KASP molecular markers for leaf area traits of low temperature tolerance in watermelon seedlings and their applications

Abstract

The present invention discloses a KASP molecular marker for the low temperature resistant leaf area trait of watermelon seedlings and its use. The molecular marker LAC obtained by the present invention is a KASP marker for the gene for controlling leaf area change in response to low temperature resistance of watermelon, which can be used to identify the leaf area size gene under low temperature conditions of watermelon and auxiliary breeding of low temperature resistant watermelon, hybridize the gene donor W-X watermelon with reduced leaf area under low temperature conditions with the gene donor W-Y watermelon with increased leaf area under low temperature conditions, and then select by combining markers. The present invention can replace the phenotypic screening of large-scale low temperature adversity treatment, reduce the field workload and the plant loss caused by adversity treatment, and greatly improve the accuracy and efficiency of screening.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable agronomic trait molecular marker development and molecular marker-assisted breeding, and particularly relates to a KASP molecular marker suitable for rapid screening of low-temperature-resistant leaf area traits of watermelon seedlings and molecular marker-assisted breeding and its use. Background Art

[0002] Low temperature stress is the main environmental factor affecting plant growth, development, productivity and distribution. According to different temperature ranges, low temperature stress can be divided into chilling stress (0℃ and above) and freezing stress (below 0℃). Among them, chilling stress is the main stress encountered by plants in tropical and subtropical regions. Cold stress can have adverse effects on the entire growth and development process of plants. Low temperature can reduce the germination potential of seeds and the emergence rate of seedlings, leading to slow plant growth, weak seedlings, wilting leaves, low fruit setting rate, and reduced yield and quality (Guo X, 2018; Wang Yi, 1994; Ding Y, 2019; Ruelland E, 2009; Thomashow MF, 1999).

[0003] The external morphological characteristics of plants are the most direct manifestation of plants' response to low temperature stress, and can directly reflect the cold resistance of plants. Leaf area refers to the surface area of ​​leaves, which can directly affect the absorption and utilization of light energy by plants. Numerous studies have shown that under low temperature stress, water-soaked spots will appear on the leaves of horticultural crops such as cucumbers, tomatoes, and peppers, and they will wilt, curl, and dry up, leading to a reduction in plant leaf area, and ultimately reducing photosynthesis efficiency and total photosynthesis. Therefore, changes in leaf area can well represent the cold resistance of plants, and have the advantages of being easy to observe and measure, which is of great significance in production.

[0004] Watermelon [Citrullus lanatus (Thunb.) Matsum. & Nakai] is an important cash crop with a wide cultivation area and significant economic benefits. my country is an important producer and consumer of watermelon in the world. In recent years, my country's watermelon industry has developed rapidly, and its area and output have ranked first in the world for many years. In 2022, my country's watermelon harvest area and output were 1.384 million hm2 respectively. 2 , 60.3861 million tons, accounting for 47.46% and 60.41% of the world respectively. With the acceleration of industrialization and specialization, watermelon production has gradually moved towards regionalization and large-scale production. From the perspective of national regional layout, watermelon production is mainly concentrated in East China and Central and South China, and the two regions together produce about 70% of watermelons (Yu Jiaqing, 2024).

[0005] Watermelon is native to tropical Africa and is sensitive to low temperatures. In East China, watermelons are cultivated in early spring, and are often attacked by low temperatures during the seedling stage or the early stage of planting, which affects the growth and development of the plants, delays the time for the fruit to be put on the market, and causes great economic losses. In production, physical measures (multi-layer covering, artificial heating, etc.), cultivation measures (grafting, low-temperature seedling hardening, adjusting the ratio of substrate materials, adding probiotics, etc.), and spraying chemical reagents (hormone growth regulators, osmotic regulators, non-enzymatic antioxidants, etc.) are usually taken to alleviate the damage to seedlings or enhance their cold tolerance, but at the same time, it also increases production costs and biosafety risks. Therefore, cultivating and promoting new cold-resistant watermelon varieties is the fundamental way to solve this problem. However, the lack of efficient and accurate phenotypic evaluation technology for measuring the low-temperature tolerance of watermelons and the lack of molecular markers available for breeding have seriously restricted the progress of molecular breeding of watermelons for low-temperature tolerance.

[0006] The references mentioned above are as follows:

[0007] Yu Jiaqing, Xia Yong. Current situation, problems and suggestions of watermelon industry in my country[J]. Modern Agriculture. 2024(05):25-27.

[0008] Guo X, Liu D, Chong K. Cold signaling in plants: Insights intomechanisms and regulation[J]. Integr Plant Biol. 2018(9):745-756.

[0009] Wang Yi, Yang Hongfu, Li Deshu. Research on chilling injury and chilling resistance of horticultural plants - a literature review[J]. Acta Horticulturae Sinica, 1994, 21(3): 239-244.

[0010] Ding, Y., Shi, Y. and Yang, S. Advances and challenges in uncovering cold tolerance regulatory mechanisms in plants[J]. New Phytol. 2019.222:1690-1704.

[0011] Ruelland E, Vaultier MN, Zachowski A, Hurry V. Cold signaling and cold acclimation in plants[J]. Advances in Botanical Research.2009.49: 35–150.

[0012] Thomashow MF. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annual Review of Plant Physiology and Plant MolecularBiology. 1999. 50: 571–599. Summary of the invention

[0013] The purpose of the present invention is to provide a KASP molecular marker for the low temperature resistance leaf area trait of watermelon seedlings and its use in view of the deficiencies in the prior art. The molecular marker LAC (Relative rate of change in leafarea under chilling stress) obtained by the present invention is a KASP marker for controlling the relative change of leaf area in response to low temperature resistance of watermelon seedlings, and can be used for auxiliary breeding of low temperature resistant and non-low temperature resistant watermelons.

[0014] In order to achieve the above object, the present invention provides a KASP molecular marker for the low temperature resistance leaf area trait of watermelon seedlings, which is located at 16128196bp of chromosome 11 of the watermelon genome, and the sequence of 50bp before and after is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0015] Furthermore, the KASP molecular marker genotype is C or T; the sequence of 50 bp before and after the C genotype is shown in SEQ ID NO.1, and the corresponding phenotype is non-cold-resistant; the sequence of 50 bp before and after the T genotype is shown in SEQ ID NO.2, and the corresponding phenotype is cold-resistant.

[0016] The present invention also provides a use of the KASP molecular marker in identifying leaf area size genes of watermelon seedlings under low temperature conditions.

[0017] Further, the molecular marker primer is selected from the following primer pair, wherein the nucleotide sequence is 5'-3':

[0018] The forward primer F-HEX is shown in SEQ ID NO.3:

[0019] GAAGGTCGGAGTCAACGGATTTCGGCATCTTGTTGAGCTCCA;

[0020] The forward primer F-FAM is shown in SEQ ID NO.4:

[0021] GAAGGTGACCAAGTTCATGCTTCGGCATCTTGTTGAGCTCCG;

[0022] The reverse primer R is shown in SEQ ID NO.5:

[0023] CGGAAGTGGTCAAGCAAATCAACG.

[0024] Furthermore, the use of the KASP molecular marker in identifying the leaf area size gene of watermelon seedlings under low temperature conditions specifically includes the following steps:

[0025] 1) Extract genomic DNA of the watermelon variety to be tested;

[0026] 2) using the KASP molecular marker to perform PCR amplification on watermelon genomic DNA;

[0027] 3) According to the difference in fluorescence signals of PCR amplification results, the genotype of each watermelon to be tested was identified by Kraken software: if the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the forward primer F-FAM, the watermelon to be tested is a homozygous genotype CC; if it is consistent with the color of the fluorescence linker of the forward primer F-HEX, the watermelon to be tested is a homozygous genotype TT; if the color of the fluorescence signal of the PCR amplification result is different from the color of the fluorescence linkers of both the forward primer F-HEX and the forward primer F-FAM, the watermelon to be tested is a heterozygous genotype CT.

[0028] Furthermore, in step 2), the PCR reaction system used for the PCR amplification is: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix; the KASP Assay Mix contains forward primer F-HEX, forward primer F-FAM, and reverse primer R, and the molar concentration ratio of F-HEX:F-FAM:R is 2:2:5, for a total of 10.14 μl; the PCR program is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61°C, -0.6°C / cycle for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for 29 cycles.

[0029] The present invention also provides a use of the KASP molecular marker in molecular assisted breeding of leaf area size of watermelon under low temperature conditions.

[0030] The beneficial effects of the present invention are as follows:

[0031] 1. Early screening: The marker genotype can be detected in advance during the seedling stage to predict the leaf area phenotype of the plant's resistance to low temperature in the later stage.

[0032] 2. Alternative phenotypic screening: Use marker screening to replace large-scale phenotypic screening under low temperature stress treatment, reducing field workload and plant losses caused by stress treatment.

[0033] 3. Improve screening efficiency and accuracy: The cold-resistance phenotype of plants is the comprehensive result of the interaction between genotype and environment. Screening for cold-resistance based on phenotype will lead to selection errors due to environmental differences. Combining molecular markers to screen genotypes can greatly improve the accuracy and efficiency of screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0035] Figure 1 The leaf area phenotypes of different low-temperature resistant materials WX and WY after low-temperature treatment, among which (a) is the plant phenotype of low-temperature sensitive material WX (left) and low-temperature resistant material WY (right) after 14 days of low-temperature treatment, and (b) is the leaf area data of WX and WY after 14 days of low-temperature treatment;

[0036] Figure 2 This is the marker typing diagram of the hybrid offspring of donor WX watermelon and donor WY watermelon; among them, blue dots represent homozygous CC genotype; red dots represent homozygous TT genotype; green dots represent heterozygous CT genotype; black dots represent water blank control;

[0037] Figure 3 This is the marker typing diagram of natural population watermelon; among them, blue dots represent homozygous CC genotype; red dots represent homozygous TT genotype; black dots represent water blank control. DETAILED DESCRIPTION

[0038] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0039] Example 1: Identification of leaf area changes in watermelon after low temperature treatment

[0040] The low temperature treatment condition (10℃ / 5℃, 12h / 12h, day / night) was selected to identify the relative change rate of leaf area after low temperature treatment for 168 watermelon materials. On the 0th day and the 14th day of low temperature treatment, the leaf area was measured using a living leaf area meter. The relative change rate of leaf area (%) = (final leaf area - initial leaf area) / initial leaf area * 100%. The identification of the change in leaf area of ​​watermelon seedlings resistant to low temperature showed that the relative change rate of leaf area of ​​WX decreased, and its low temperature resistance was poor; the relative change rate of leaf area of ​​WY increased, and its low temperature resistance was good. Figure 1 .

[0041] Example 2: Location of the major QTL for the low temperature tolerance leaf area trait in watermelon

[0042] Watermelon germplasm leaf materials were selected, and DNA was extracted and sequenced using the CTAB (Hexadecyl trimethylammonium bromide) method; the resequencing file (VCF) of the watermelon material was obtained. Through the Bulked Segregant Analysis (BSA) analysis, a QTL related to leaf area changes under low temperature conditions was located in the 13874671-17378125 interval of chromosome 11.

[0043] Example 3: Design of molecular marker LAC

[0044] The molecular marker LAC related to the leaf area of ​​watermelon under low temperature conditions of the present invention is obtained by the following method:

[0045] 1) Use the CTAB method to extract genomic DNA from watermelon parent seedlings and hybrid offspring seedlings;

[0046] 2) Screening of gene markers related to leaf area tolerance to low temperature in watermelon by PCR;

[0047] 3) A KASP marker LAC was developed. After polymorphism detection, it was found that it was significantly correlated with the leaf area of ​​watermelon under low temperature conditions. This marker can be used to identify changes in leaf area of ​​watermelon under low temperature conditions.

[0048] The molecular marker is located at 16128196 of chromosome 11 of the watermelon genome (Cla97Chr11:16128196), and the sequence of 50 bp before and after the molecular marker site is:

[0049] CATGCCGGAAGTGGTCAAGCAAATGAACGAAAAGTTGGCAATAAATATTGCGGAGCTCAAGAAGATGCCGAAGAAACTATCGACCGTCGCTGAGGCGATGA (SEQ ID NO.1)

[0050] or

[0051] CATGCCGGAAGTGGTCAAGCAAATGAACGAAAAGTTGGCAATAAATATTGTGGAGCTCAAGAAGATGCCGAAGAAACTATCGACCGTCGCTGAGGCGATGA (SEQ ID NO. 2)

[0052] The molecular marker primers are selected from the following primer pairs, wherein the nucleotide sequence is 5'-3':

[0053] Forward Primer (F-HEX):

[0054] GAAGGTCGGAGTCAACGGATTTCGGCATCTTGTTGAGCTCCA (SEQ ID NO.3)

[0055] Forward Primer (F-FAM):

[0056] GAAGGTGACCAAGTTCATGCTTCGGCATCTTGTTGAGCTCCG (SEQ ID NO.4)

[0057] Reverse primer (R):

[0058] CGGAAGTGGTCAAGCAAATCAACG (SEQ ID NO.5)

[0059] Example 4: Using molecular markers to identify sequence differences between watermelons with increased leaf area changes and watermelons with reduced leaf area changes under low temperature conditions

[0060] The present invention also provides a method for identifying the leaf area size gene of watermelon under low temperature conditions using the molecular marker LAC, comprising the following steps:

[0061] (1) Extracting genomic DNA of the watermelon variety to be tested;

[0062] (2) PCR amplification of watermelon genomic DNA using molecular marker LAC;

[0063] (3) Based on the difference in fluorescence signals of PCR products, the genotype of each watermelon to be tested was identified using Kraken software, that is, the homozygous CC genotype (WX), the homozygous TT genotype (WY), the heterozygous CT genotype ( Figure 1 ).

[0064] In this example, the PCR reaction was directly carried out on the ABI Stepone fluorescence quantitative PCR instrument, which has its own fluorescence analysis software, so that the analysis results can be directly obtained. The results are as follows: Figure 2 That is, the software automatically divides the test samples into homozygous CC genotype, homozygous TT genotype and heterozygous CT genotype according to different genotypes.

[0065] The PCR reaction system was: 20-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5 molar concentration ratio) 0.14 μl, a total of 10.14 μl;

[0066] The PCR program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing at 61°C (-0.6°C / cycle) for 60 s, for 10 cycles; denaturation at 94°C for 20 s, and annealing at 55°C for 60 s, for 29 cycles.

[0067] When the software analyzes that dots of the same color as WX appear, it means that the genotype of the material corresponding to the dots is CC; when dots of the same color as WY appear, it means that the genotype of the material corresponding to the dots is TT.

[0068] Two forward primers are each provided with a fluorescent connector (in different colors), corresponding to F-HEX and F-FAM respectively. If the material to be tested is a homozygous genotype, only one of the corresponding primers will be selected for amplification during amplification (for example, the homozygous CC type can only react with F-FAM). Based on the difference in fluorescence, it can be determined whether the material to be tested is CC or TT. If the material to be tested is a heterozygous type, both primers will be used during amplification, and the fluorescence generated will be different from that of the homozygous genotype material, thereby achieving the distinction between heterozygous genotypes.

[0069] Experiment 1: The different watermelon germplasms described in Table 1 were tested according to the method described in Example 2. The results are shown in Table 1.

[0070] The results showed that the genotyping of LAC markers in F2 was linked to the phenotype of leaf area change under low temperature, and the next step of breeding could be carried out by selecting hybrid or backcross offspring individuals of the TT gene. This indicated that LAC markers could assist in the selection and breeding of cold-tolerant watermelon lines or their offspring.

[0071] Table 1: Results of the F2 population measured in Example 2 and Example 3 and classification statistics of relative change rate of leaf area

[0072]

[0073]

[0074]

[0075] Example 5: DNA polymorphism analysis of LAC markers in natural population materials with different watermelon genotypes

[0076] According to the nucleotide sequence of the LAC gene, the molecular marker LAC is designed and developed to detect the polymorphism of watermelon genotypes with different leaf area changes under low temperature conditions. The primers (molecular markers) can be commissioned to Shanghai Sunny Biotechnology Co., Ltd. for synthesis, PCR amplification can be performed on the ABI Veriti96 PCR instrument, and the fluorescence signal can be detected and the genotyping can be analyzed using the ABI company's Stepone fluorescence quantitative PCR instrument.

[0077] The PCR reaction system was: 20~50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5, the molar concentrations of these three were 2.2 ng / l, 2.2 ng / l, and 5.5 ng / l, respectively) 0.14 μl, a total of 10.14 μl.

[0078] The specific procedure is: 94℃ pre-denaturation, 15 minutes; 94℃, 20 seconds (denaturation) - 61℃~55℃, 1 minute (renaturation & extension: 10 cycles of amplification with touch down program, 0.6℃ lowered for each cycle); 94℃, 20 seconds (denaturation) - 55℃, 60 seconds for 29 cycles. After amplification, use the BMG PHERAstar instrument to detect the fluorescence signal and check the typing. If the typing is not sufficient, continue amplification and check the typing every 3 cycles until the typing is complete, and export the experimental results from the Kraken software.

[0079] According to the setting of the present invention, 29 cycles of amplification can achieve complete typing.

[0080] Experiment 2: The different watermelon germplasms described in Table 2 were tested according to the method described in Example 2. The results are shown in Table 2.

[0081] The genotyping results show that each set of primers has a good typing effect on the tested watermelon. The typing effect of primers on DNA samples is shown in the figure below. Figure 2 As shown in the figure, each dot represents a material to be tested, where the red dot indicates that the site is a homozygous genotype "TT"; the blue dot indicates that the site is a homozygous genotype "CC"; the coordinate original position is the water control. The typing result graph has clear division boundaries, indicating that the KASP marker typing is reliable.

[0082] The results of association analysis of LAC genotype and low temperature tolerance phenotype showed that the genotyping of LAC markers in the natural population tested was linked to the phenotype of leaf area change at low temperature, and the next step of breeding could be carried out by selecting hybrid or backcross offspring of TT gene. This indicates that LAC markers can assist in the selection and breeding of watermelon cold-tolerant strains or their offspring.

[0083] Table 2: The results of natural populations measured in Example 2 and Example 3 and the classification statistics of relative change rate of leaf area

[0084]

[0085]

[0086] Example 6: Using LAC molecular markers to carry out leaf area-assisted selection breeding of watermelon under low temperature conditions

[0087] The WX watermelon, which is a gene donor for reducing leaf area under low temperature conditions, was hybridized with the WY watermelon, which is a gene donor for increasing leaf area under low temperature conditions, and then marker-assisted selection was used. The F2 population was obtained by hybridization, and the leaf area size of the watermelon was tested under low temperature stress, such as Figure 2 As shown, blue dots represent homozygous CC genotypes; red dots represent homozygous TT genotypes; green dots represent heterozygous CT genotypes; black dots represent water blank controls (the typing results are clearly distinguished by color, indicating that the KASP marker typing is reliable); it was found that the leaf area changes of all homozygous TT genotype watermelon F2 offspring populations were significantly greater than those of homozygous CC gene watermelon F2 offspring populations, while the leaf area changes of heterozygous populations showed an intermediate type. This result once again verified the high linkage between the LAC molecular marker and the leaf area size of watermelon under low temperature stress ( Figure 3 ), which can be used in molecular assisted breeding of watermelon leaf area changes under low temperature conditions.

[0088] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Use of a KASP molecular marker reagent for detecting the low temperature resistance leaf area trait of watermelon seedlings in identifying the low temperature resistance trait of watermelon seedlings, characterized in that: The sequence of the marker is shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the KASP molecular marker is CC or TT; the sequence of the CC genotype is shown in SEQ ID NO.1, and the corresponding phenotype is a non-low temperature resistant type; the sequence of the TT genotype is shown in SEQ ID NO.2, and the corresponding phenotype is a low temperature resistant type.

2. The use according to claim 1, characterized in that The reagent for detecting the KASP molecular marker for the low temperature tolerance leaf area trait of watermelon seedlings is the following primer pair, wherein the nucleotide sequence is 5'-3': The forward primer F-HEX is shown in SEQ ID NO.3: GAAGGTCGGAGTCAACGGATTTCGGCATCTTGTTGAGCTCCA; The forward primer F-FAM is shown in SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTTCGGCATCTTGTTGAGCTCCG; The reverse primer R is shown in SEQ ID NO.5: CGGAAGTGGTCAAGCAAATCAACG.

3. The use according to claim 2, characterized in that: The following steps are involved: (1) Extracting genomic DNA of the watermelon variety to be tested; (2) using the KASP molecular marker to perform PCR amplification on watermelon genomic DNA; (3) Based on the difference in fluorescence signals of PCR amplification results, the genotype of each watermelon to be tested was identified using Kraken software: if the color of the fluorescence signal of the PCR amplification result is consistent with the color of the fluorescence linker of the forward primer F-FAM, the watermelon to be tested is a homozygous genotype CC; if it is consistent with the color of the fluorescence linker of the forward primer F-HEX, the watermelon to be tested is a homozygous genotype TT; if the color of the fluorescence signal of the PCR amplification result is different from the color of the fluorescence linkers of both the forward primer F-HEX and the forward primer F-FAM, the watermelon to be tested is a heterozygous genotype CT.

4. The use according to claim 3, characterized in that In step (2), the PCR reaction system used for the PCR amplification is: 5.0 μl of 20-50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix; the KASP Assay Mix contains forward primer F-HEX, forward primer F-FAM, and reverse primer R, and the molar concentration ratio of F-HEX:F-FAM:R is 2:2:5, for a total of 10.14 μl; the PCR program is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61°C, -0.6°C / cycle for 60 seconds, for a total of 10 cycles; denaturation at 94°C for 20 seconds, annealing at 55°C for 60 seconds, for 29 cycles.

5. Use of a KASP molecular marker reagent for detecting the low temperature resistance leaf area trait of watermelon seedlings in molecular assisted breeding of low temperature resistance of watermelon seedlings, characterized in that: The sequence of the marker is shown in SEQ ID NO.1 or SEQ ID NO.2; the genotype of the KASP molecular marker is CC or TT; the sequence of the CC genotype is shown in SEQ ID NO.1, and the corresponding phenotype is a non-low temperature resistant type; the sequence of the TT genotype is shown in SEQ ID NO.2, and the corresponding phenotype is a low temperature resistant type.

Images