A molecular marker affecting the feather color of Muscovy duck and its application

Abstract

The present invention belongs to the technical field of molecular markers, and specifically relates to a molecular marker that affects the feather color of Muscovy ducks and its application. The molecular markers are SNP markers and InDel markers; the nucleotide sequence containing the SNP markers and InDel markers is shown in SEQ ID No.1; the SNP marker is located at the 273rd position from the 5' end of SEQ ID No.1, which is C or G; the InDel marker is located at the 3136th position to the 3141th position from the 5' end of SEQ ID No.1, which is a CAACTA fragment or deletion. The relevant indicators of Muscovy ducks can be detected by the SNP and InDel markers provided by the present invention, or the genetic improvement of Muscovy ducks can be carried out by using the SNP markers and InDel markers, and favorable superior genotypes can be selected for seed preservation, and the proportion of white feathers of Muscovy ducks can be rapidly increased, which can bring economic benefits to the industrial development of Muscovy ducks.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker affecting the feather color of a Muscovy duck and an application thereof. Background Art

[0002] Muscovy ducks, also known as knob-headed ducks and musk ducks, are introduced meat-producing breeds native to Central and South America. Muscovy ducks grow quickly, tolerate roughage, have delicious meat, produce good liver, and are suitable for dry farming. They are one of the waterfowl breeds suitable for meat and liver production. Muscovy ducks are large in size, with red or dark red tumors at the base of the beak and around the eye sockets. They are famous for their superior production performance and excellent hybrid advantages.

[0003] Single nucleotide polymorphism (SNP) is a DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. It is the most common type of heritable variation in humans. Insertion-deletion marker (InDel) refers to a gene sequence change in a chromosome that adds or subtracts a small fragment. It is a type of genomic mutation that may affect the structure and function of the entire gene. The genetic differentiation index (FST) is a measure of population differentiation and genetic distance. The larger the differentiation index, the greater the difference between groups. It is suitable for comparing diversity between subpopulations. FST is between 0 and 1. The closer it is to 1, the greater the degree of differentiation between the two groups and the higher the degree of selection, and vice versa.

[0004] After hundreds of years of artificial selection, the feathers of domesticated Muscovy ducks have diverse colors, including white, black, and black and white. There are also a small number of black mixed with silver-gray or blue-green. Generally speaking, the meat quality of black-feathered Muscovy ducks is better than that of white-feathered ducks, but the growth rate is very slow, so most breeders prefer to breed white-feathered Muscovy ducks. Bird feather color is also considered an important genetic marker. Understanding the inheritance mode of Muscovy duck feather color traits and even finding candidate genes that control feather color traits are of great significance for guiding the selection and genetic research of Muscovy duck feather color. Due to the lack of high-quality reference genomes, research related to Muscovy duck feather color has considerable limitations in identifying key genes. Therefore, by comparing the differences in the genome between black and white Muscovy ducks and further identifying molecular markers that affect the feather color of Muscovy ducks, people will deepen their understanding of the evolution of this trait in the phylogeny of Muscovy ducks and provide new insights into the genetic breeding of Muscovy ducks. Summary of the invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and provide a molecular marker affecting the feather color of Muscovy ducks and its application, specifically adopting the following technical solutions:

[0006] The first aspect of the present invention provides a molecular marker that affects the feather color of Muscovy ducks, which is a SNP marker (single nucleotide mutation marker) and an InDel marker (insertion deletion mutation marker); the nucleotide sequence containing the SNP marker and the InDel marker is shown in SEQ ID No.1; wherein the SNP marker is located at the 273rd position from the 5' end of SEQ ID No.1, and is C or G; the InDel marker is located at the 3136th to 3141th position from the 5' end of SEQ ID No.1, and is a CAACTA fragment or deletion.

[0007] The above-mentioned SNP marker is located at the 273rd position from the 5' end on SEQ ID No.1, corresponding to the 15085125th position on chromosome 13 of the Muscovy duck genome in the international version number GCA_018104995.1; the InDel marker is located at the 3136th position to the 3141th position from the 5' end on SEQ ID No.1, corresponding to the 15087987th position to the 15087992th position on chromosome 13 of the Muscovy duck genome in the international version number GCA_018104995.1.

[0008] The above SNP markers and InDel markers are all located on chromosome 13 of the Muscovy duck genome. ED On the NRB2 gene, combined with the results of the genotype frequency distribution, it can be noted that the genotypes of these two sites are CC type and CAACTA / CAACTA type (frequency is 100%) in all black feather individuals, but there are genotypes CG type or GG type and CAACTA / - type or - / - type in the white feather population. This is believed that no matter which site mutates or both sites mutate at the same time, the final result will lead to EDNRB2 The formation of the termination codon of the gene leads to the premature termination of the transcription process. When the gene is not expressed or expressed in small amounts, the expression of genes related to the promotion of melanin biosynthesis may also be inhibited to a certain extent, thereby affecting the formation and development of the black feather phenotype. When the two marker sites are CC type and CAACTA / CAACTA type, that is, both are wild type, they exhibit a black feather phenotype; conversely, when any one of the sites mutates, it exhibits a white feather phenotype. Among them, "-" represents a deletion mutation, and the InDel mutation refers to the deletion of 6 consecutive nucleotides of "CAACTA" in SEQ ID No.1.

[0009] The second aspect of the present invention provides the use of the above-mentioned SNP markers and InDel markers in identifying the feather color of Muscovy ducks.

[0010] The third aspect of the present invention provides a method for identifying the feather color of Muscovy ducks, determining the above-mentioned SNP markers and InDel markers that affect the feather color of Muscovy ducks, and designing corresponding primer combinations based on the genotypes of the SNP markers and InDel markers, performing PCR amplification respectively, and determining the genotype after sequencing the PCR amplification products.

[0011] As a further preferred embodiment, the above primer combination is as follows:

[0012] The SNPF and SNPR primer pairs used to amplify the SNP loci are as follows:

[0013] SNPF:AGGCTGCCCAACCACTCT;

[0014] SNPR: CCGATGATCCCCACTATGAA;

[0015] The InDelF and InDelR primer pairs used to amplify the InDel site are as follows:

[0016] InDelF:GAGTCGGATCCAGGGGATAG;

[0017] InDelR:CATGAAGCTGGATTTCTGCTC.

[0018] As a further preferred embodiment, the SNP marker and InDel marker of the feather color of the Muscovy duck are identified by analyzing the nucleotide sequence of the Muscovy duck, wherein the nucleotide sequence is shown as SEQ ID No.1.

[0019] As a further preferred embodiment, when the SNP marker at the 273rd site from the 5' end on SEQ ID No.1 is of CC type and the InDel marker at the 3136th to 3141th site from the 5' end on SEQ ID No.1 is of CAACTA / CAACTA type, a black feather phenotype is exhibited; when the SNP marker at the 273rd site from the 5' end on SEQ ID No.1 and / or the InDel marker at any one of the 3136th to 3141th sites from the 5' end on SEQ ID No.1 mutates, a white feather phenotype is exhibited.

[0020] In a fourth aspect of the present invention, a method for genetic improvement of Muscovy ducks is provided, comprising the following steps: determining the above-mentioned SNP markers of a Muscovy duck population, and making corresponding selections based on the SNP markers, selecting Muscovy duck individuals with CG and GG genotypes at the 273rd site from the 5' end on SEQ ID No. 1 in the above-mentioned Muscovy duck population, and eliminating Muscovy duck individuals with CC genotypes at the site, so as to increase the frequency of the allele G at the site generation by generation;

[0021] And / or, determine the above-mentioned InDel marker of the Muscovy duck population, and make corresponding selections based on the InDel markers, select Muscovy duck individuals with CAACTA / - and - / - genotypes at positions 3136 to 3141 from the 5' end on SEQ ID No.1 in the above-mentioned Muscovy duck population, and eliminate Muscovy duck individuals with CAACTA / CAACTA genotypes at this position, so as to reduce the frequency of the allele CAACTA at this position from generation to generation.

[0022] In a fifth aspect, the present invention also provides a method for improving the establishment of a white-feathered Muscovy duck strain, comprising the following steps: for a Muscovy duck whose genotype of the SNP marker is CC, mutating the CC genotype to CG or GG genotype by site-directed mutagenesis;

[0023] And / or, for Muscovy ducks whose genotype of the InDel marker is CAACTA / CAACTA, the CAACTA / CAACTA is mutated to CAACTA / - or - / - by site-directed mutagenesis.

[0024] As a further preferred embodiment, mutation is performed using a transgenic method or a gene editing method.

[0025] As a further preferred embodiment, mutation is performed using the CRISPR / Cas9 gene editing method.

[0026] The beneficial effects of the present invention are:

[0027] The present invention provides a SNP marker and an InDel marker that are closely related to the feather color of Muscovy ducks. Therefore, the SNP marker and the InDel marker provided by the present invention can be used to detect relevant indicators of Muscovy ducks, or the genetic improvement of Muscovy ducks can be carried out through the SNP marker and the InDel marker, and favorable superior genotypes can be selected for seed retention, and the proportion of white feathers in Muscovy ducks can be rapidly increased, thereby providing two useful molecular markers for the breeding of white-feathered Muscovy ducks, and providing an important basis for the selection and domestication of waterfowl based on feather color, and can also bring economic benefits to the industrial development of Muscovy ducks. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Shown is the Manhattan plot of the FST analysis of white-feathered Muscovy ducks (large white Muscovy ducks) versus black-feathered Muscovy ducks (large black Muscovy ducks and small black Muscovy ducks);

[0029] Figure 2 Shown is a bar graph of genotype frequencies of different varieties at SNP markers;

[0030] Figure 3 Shown is a bar graph of genotype frequencies of different varieties at the InDel marker. DETAILED DESCRIPTION

[0031] The following will be combined with the embodiments and drawings to clearly and completely describe the concept, specific structure and technical effects of the present invention, so as to fully understand the purpose, scheme and effect of the present invention. It should be noted that the embodiments and features in the embodiments of this application can be combined with each other without conflict.

[0032] Example 1

[0033] Identification of molecular markers associated with plumage color in Muscovy ducks

[0034] 1. Experimental Animals

[0035] The duck flock used in the present invention is a total of 200 large white Muscovy ducks from Fuzhou City, Jiangxi Province, and small white Muscovy ducks, large black Muscovy ducks and small black Muscovy ducks from Zhangzhou City, Fujian Province, with 50 ducks in each group.

[0036] 2. Experimental methods

[0037] Genomic DNA was extracted from whole blood of 200 individuals of Muscovy ducks from four populations using a standard phenol-chloroform extraction method. All qualified samples were used for library construction (paired-end, 2x150bp) and whole-genome sequencing was performed using the Illumina NovaSeq 6000 platform of Novogene, Beijing, China, with an average sequencing depth of approximately 10-fold sequencing depth. The raw reads were first preprocessed (including removal of adapters and low-quality bases) to obtain clean reads, which were then aligned to the assembled Muscovy duck reference genome using the BWA-MEM algorithm. The alignment results were then converted to BAM format and sorted using the SAMtools software. Several functions of the Sentieon software were then used to detect variants: the site set and realignment functions were used to remove duplicate reads and insertions / deletions (indels) on the realignment; the QualCal function was used to perform base quality value recalibration (BQSR); the gvcf file was generated using the Haplotyper method, and then the GVCFtyper function was used for joint calling. After that, hard filtering was performed using the VariantFiltration method of GATK v4.1.9, with the following filtering conditions: QD<2.0 || FS>60.0 || MQ<40.0 || MQRankSum<-12.5 || ReadPosRankSum<-8.0 || SOR>3.0. Finally, bcftools was used to remove unqualified variant sites, and PLINKv2.0 was used to further filter the output, with minor allele frequency (MAF)>0.01 and call rate>0.9.

[0038] 3. Genetic differentiation index (FST) analysis

[0039] Genetic differences were calculated using autosomal SNPs with a 10kb sliding window to reveal genomic signals pointing to artificial selection characteristics of Muscovy duck plumage. VCFTOOLS v0.1.16 was used to calculate the FST values ​​between the large white Muscovy duck and the large black Muscovy duck and the small black Muscovy duck. The average FST of each 10kb non-overlapping window was summarized and statistically analyzed, and windows with less than 10 SNPs were excluded; the top 1% was selected as the threshold, and genes exceeding the threshold line were considered candidate genes under selection. Figure 1 It can be seen that there are windows on chromosome 13 that exceed the threshold (1%), and the variation information is annotated to the gene name. EDNRB2 The relevant region of the gene.

[0040] The present invention divides four groups of Muscovy ducks into two groups: white feathers (large white Muscovy ducks and small white Muscovy ducks) and black feathers (large black Muscovy ducks and small black Muscovy ducks). EDNRB2 The allele frequency of each SNP site and InDel site on the gene was calculated, and the two sets of results were compared to screen out the SNP sites or InDel sites with a frequency of 0 or 1 in black-feathered Muscovy ducks and which were extremely different from those in white-feathered Muscovy ducks.

[0041] Table 1 Two molecular marker loci affecting the plumage color of Muscovy ducks

[0042]

[0043] The SNP marker and InDel marker of Muscovy duck were identified respectively. The SNP marker was located at the 273rd position from the 5' end of SEQ ID No.1 and was C or G. The InDel marker was located at the 3136th position to the 3141th position from the 5' end of SEQ ID No.1 and was CAACTA or -.

[0044] Example 2

[0045] Verification of the effects of SNP and InDel loci on the plumage color of Muscovy ducks

[0046] This example identified SNP markers and InDel markers that affect the feather color of Muscovy ducks. The SNP marker is located at the 273rd position from the 5' end of SEQ ID No.1 and is C or G. The InDel marker is located at the 3136th position to the 3141th position from the 5' end of SEQ ID No.1 and is CAACTA or -.

[0047] The genotype frequencies of the SNP marker loci in the Muscovy duck population of each breed were analyzed, and the statistical results are as follows: Figure 2 The genotype frequencies of the InDel marker loci in the Muscovy duck population of each species were analyzed, and the statistical results are shown in Figure 3 The results showed that the genotypes of black-feathered Muscovy ducks were all CC and CAACTA / CAACTA types, and when any one of the sites mutated, a white feather phenotype was exhibited.

[0048] Example 3

[0049] Verification of the effect of SNP marker and InDel marker locus genotype on the plumage color of Muscovy duck

[0050] 1. Extract the total DNA of the Muscovy duck genome to be tested

[0051] (1) Mark the sample number on a 1.5 mL sterile centrifuge tube, draw 20 μL of the corresponding numbered Muscovy duck anticoagulated whole blood into the corresponding centrifuge tube, add 600 μL of DNA extraction solution and 10 μL of proteinase K, seal the mouth of the centrifuge tube with sealing film, oscillate gently to mix, and place on a shaker (60°C, 180 r / min) for lysis for 30 minutes; remove the fully digested centrifuge tube from the shaker and centrifuge for 5 minutes (12000 r / min) to precipitate the undigested blood clots;

[0052] (2) Carefully aspirate the supernatant with a pipette tip, add 1 / 10 volume (about 55 μL) of 3 mol / L sodium acetate (pH=5.2), shake upside down until no layers are separated, let stand at 4°C for 10 min, then add 300 mL of phenol-chloroform-isoamyl alcohol (25:24:1), shake vigorously until no layers are separated, let stand at 4°C for 10 min, and centrifuge at 12,000 r / min for 10 min;

[0053] (3) Pipette the DNA supernatant into a new sterilized 1.5 mL centrifuge tube, then add 1 mL of 20°C precooled anhydrous ethanol to the DNA supernatant, gently mix to precipitate the DNA, and then pick out the DNA with a clean pipette tip;

[0054] (4) After picking out the precipitated DNA, add 500 μL of 75% ethanol precooled at 20°C, repeatedly blow and wash the DNA, pour out the ethanol, repeat this step 2-3 times, and finally suck out the excess 75% ethanol in the centrifuge tube with a yellow pipette tip;

[0055] (5) Place the DNA in a ventilated place to air dry for about two hours. After it is air-dried, add 200 μL of TE solution to the centrifuge tube to dissolve and dilute it.

[0056] 2. Design primer combinations

[0057] Table 2 Primer combinations for identifying Muscovy duck feather color

[0058]

[0059] 3. PCR amplification

[0060] (1) performing PCR amplification respectively using the primer combination for identifying the feather color of Muscovy duck according to the selected marker site combination;

[0061] (2) Sequencing the PCR amplification product to determine the genotype;

[0062] (3) Determine the feather color of the tested Muscovy duck based on the genotype results.

[0063] The examples of the present invention have no particular limitation on the PCR amplification method, and conventional PCR amplification methods in the art may be used.

[0064] In summary, the molecular markers provided by the present invention can accurately and effectively identify the feather color of Muscovy ducks, have certain application value in the breeding of Muscovy ducks, and provide a reliable reference for the breeding of Muscovy ducks.

[0065] Although the description of the present invention has been quite detailed and specifically describes several described embodiments, it is not intended to be limited to any of these details or embodiments or any particular embodiment, but should be regarded as providing a broad possible interpretation of these claims in view of the prior art by reference to the appended claims, thereby effectively covering the intended scope of the present invention. In addition, the above description of the present invention is based on the embodiments foreseeable by the inventor, and its purpose is to provide a useful description, and those non-substantial changes to the present invention that have not yet been foreseen may still represent equivalent changes to the present invention.

Claims

1. A molecular marker affecting the feather color of Muscovy ducks, characterized in that: The molecular markers are SNP markers and InDel markers; the molecular marker is the nucleotide sequence of SEQ ID No.1; the SNP marker is located at the 273rd position from the 5' end of SEQ ID No.1, and is C or G; the InDel marker is located at the 3136th position to the 3141th position from the 5' end of SEQ ID No.1, and is a CAACTA fragment or deletion.

2. Use of the SNP marker and InDel marker described in claim 1 in identifying the feather color of Muscovy duck.

3. A method for identifying the feather color of a Muscovy duck, characterized in that: Determine the SNP marker and InDel marker as claimed in claim 1 that affect the feather color of Muscovy duck, design corresponding primer combinations according to the genotypes of the SNP marker and InDel marker, perform PCR amplification respectively, sequence the PCR amplification products, and determine the genotype.

4. The method according to claim 3, characterized in that The primer combinations are as follows: The SNPF and SNPR primer pairs used to amplify the SNP loci are as follows: SNPF:AGGCTGCCCAACCACTCT; SNPR: CCGATGATCCCCACTATGAA; The InDelF and InDelR primer pairs used to amplify the InDel site are as follows: InDelF:GAGTCGGATCCAGGGGATAG; InDelR:CATGAAGCTGGATTTCTGCTC.

5. The method according to claim 4, characterized in that The SNP marker and InDel marker of the feather color of the Muscovy duck are identified by analyzing the nucleotide sequence of the Muscovy duck, wherein the nucleotide sequence is shown as SEQ ID No.

1.

6. The method according to claim 5, characterized in that When the gene of the SNP marker at the 273rd site from the 5' end on SEQ ID No.1 is of CC type and the gene of the InDel marker at the 3136th to 3141th site from the 5' end on SEQ ID No.1 is of CAACTA / CAACTA type, a black feather phenotype is exhibited; when the SNP marker at the 273rd site from the 5' end on SEQ ID No.1 and / or the InDel marker at any one of the sites from the 3136th to 3141th site from the 5' end on SEQ ID No.1 mutates, a white feather phenotype is exhibited.

7. A method for genetic improvement of Muscovy ducks, characterized in that: The following steps are involved: Determine the SNP marker of claim 1 in a Muscovy duck population, and make corresponding selections based on the SNP markers, select Muscovy duck individuals with CG and GG genotypes at the 273rd position from the 5' end of SEQ ID No. 1 in the Muscovy duck population, and eliminate Muscovy duck individuals with CC genotype at the position, so as to increase the frequency of the allele G at the position generation by generation; And / or, determine the InDel marker as described in claim 1 of the Muscovy duck population, and make corresponding selections based on the InDel marker, select Muscovy duck individuals with CAACTA / - and - / - genotypes at positions 3136 to 3141 from the 5' end on SEQ ID No.1 in the Muscovy duck population, and eliminate Muscovy duck individuals with CAACTA / CAACTA genotypes at this position, so as to reduce the frequency of the allele CAACTA at this position from generation to generation.

Images