Application of microglial AKAP8L in the diagnosis and treatment of diabetes-related cognitive impairment

Abstract

The present invention belongs to the field of biomedicine technology and relates to the application of microglial AKAP8L in the diagnosis and treatment of diabetes-related cognitive impairment. The present invention found through proteomic analysis that in HG-treated microglia, AKAP8L was significantly upregulated, accompanied by the disorder of autophagy and inflammatory markers. The accumulation of AKAP8L is unique to HG-treated microglia, and no relevant changes were observed in co-cultured astrocytes or neurons. The present invention's research shows that knocking out AKAP8L and rapamycin can effectively inhibit mTORC1 signaling, normalize autophagic flux, reduce neuroinflammation, and reduce cell pyroptosis. Therefore, it is shown that AKAP8L in microglia can be used as a biomarker and therapeutic target for DACI.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and relates to the application of microglial cell AKAP8L in the diagnosis and treatment of diabetes-related cognitive impairment. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Diabetes and its related complications have become important factors affecting human health, among which diabetes-associated cognitive impairment (DACI) has become a prominent problem. Clinical studies have shown that the risk of dementia in diabetic patients is 1.73 times higher than that of ordinary people, and the risk of cognitive impairment is 2.27 times higher. In addition, DACI leads to difficulties in self-management in diabetic patients, aggravates the progression of the disease, and thus increases the burden of diabetes care. The pathophysiology of DACI is complex, including factors such as insulin resistance, inflammation, lipid abnormalities, oxidative stress, mitochondrial dysfunction, and autophagy, but the specific mechanism of DACI still needs further study to provide a biomarker for the diagnosis of DACI, as well as a therapeutic target for DACI. Summary of the invention

[0004] The present invention finds through proteomic analysis that in microglia treated with high glucose (HG), AKAP8L (A-kinase anchor protein 8-like) is significantly upregulated, accompanied by the disorder of autophagy and inflammatory markers, thereby indicating that AKAP8L in microglia can be used as a new biomarker of DACI. Moreover, the accumulation of AKAP8L is unique to HG-treated microglia, and no relevant changes are observed in co-cultured astrocytes or neurons. Further studies by immunoprecipitation and proximity connection assays show that HG treatment can enhance the interaction between AKAP8L and mTORC1 complex in microglia. In a diabetic mouse model induced by streptozotocin (STZ), the present invention finds that both knocking out AKAP8L and rapamycin treatment can improve the performance of the Morris water maze and reduce the activation of microglia, significantly improving cognitive function. In addition, the study showed that knocking out AKAP8L effectively inhibited mTORC1 (Mechanistic target of rapamycin complex 1) signaling, normalized autophagic flux, alleviated neuroinflammation, and reduced pyroptosis, thus indicating that AKAP8L in microglia can be used as a therapeutic target for DACI.

[0005] Based on the above research results, the purpose of the present invention is to provide the application of microglial AKAP8L in the diagnosis and treatment of diabetes-related cognitive impairment.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, a substance for detecting the level of AKAP8L encoding gene and its expression product in microglia is used in the preparation of a product for diagnosing, detecting, predicting or monitoring diabetes-related cognitive impairment.

[0008] The present invention performs proteomic analysis on various HG-treated cells and shows that only AKAP8L in microglia is significantly upregulated, and there is an increase in proteins related to autophagy and inflammation. Therefore, the present invention uses AKAP8L in microglia as a biomarker for diagnosing, detecting, predicting or monitoring diabetes-related cognitive impairment.

[0009] In some embodiments, the AKAP8L encoding gene and its expression product are of human origin.

[0010] The product of the present invention can diagnose, detect, predict or monitor diabetes-related cognitive impairment by detecting the level of AKAP8L encoding gene and / or AKAP8L encoding gene expression product in microglia. The product can be a substance that detects the transcription of AKAP8L encoding gene in a sample based on a high-throughput sequencing method and / or a quantitative PCR method and / or a probe hybridization method; or detects the expression of AKAP8L encoding gene in a sample based on an immunodetection method. In some embodiments, the product includes a substance that detects AKAP8L by liquid chromatography-tandem mass spectrometry.

[0011] In some embodiments, the product is administered to patients with diabetes-related cognitive impairment, who may be patients with diabetes-related cognitive impairment who are undergoing treatment or who are not undergoing treatment.

[0012] In a second aspect, a substance that inhibits the reduction of AKAP8L encoding gene and its expression product and / or activity is used in the preparation of a drug for treating diabetes-related cognitive impairment.

[0013] The substance for inhibiting the AKAP8L coding gene and its expression product and / or activity reduction of the present invention can be an RNA interference molecule or antisense oligonucleotide, a small molecule inhibitor, siRNA for AKAP8L, a substance for implementing lentiviral infection or gene knockout, and a specific antibody for AKAP8L itself or its upstream and downstream molecules, such as an anti-AKAP8L antibody, etc. In some embodiments, the substance for inhibiting the AKAP8L coding gene and its expression product and / or activity reduction is shRNA or siRNA. Specifically, the shRNA is shown in SEQ ID NO.1. Specifically, the siRNA is shown in SEQ ID NO.2.

[0014] In some embodiments, the shRNA is cloned into a pAAV vector.

[0015] In some embodiments, the substance that inhibits the gene encoding AKAP8L and its expression product and / or activity reduction acts to inhibit mTORC1 signaling, normalize autophagy, and reduce neuroinflammation.

[0016] In some embodiments, the drug comprises an active ingredient and a pharmaceutical excipient, wherein the active ingredient is the substance that inhibits the AKAP8L encoding gene and its expression product and / or activity reduction. The pharmaceutical excipients of the present invention are water, buffer solution, serum protein, polyethylene glycol, gum arabic, sorbitol, starch, lactose, magnesium stearate, colloidal silicon oxide, etc.

[0017] In some embodiments, the drug is administered by intracranial injection, intravenous injection, etc.

[0018] In some embodiments, the drug is administered to a human or non-human mammal, such as a mouse, rat, rabbit, monkey, etc.

[0019] The beneficial effects of the present invention are:

[0020] The present invention found through proteomic analysis that AKAP8L was significantly upregulated in microglia exposed to HG conditions, which was associated with changes in the expression patterns of autophagy and inflammation-related proteins. Importantly, the accumulation of AKAP8L was limited to HG-treated microglia, and no changes were detected in co-cultured astrocytes or neurons. Further studies of the present invention showed that microglia enhanced the interaction between AKAP8L and mTORC1 in an HG environment. In addition, the present invention showed that interventions targeting mTORC1 by knocking down AKAP8L and rapamycin can alleviate cognitive deficits in STZ-induced diabetic mice by normalizing autophagy and reducing neuroinflammation. These findings suggest that AKAP8L can be used as a DACI therapeutic target. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0022] Figure 1 The figures are the results of proteomic analysis in the embodiments of the present invention; wherein, (a) schematic overview of the workflow of high glucose-induced microglial proteomic analysis; (b) volcano plot depicting differentially expressed proteins; (c) KEGG pathway enrichment analysis of differentially expressed proteins; (d) representative immunofluorescence image of IL-1β with statistical quantification, scale bar: 20 μm, relative mRNA expression of TNF-α (e) and IL-1β (f); (g) representative protein blot and statistical analysis of P62 protein levels; representative confocal microscopy images (h) and statistical graphs (i) of mRFP-GFP-LC3 dots, scale bar: 5 μm; (j) representative immunofluorescence co-localization images and statistical graphs of p62 and AKAP8L, scale bar: 10 μm; data are mean ± standard deviation; P values ​​are from unpaired t-test *p < 0.05 and **p < 0.01 compared with the control group.

[0023] Figure 2 The figures are the accumulation results of AKAP8L in various cells in the embodiments of the present invention; wherein, (a) representative protein blot and statistical analysis of AKAP8L protein level; (b) representative immunofluorescence image of AKAP8L with quantification, scale bar: 20 μm; co-localization of AKAP8L with microglia marker Iba-1, astrocyte marker GFAP and neuron marker βIII tubulin in primary neural co-culture (c), and corresponding statistical analysis (d), scale bar: 10 μm; (ef) co-localization of Iba-1 and AKAP8L in mouse hippocampus, and quantification, scale bar: 10 μm; (gh) quantitative determination of co-localization of GFAP and βIII tubulin with AKAP8L in mouse hippocampus, scale bar: 10 μm; data are mean ± standard deviation; P values ​​are from unpaired t-test *p < 0.05 and **p < 0.01 compared with the control group.

[0024] Figure 3Figure 1 shows the results of HG enhancing the interaction between AKAP8L and mTORC1 in primary microglia and BV2 cells and the effect of knocking down AKAP8L on the mTORC1-mediated autophagy pathway; among them, co-immunoprecipitation of FLAG-tagged AKAP8L and HA-tagged Raptor (a), and vice versa (b), and the interaction between endogenous AKAP8L and Raptor (c). Proximity ligation analysis showed that AKAP8L-Raptor interaction was increased in BV2 cells (d) and primary microglia (e), scale bar: 20μm; (f) Representative blots of autophagy-related proteins; p-mTOR / mTOR (g), p-p70S6K / p70S6K (h), p-ULK1 / ULK1 (i), Beclin-1 (j), p62 (k), and LC3 II / LC3 i (l) Statistical graph of protein expression; (m) Immunofluorescence staining of microglia transfected with mRFP-GFP-LC3 adenovirus, showing punctate LC3 distribution, scale bar: 10 μm; (n) Electron microscopy images of microglia showing HG-induced autophagy changes, scale bar: 500 nm; (o) Number of LC3 dots per cell; (p) Quantification of the number of autophagosomes (GFP+RFP+yellow dots) and autolysosomes (red dots) in microglia; Data are mean ± SD; P values ​​were compared between two groups using unpaired Student's t test, and one-way ANOVA was performed with Tukey's post hoc test for multiple comparisons **p < 0.01 compared with the control group # p<0.05 and ## p<0.01.

[0025] Figure 4 The results of knocking down AKAP8L on inflammasomes and cell pyroptosis in the embodiments of the present invention are shown in the figure; wherein, (a) representative blots and statistical analysis of the response of NLRP3, ASC, Caspase-1p20, TXNIP, GSDMD-N and IL-1β to HG treatment; representative immunofluorescence images (b) and quantification of NLRP3 (c) and GSDMD (d), scale bar: 20 μm; (e) ELISA quantification of IL-18 levels; representative images (g) and statistical graphs (f) of microglia stained with YO-PRO-1 for analysis of pyroptotic cells, scale bar: 50 μm; (h) transmission electron microscopy images of pyroptotic cells, main image is 2 μm, inset is 1 μm; data are mean ± standard deviation; P value is from one-way ANOVA with Tukey's post hoc multiple comparisons **p < 0.01 compared with the control group ## Compared with the STZ group, p<0.01.

[0026] Figure 5The results of the effects of knocking down AKAP8L on the state of autophagy in the hippocampus of STZ mice in the embodiments of the present invention are shown in Figure 1, wherein (a) representative blots of p-mTOR, mTOR, p-p70S6K, p70S6K, p-ULK1, ULK1, Beclin-1, p62, LC3-II, LC3-I and β-actin; representative immunofluorescence images (b) and statistical graphs (c) of co-localization of Iba-1 and LC3, scale bar: 20 μm; representative immunofluorescence images (d) and statistical graphs (e) of co-localization of Iba-1 and p62, scale bar: 20 μm; (f) statistical graphs of protein expression at the phosphorylation levels of mTOR, p70S6K and ULK1; (g) statistical graphs of protein expression of LC3-II / LC3-I, p62 and Beclin-1; data are mean ± standard deviation; P values ​​are from one-way ANOVA with Tukey's post hoc multiple comparisons **p < 0.01 compared with the control group # p<0.05 and ## p<0.01.

[0027] Figure 6 The results of the effects of sh-AKAP8L on NLRP3 inflammasome and cell pyroptosis in the hippocampus of STZ mice in the embodiments of the present invention are shown in Figure 1; wherein, representative blots (a) and statistical graphs (b) of NLRP3, ASC, Caspase-1, TXNIP, GSDMD-N and IL-1β; (c) gene expression of TNF-α, IL-1β, IL-6, CD86, iNOS, IL-4, Arg-1 and TGF-β were detected using the Z-score transformation method; (d) representative immunofluorescence images of GSDMD, Iba-1 and DAPI, scale bar: 20 μm; (e) representative example binary images of microglia in mouse hippocampus; (f) statistical graphs of Sholl analysis results showing the number of intersections per radius around the microglial cell body; (g) quantification of microglial process endpoints for each cell; data are mean ± standard deviation; P value is from one-way ANOVA with Tukey post hoc multiple comparisons **p < 0.01 compared with the control group ## Compared with the STZ group, p<0.01.

[0028] Figure 7: The effects of sh-AKAP8L on neuronal damage and cognitive function of STZ-induced diabetic mice in the embodiments of the present invention; wherein, (a) swimming track images of CON, STZ, STZ+sh-AKAP8L and STZ+RAPA groups in the MWM test; (b) escape latency during training; (c) average speed of each group; (d) statistical graph of time spent in the target quadrant; (e) number of crossing platforms at the original platform position; (f) statistical graph of NeuN immunofluorescence staining images and live neuron ratios, scale bar: 20 μm; (g) statistical graph of H&E staining images and intact cell rates, scale bar: s 20 μm; (h) statistical graph of Nissl staining images and intact neuron ratios, scale bar: 20 μm; data are mean ± standard deviation; P values ​​are from one-way or two-way ANOVA with Tukey's post hoc multiple comparisons **p<0.01 compared with the control group ## Compared with the STZ group, p<0.01.

[0029] Figure 8 Mechanism diagram of AKAP8L in the potential pathogenesis of DACI in the embodiments of the present invention. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0031] Example

[0032] Materials and methods:

[0033] 1. Proteomic analysis

[0034] Primary microglia were cultured from the brains of 1-day-old mice. The brains were harvested, the meninges were removed, and the cells were cultured in a Ca-free medium. 2+ and Mg 2+ Brain slices were cut into small pieces in HBSS (Hank's Balanced Salt Solution). The tissue blocks were then incubated in 0.125% trypsin solution at 37°C for 15 minutes and subjected to gentle mechanical disruption to promote enzymatic digestion. The cells were cultured at 37°C and 5% CO2 for 10-14 days in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% fetal bovine serum, 2mM L-glutamine, 100U / mL penicillin and 0.1mg / mL streptomycin. Subsequently, the mixed cells in the culture medium were shaken at 200rpm for 4 hours at 37°C to suspend the loosely attached microglia. The culture medium was centrifuged and the microglia formed pellets.

[0035] Subsequently, microglia exposed to high glucose (HG, 33 mM) for 48 hours and untreated control cells were subjected to a thorough proteomic analysis. Proteins were extracted and subjected to meticulous quality assessment. Subsequently, the extracted proteins were enzymatically digested and labeled with TMT reagent (ThermoFisher) with the addition of acetonitrile and hydroxylamine. The labeled proteins were then analyzed using liquid chromatography-tandem mass spectrometry (LC-MS / MS). The resulting mass spectrometry data were cross-referenced with major protein databases (including Uniprot, NR, GO, KEGG, and String) to obtain subcellular localization and annotation information for each identified protein. To determine the differentially expressed proteins between the groups, strict criteria based on fold change (FC) and statistical significance were established. Proteins with FC≥1.5 or FC≤0.66 and p<0.05 were selected as differential proteins. This systematic approach ensures robust and reliable identification of proteins that may play an important role in underlying biological processes.

[0036] 2. Animals and drug treatment

[0037] Eight-week-old male C57BL / 6 mice were purchased from Pengyue Experimental Animal Breeding Co., Ltd. The animals were acclimatized to standard laboratory conditions (22±1°C, 55±5% humidity, 12-h light-dark cycle) and had free access to food and water.

[0038] This part of the animal study was divided into two parts. In the first part, mice were randomly divided into a control group and a streptozotocin (STZ) group (n=6 / group) to study whether AKAP8L is upregulated in hippocampal microglia. In the second part, mice were randomly divided into the following four groups: control group, STZ group, STZ+sh-KAP8L group, and STZ+RAPA group (n=12 / group) to study whether inhibition of AKAP8L or mTORC1 by sh-AKAP8L or rapamycin (RAPA) can improve DACI.

[0039] In the STZ-induced diabetes model, C57BL / 6J mice were injected intraperitoneally with STZ at a dose of 50 mg / kg once a day for five consecutive days. STZ was dissolved in 0.01 M sodium citrate buffer at pH 4.4. The control group received an equal amount of citrate buffer. Body weight and fasting blood glucose levels were assessed from tail vein blood samples using an Ultra blood glucose meter. Mice with blood glucose levels higher than 11.1 mmol / L were designated as the diabetic model group for subsequent experiments.

[0040] In preliminary experiments, it was observed that adeno-associated virus (AAV)-induced knockdown of AKAP8L had no effect on the body weight and blood glucose levels of mice. In the STZ+sh-AKAP8L group, the selected shRNA sequence (CCAGAACATCATACCCGAGTA, as shown in SEQ ID NO.1) was cloned into the pAAV vector under the control of the U6 promoter. For stereotactic injection, mice were anesthetized with isoflurane and fixed on a stereotactic apparatus. Subsequently, 1 μL of AAV9-U6-sh-NC (for the control group, STZ group, and STZ+RAPA group) and AAV9-U6-sh-AKAP8L (for the STZ+sh-KAP8L group) were slowly injected into each side of the hippocampus of anesthetized mice. The injection was performed using a 10 μL Hamilton syringe equipped with a 30-gauge bevel needle at a flow rate of 0.25 μL / min. After the injection was completed, the needle was kept in place for 5 minutes and then gently withdrawn to prevent viral reflux. Rapamycin (MCE, HY-10219) was administered by intraperitoneal injection at a dose of 2 mg / kg every other day for two weeks.

[0041] 3. Morris water maze test

[0042] The learning and memory abilities of mice were assessed using the Morris water maze test (MWM). The MWM consists of a circular water tank divided into four imaginary quadrants of equal size, with a hidden platform in the center of one of the quadrants submerged 1 cm below the water surface. Navigation trials were conducted over the first 5 days. In each trial, mice were placed in the water tank facing the wall from one of four different starting points and given 60 seconds to locate the hidden platform. The time taken to reach the platform was recorded as the escape latency. If the mouse failed to find the platform within the specified time, it was gently guided to the platform and allowed to remain there for 10 seconds; in this case, the escape latency was recorded as 60 seconds. After 24 hours, the escape platform was removed and the mice were placed in the water maze from the opposite quadrant for a spatial probe test. In this test, the time the mice stayed in the quadrant of the previous platform and their swimming speed were carefully recorded. These behavioral tests provide a comprehensive assessment of the cognitive abilities of mice, especially those related to learning and memory functions.

[0043] 4. Cell culture and treatment

[0044] Primary microglia were isolated from the brains of 1-day-old mice according to the method described in "Proteomic Analysis". At the same time, BV2 mouse microglia (purchased from Wuhan Punosai Life Science Technology Co., Ltd.) were cultured under the following conditions: at a temperature of 37°C, DMEM / F-12 medium enriched with 10% fetal bovine serum (FBS) was used in a completely humidified atmosphere containing 5% CO2. Brains were collected from one-day-old mouse pups and enzymatically digested with 20U / mL papain for 1 hour at 37°C and 5% CO2. After enzymatic treatment, papain was removed and the tissue was gently rinsed in DMEM. The tissue was then mechanically dissociated using a finely polished glass serological pipette until all visible aggregates were dispersed. The isolated cells were inoculated into a porous chamber coated with poly-L-lysine and incubated in DMEM supplemented with 10% fetal bovine serum (FBS), 1% glutamine, and 1% penicillin-streptomycin. The cultures were maintained at 37°C in a humidified atmosphere containing 5% CO2 and the medium was refreshed every three days by replacing half of the medium with fresh medium.

[0045] Experimental design The cells were divided into a control group and a HG group. The control group maintained a concentration of 5.5 mM under normal glucose conditions. In contrast, the HG group was challenged in a high glucose environment of 33 mM for 48 hours. Further classification of BV2 cells produced four different experimental groups: control group, HG group, HG+si-AKAP8L group, and HG+RAPA group. The HG+si-AKAP8L group was pretreated with AKAP8L small interfering RNA (siRNA: AAGCGACAGAGCTCACAGAGG, as shown in SEQ ID NO.2) for 24 hours and then exposed to high glucose (33 mM) for an additional 48 hours. siRNA specific for AKAP8L was transfected into BV2 cells. The cells were plated one day before transfection to achieve a confluency of approximately 70% on the day of transfection. The transfection procedure was performed using Lipofectamine3000 (Invitrogen) according to the manufacturer's instructions. The HG+RPA group was initially treated with 100 nM rapamycin for 24 h and then exposed to high glucose (33 mM) for 48 h.

[0046] 5. Immunofluorescence assay

[0047] Immunofluorescence staining was performed on frozen hippocampal sections or paraffin-embedded cells. The samples were washed three times with PBS and then incubated with primary antibodies overnight in a humidified atmosphere at 4°C. The following primary antibodies were used: anti-IL-1β (1:100, Abcam), anti-p62 (1:100, Abcam), anti-AKAP8L (1:100, Santa Cruz), anti-βIII Tubulin (1:500, Servicebio), anti-GFAP (1:500, Servicebio). After primary antibody incubation, the sections were coupled with Alexa-488 (green, Invitrogen), Alexa-594 (red, Invitogen), and Alexa-647 (red, Invitrogen). The sections were mounted with 50% glycerol and examined under a fluorescence microscope.

[0048] 6. Co-immunoprecipitation (Co-IP) analysis and western blotting

[0049] Co-immunoprecipitation (Co-IP) assays were performed using a Co-IP kit (Absin Biosciences, China) according to the manufacturer's instructions. BV2 cells were transfected with FLAG-tagged AKAP8L and HA-tagged Raptor plasmids. All steps were performed on ice or at 4 °C. The cells were cold washed once with 1x PBS and then lysed with 0.3% CHAPS. Cell fragments were pelleted by centrifugation at 15000 rpm for 10 minutes. 75 μL of the lysate was taken as a whole cell lysate, and the remaining lysate was used for immunoprecipitation. Proteins were eluted from the beads and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

[0050] For Western blotting, hippocampal tissue or cultured cells were homogenized and total protein was extracted using RIPA lysis buffer. Protein concentration was determined using a BCA assay kit. 50 μg of protein per sample was separated by electrophoresis on a 12% SDS-PAGE gel. Proteins were transferred to polyvinylidene fluoride (PVDF) membranes and blocked in 10% skim milk for 1 hour at room temperature. Subsequently, the membrane was incubated with the following primary antibodies at 4°C overnight: anti-LC3 (1:500, Proteintech), anti-p62 (1:500, Proteintech) NLRP3 antibody (1:1000, CST), anti-ASC antibody (1:1000, CST), anti-caspase-1 antibody (1:1000, CST), anti-TXNIP antibody (1:1000, Proteintech), anti-GSDMD N-terminal antibody (1:1000, Abcam), anti-GSDMD antibody (1:1000, Abcam), anti-IL-1β antibody (1:1000, Abcam) and β-actin 1:2000, Proteintech. The blot was then washed three times with Tris-buffered saline-Tween-20 (TBST) and incubated with secondary antibodies. Finally, the signal was detected using an ECL kit (Thermo Fisher). The band intensities were analyzed using Image J software and normalized to β-actin.

[0051] 7. Enzyme-linked immunosorbent assay

[0052] IL-18 levels in the culture medium were determined using an ELISA kit according to the manufacturer's protocol (R&D Systems, catalog number DY7625-05). Plates were read at a wavelength of 450 nm using a TECAN reader (TECAN, Durham, NC, USA).

[0053] 8. Real-time quantitative PCR (RT-qPCR)

[0054] To evaluate the mRNA expression levels of IL-1β, tumor necrosis factor (TNF)-α, CD86, IL-6, iNOS, IL-4, Arg1, and TGF-β, total RNA was extracted from the samples using Trizol reagent (Invitrogen). Subsequently, complementary DNA (cDNA) was synthesized using a cDNA library construction kit (Tiangen). The sequences of the primers used are detailed in Table 1. SYBR PCR Master Mix (Tiangen) was used in Bio-Rad CFX96TMRT-qPCR was performed on the detection system. Thermal conditions were as follows: temperature 95°C for 15 minutes, and finally amplification at 95°C for 10 seconds and 60°C for 30 seconds for 40 cycles. β-actin was used as an internal standard to normalize relative expression levels. Data for IL-1β, IL-6, CD86, TNF-α, iNOS, IL4, Arg1, and TGF-β are expressed as the average Z score of three independent experiments, calculated based on Ct values ​​and the standard curve method.

[0055] Table 1 Primer sequences

[0056]

[0057]

[0058] 9. Measurement of Autophagic Flux

[0059] BV2 cells and primary microglia were cultured at 1×10 5 Cells were seeded at a density of 10 cells / well and cultured overnight, after which cells were transfected with mRFP-GFP-LC (Hanbio, China) for 24 hours according to the manufacturer's protocol. Cells were fixed with 4% paraformaldehyde and digital images of LC3-positive puncta were taken using a TCS SP8 confocal laser scanning microscope. The number of LC3-positive puncta per cell in each experimental group was quantified using ImageJ software.

[0060] 10. Dyeing

[0061] After anesthesia, mice were perfused transcardially with 0.9% saline and 4% paraformaldehyde for brain fixation. The brain was then paraffin-embedded and sliced ​​with a thickness of 4 μm for hematoxylin-eosin (HE) and Nissl staining. The slices were stained with hematoxylin to mark the nuclei and eosin to mark the cytoplasm. HE-positive cells in the hippocampus were counted in five random fields of each slice using an optical microscope in a blinded manner. For Nissl staining, the manufacturer's instructions were strictly followed (Nissl staining kit #G1430, Solarbio, China). Without knowing the treatment group, the total number of Nissl-positive neurons in the penumbra was calculated in five different fields of view of each slice using an optical microscope.

[0062] 11. Proximity connection test

[0063] Proximity ligation assay (PLA) was performed using Sigma's Duolink PLA kit. Cells were centrifuged onto slides, fixed with 4% paraformaldehyde (PFA), and permeabilized with 0.2% Triton X-100 for 5 minutes. After blocking with Duolink blocking buffer for 30 minutes, cells were incubated with primary antibodies to Raptor and AKAP8L overnight at 4°C. PLA probes were mixed with Duolink antibody diluent and applied to slides, followed by ligation and amplification steps to detect protein complexes. Slides were rinsed, mounted with Duolink in situ mounting medium containing DAPI to stain cell nuclei, and observed under an Olympus fluorescence microscope. This approach enables specific detection of protein interactions in a cellular context.

[0064] 12. Transmission Electron Microscope

[0065] After treatment, cells were fixed with 2.5% glutaraldehyde solution, washed three times with PBS at room temperature for 5 minutes each time, treated with 1% osmium acid for 1 hour, washed again with PBS, and dehydrated by graded series of propanol. Finally, after saturation with 2% uranyl acetate solution, cells were embedded in epoxy resin. Transmission electron microscopy (Hitachi, HT7700, Japan) was used to observe autophagy and cell pyroptosis in different treatment groups.

[0066] 13. Dye uptake

[0067] Cells were incubated with YO-PRO-1 iodide at a concentration of 0.2 mM for 15 min. Subsequently, cells were counterstained with Hoechst 33342 and images were acquired using an inverted microscope (Olympus, Tokyo, Japan). This technique facilitates the assessment of cell integrity and viability through visualization of dye penetration.

[0068] 14. Sholl analysis

[0069] Confocal images of IBA-1 stained brain sections were acquired using confocal microscopy and imported into FIJI software. Images were thresholded to binary, including the complete processes of microglia. The surrounding processes of other cells were erased using the eraser tool to isolate individual microglia. The longest processes were drawn using the line segment tool. Using the Sholl analysis function, the first shell was defined at 10 μm from the center of the cell body (to exclude the cell body from the analysis), and each subsequent shell was 5 μm. Given the linear profile, the software automatically counted the number of intersections with each concentric shell.

[0070] 15. Statistical analysis

[0071] Statistical analysis was performed using SPSS (IBM Corp., Armonk, NY, USA, version 29.0), and the results are presented as mean ± standard deviation. Unpaired Student t test and one-way and two-way analysis of variance (ANOVA) were used for statistical analysis. To compare the groups after ANOVA, a post hoc Tukey test was performed. P values ​​less than 0.05 were considered statistically significant.

[0072] Results and Analysis

[0073] 1. Proteomic analysis of microglia exposed to HG

[0074] To explore the changes in protein expression and potential mechanisms in DACI, proteomic analysis of microglia exposed to HG was performed. This analysis identified 126 proteins that were upregulated and 93 proteins that were downregulated in microglia after HG treatment. The raw data of these differentially expressed proteins are shown in Supplementary Table 1. Notably, AKAP8L was one of the most significantly upregulated proteins, while proteins related to autophagy and inflammation were increased ( Figure 1 A and 1B). In addition, KEGG pathway enrichment analysis highlighted that these proteins are involved in pathways such as cytokine-cytokine receptor interaction, autophagy, NOD-like signaling cascade, mitophagy, and apoptosis ( Figure 1 C). Autophagy and inflammatory pathways were further validated using immunofluorescence staining, western blotting, and rt-qPCR. As expected, the mRNA levels of IL-1β and TNF-α, as well as the relative fluorescence intensity of specific IL-1β, were significantly increased in microglia exposed to HG conditions ( Figure 1 D, 1E, and 1F). The protein level of p62 was also assessed by Western blotting, revealing a significant upregulation in HG-induced microglia ( Figure 1 G). Monitoring of autophagic flux using LC3 tandem fluorescent tag (mRFP-GFP-LC3) showed a decrease in the number of LC3 dots per cell in HG-treated microglia ( Figure 1 H and 1I). These results suggest that HG exposure disrupts autophagy in microglia. Interestingly, our immunolocalization analysis showed that HG treatment enhanced the colocalization of p62 and AKAP8L in microglia, implying that AKAP8L may play a role in regulating autophagy ( Figure 1 J and 1K).

[0075] 2. Accumulation of AKAP8L in various cells

[0076] The upregulation of AKAP8L identified in the proteomic analysis was further validated using Western blotting and immunofluorescence. Figure 2A and 2B). To elucidate the expression profile of AKAP8L in co-culture and upon HG stimulation, we performed co-staining with specific markers: Iba-1 for microglia, GFAP for mature astrocytes, and Tubulin for neurons. Notably, AKAP8L was found to accumulate specifically in HG-treated microglia, whereas it was absent in co-cultured astrocytes and neurons ( Figure 2 C and 2D). Consistent with these findings, similar results were observed in the hippocampus of STZ-induced diabetic mice ( Figure 2 EH).

[0077] 3. HG enhances the interaction between AKAP8L and mTORC1 in primary microglia and BV2 cells

[0078] HA-tagged Raptor and FLAG-tagged AKAP8L were overexpressed in BV2 cells. Co-immunoprecipitation of HA-tagged Raptor confirmed its interaction with FLAG-tagged AKAP8L under normal glucose conditions ( Figure 3 A). In contrast, reverse immunoprecipitation of FLAG-tagged AKAP8L also co-immunoprecipitated with HA-tagged Raptor ( Figure 3 B). In addition, we observed an increase in the interaction between endogenous AKAP8L and Raptor upon HG stimulation ( Figure 3 C). Proximity ligation assay results further confirmed that HG stimulation enhanced the interaction between AKAP8L and mTORC1 in primary microglia and BV2 cells ( Figure 3 D and 3E).

[0079] 4. Effect of AKAP8L knockdown on mTORC1-mediated autophagy pathway

[0080] Compared with the control group, HG treatment significantly increased the expression ratios of p-mTOR / mTOR, p-p70S6K / p70S6K, and p-ULK1 / ULK1 in microglia ( Figure 3 FI). Meanwhile, Beclin-1 level and LC3-II / LC3-I ratio were significantly decreased, while p62 level was increased ( Figure 3 JL), indicating that autophagy was impaired under HG conditions. Moreover, in HG-induced microglia, si-AKAP8L and rapamycin treatment reversed the expression patterns of these proteins. Consistent with these findings, mRFP-GFP-LC3 immunostaining showed that si-AKAP8L and rapamycin significantly increased the formation of LC3 dots per cell compared with the HG group, and transmission electron microscopy also detected the restoration of the number of autophagosomes and autolysosomes ( Figure 3MP). Taken together, these results suggest that knockdown of AKAP8L and rapamycin can ameliorate autophagy impairment by inhibiting mTORC1 in HG-induced microglia.

[0081] 5. Effects of AKAP8L knockdown on inflammasome and pyroptosis

[0082] Compared with the control group, HG-induced microglia showed a significant upregulation of NLRP3, ASC, Caspase-1, TXNIP, GSDMD-N, and IL-1β protein levels, and si-AKAP8L and rapamycin treatment led to a decrease in the expression of these proteins ( Figure 4 A). Immunofluorescence and ELISA assays further confirmed that HG-induced microglia had elevated levels of NLRP3, GSDMD, and IL-18, which were significantly reversed by si-AKAP8L and rapamycin treatment ( Figure 4 BE). Furthermore, HG-induced microglia showed signs of increased cell membrane fragmentation and pyroptosis, as detected by Yo-Pro-1 staining and transmission electron microscopy; these abnormalities were significantly rescued by si-AKAP8L and rapamycin treatment ( Figure 4 G, H). These findings collectively indicate that knockdown of AKAP8L and rapamycin treatment alleviate HG-induced NLRP3 inflammasome activation and pyroptosis in microglia via the mTORC1 pathway.

[0083] 6. Effect of AKAP8L knockdown on the state of autophagy in the hippocampus of STZ mice

[0084] Immunofluorescence co-staining was performed with the microglial marker Iba-1 and the autophagy-related proteins LC3 and p62. The images obtained showed that the number of LC3 dots per Iba-1-positive cell was reduced and the number of p62 dots per Iba-1-positive cell was increased in the hippocampus of STZ-treated mice compared with the control group ( Figure 5 BE). These findings were further confirmed by Western blotting, which revealed increased phosphorylation levels of mTOR, p70S6K, and ULK1 in the hippocampus of STZ-treated mice ( Figure 5 F). In addition, as p62 levels increased, the ratio of LC3-II to LC3-I and Beclin-1 decreased significantly ( Figure 5 G). Taken together, these results suggest that activation of mTORC1 in microglia impairs autophagy in STZ-induced diabetic mice. Notably, knockdown of AKAP8L and rapamycin treatment effectively reversed these autophagy defects.

[0085] 7. Effects of sh-AKAP8L on NLRP3 inflammasome and pyroptosis in the hippocampus of STZ mice

[0086] The hippocampus of STZ mice showed significant upregulation of NLRP3, ASC, Caspase-1, TXNIP, GSDMD-N, and IL-1β ( Figure 6 A, B). However, treatment with sh-AKAP8L and rapamycin reduced the expression of these proteins in the hippocampus of STZ mice. Using Z-score transformation, we confirmed that the expression of pro-inflammatory markers, including TNF-α, IL-1β, IL-6, CD86, and iNOS, was elevated in the hippocampus of STZ mice compared with controls ( Figure 6 C). At the same time, the expression of anti-inflammatory markers such as IL-4, Arg-1, and TGF-β was reduced in the hippocampus of STZ mice. These results highlight the significant inflammatory response in the hippocampus of STZ mice, which was significantly reduced by sh-AKAP8L and rapamycin treatment. Immunofluorescence was used to observe the colocalization of GSDMD and the microglial marker Iba-1 to assess the pyroptosis status of microglia in STZ-induced mice. Visual data showed that STZ-induced microglial pyroptosis in mice was increased, which was partially alleviated by sh-AKAP8L and rapamycin treatment ( Figure 6 D). In addition, the branching morphology of microglia, indicative of microglial inflammation, was assessed using Sholl analysis ( Figure 6 EG). Microglia from the control group exhibited a highly branched resting-state morphology, whereas microglia from STZ mice were amoeboid and had reduced endpoints per cell. Notably, sh-AKAP8L and rapamycin treatment restored the branched morphology and increased endpoints per cell in microglia from STZ mice. Together, these findings suggest that sh-AKAP8L and rapamycin can attenuate neuroinflammation and pyroptosis in microglia from STZ mice.

[0087] 8. Effects of sh-AKAP8L on neuronal damage and cognitive function in STZ-induced diabetic mice

[0088] Morris water maze test was used to assess spatial learning and memory ( Figure 7 AE) to evaluate the effect of AKAP8L knockdown on cognitive function in STZ-induced diabetic mice. Compared with control mice, STZ mice showed significantly prolonged escape latency, decreased time in the target quadrant, and fewer platform crossings. However, compared with the STZ alone group, mice in the sh-AKAP8L+STZ and RAPA+STZ groups showed shorter escape latency, increased time in the target quadrant, and more platform crossings. These findings suggest that although cognitive and memory functions are impaired in STZ mice, sh-AKAP8L knockdown and rapamycin treatment can significantly improve these functions.

[0089] To assess the neuronal integrity of the hippocampus, a key area for cognition and memory, hippocampal tissue samples from STZ mice were stained with NeuN, HE, and Nissl ( Figure 7 FH). Microscopic analysis showed that the percentages of intact cells and surviving neurons were significantly decreased in the STZ group compared with the control group. Taken together, these results suggest that STZ induces hippocampal and neuronal damage, which can be alleviated by sh-AKAP8L knockdown and rapamycin treatment.

[0090] Proteomic analysis revealed that AKAP8L was significantly upregulated in HG-treated microglia, accompanied by aberrant expression of autophagic and inflammatory markers. Notably, the accumulation of AKAP8L was specific to HG-treated microglia, with no changes observed in co-cultured astrocytes or neurons, a pattern that was reflected in STZ-induced diabetic mice. Further studies by co-immunoprecipitation and PLA revealed that elevated AKAP8L in HG-treated microglia interacted with the mTORC1 complex. In the STZ mouse model, we demonstrated that both knockout of AKAP8L and rapamycin treatment significantly enhanced cognitive function, as evidenced by improved performance in the Morris water maze and reduced microglial activation. Furthermore, these interventions effectively inhibited mTORC1 signaling, normalized autophagic flux, alleviated neuroinflammation, and reduced pyroptosis. Potential involvement of AKAP8L in the pathogenesis of DACI such as Figure 8 shown.

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of a substance for detecting the level of AKAP8L encoding gene and its expression product in microglia in the preparation of a product for diagnosing, detecting, predicting or monitoring diabetes-related cognitive impairment.

2. The use according to claim 1, characterized in that: The AKAP8L encoding gene and its expression product are of human origin.

3. The use according to claim 1, characterized in that: The products include material for the detection of AKAP8L by liquid chromatography-tandem mass spectrometry.

4. The use according to claim 1, characterized in that: The product is administered to patients with diabetes-related cognitive impairment.

5. Use of a substance that inhibits AKAP8L encoding gene and its expression product in the preparation of a drug for treating diabetes-related cognitive impairment; the substance that inhibits AKAP8L encoding gene and its expression product is shRNA or siRNA.

6. The use according to claim 5, characterized in that: The shRNA is shown as SEQ ID NO.

1.

7. The use according to claim 5, characterized in that: The siRNA is shown as SEQ ID NO.

2.

8. The use according to claim 6, characterized in that: The shRNA was cloned into pAAV vector.

9. The use according to claim 5, characterized in that: The effects of substances that inhibit the AKAP8L encoding gene and its expression product are: inhibiting mTORC1 signaling, normalizing autophagy and reducing neuroinflammation.

10. The use according to claim 5, characterized in that: The drug comprises an active ingredient and a pharmaceutical excipient, wherein the active ingredient is the substance that inhibits the AKAP8L encoding gene and its expression product; and the substance that inhibits the AKAP8L encoding gene and its expression product is shRNA or siRNA.

11. The use according to claim 5, characterized in that: The drug is administered by intracranial injection or intravenous injection.

12. The use according to claim 5, characterized in that: The drug is administered to humans or non-human mammals.

Images