sterile seedlings of Bletilla striata (only the tuber part is retained) with the same source and growth, disinfect them with 75% alcohol and 0.1% HgCl solution, and plant 3 Bletilla striata seedlings in each pot according to the soil covering 3cm soil depth. Finally, 2mL of B-4 strain fermentation liquid was added around each Bletilla striata (once a week), and the CK control group was treated with PDB medium without inoculation of strains under the same conditions. Cover the pots with plastic wrap to prevent contamination by miscellaneous bacteria in the air, and mark each pot. Cultivate in a light culture room, the ambient temperature should be controlled at 23-25°C, and the humidity should be controlled at 40%-50%. Light is provided for 12 hours every day. Irrigate weekly with sterile water according to specific growing needs. Implement manual pest and disease control measures. Figure 6

[0091] Experimental results: Figure 7 , Figure 8 As shown, after 90 days of planting, the growth indicators of Bletilla striata after inoculation of B-4 strain fermentation liquid in the soil were significantly higher than those of the control group in terms of plant height, leaf length, root length, tuber length, number of new roots and fresh weight of the whole plant. The results showed that rhizosphere fungus B-4 can promote the growth and development of Bletilla striata.

[0092] In summary, Bletilla striata rhizosphere fungus B-4 has a strong ability to produce IAA and synthesize iron carriers. Moreover, it played a significant role in the seedling growth promotion experiment. Therefore, in the ecological cultivation of Bletilla striata, Bletilla striata rhizosphere fungus B-4 has obvious potential.

[0093] The embodiments described in the present invention are merely descriptions of the preferred implementation modes of the present invention, and are not intended to limit the concept and scope of the present invention. Without departing from the design concept of the present invention, various modifications and improvements made to the technical solutions of the present invention by those skilled in the art should all fall within the protection scope of the present invention.

[0094] Sequence Listing

[0095] GGGGATCGAGATGTCCCACTCCCAACCCATTGTTTACCTACCCGTCCACCGTGCTTCGGCAGGCAGTCCTGTGGGACAGGGCCTCGCCCCCGCGAGGGGGTGCCTGCCGCTGGCCAACCAAAAATTCTAGCTGTTTTTGTACCATCTGAGTCTTCCACAAATAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCACTAGTATTCTGGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGTTGGGGCTCTGCGTCTGCAGTCCCTTAAATCCAGTGGCGGACACGCTAGGTCTCCGAGCGCAGTAGTTTCTCCTCGCTCAGGGCGTCCGGCGTGGGCTTGCCTCGCACCCATCTTTTACAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAG

Claims

1. A strain of Myrmecridium schulzeri B-4, characterized in that: The bletilla striata rhizosphere fungus B-4 (Myrmecridium schulzeri) B-4 is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231686.

2. The use of the Bletilla striata rhizosphere fungus B-4 (Myrmecridium schulzeri) B-4 as claimed in claim 1, characterized in that: Application of Bletilla striata rhizosphere fungus B-4 (Myrmecridium schulzeri) B-4 in preparing a product for promoting the growth of Bletilla striata.

Images