Specific primers for detecting tet(X)-positive variable Acinetobacter and their application

Abstract

The present invention discloses a specific primer for detecting tet (X) positive variable acinetobacter and its application. The tet (X) positive variable acinetobacter detection primer of the present invention is composed of two pairs of primers, variabilis-3635F / variabilis-3635R and mono-F / mono-R. PCR amplification is performed using the above primers, and two clear bands of 620bp and 240bp are respectively presented by 1.2% agarose gel electrophoresis, and sequencing is correct. The detection rate of tet (X) positive variable acinetobacter genome and bacterial suspension is 100%, the minimum DNA detection limit is 0.08ng / μL, and the whole bacterial liquid detection process only takes 3h. The tet (X) positive variable acinetobacter detection method provided by the present invention is simple to operate, highly sensitive, highly accurate and time-consuming.

Description

Technical Field

[0001] The present invention relates to the detection of variable acinetobacter, and in particular to a specific primer for detecting tet(X)-positive variable acinetobacter and an application thereof. Background Art

[0002] Tigecycline is a third-generation tetracycline antibiotic and is considered one of the last options for treating multidrug-resistant bacterial infections in adults. However, in recent years, new tet(X) variants such as tet(X3) have continued to appear and spread widely in Acinetobacter bacteria, with high levels of degradation activity against tigecycline and even fourth-generation elacycline and omadacycline. Acinetobacter variabilis belongs to the Acinetobacter family and is a type of strictly aerobic, non-flagellated and non-motile Gram-negative bacteria. Statistics from the NCBI database show that tet(X)-positive Acinetobacter variabilis accounts for as much as 12.7% of tet(X)-positive Acinetobacter bacteria, and the main subtypes include tet(X3), tet(X6) and tet(X15). They have been detected in pigs, chickens, ducks, sewage and soil in my country. Therefore, we need a precise and rapid detection method to monitor tet(X)-positive Acinetobacter variabilis.

[0003] The determination of bacterial physiological and biochemical characteristics is a common method for bacterial identification, but this method takes a lot of time. 16S rRNA sequencing and rpoB sequencing are also important means of bacterial identification, but the sequencing cost is high, and with the increasing number of Acinetobacter species, this method is no longer widely applicable to its accurate detection. At the same time, PCR-specific primers are one of the options for rapid bacterial identification. However, there is currently a lack of specific PCR primers for variable Acinetobacter, especially tet(X)-positive variable Acinetobacter. Summary of the invention

[0004] In view of the problem that there is currently a lack of specific PCR primers for tet(X)-positive variable Acinetobacter, the present invention provides a specific primer for detecting tet(X)-positive variable Acinetobacter and its application. The specific primer can efficiently detect tet(X)-positive variable Acinetobacter and promote the rapid detection of this type of pathogen.

[0005] In order to achieve the above object, the present invention provides a specific primer for detecting tet(X)-positive variable acinetobacter, which comprises the following two pairs of primer sets:

[0006] variabilis-3635F:5'-CAGTTGCGTGATAAAAACGG-3'(SEQ ID NO.1)

[0007] variabilis-3635R: 5'-TGCTGCTATCATTGGAGT-3' (SEQ ID NO. 2);

[0008] mono-F: 5'-GCGGGATTGTTACAAACTTA-3' (SEQ ID NO.3)

[0009] mono-R: 5'-ATCTGCTGTTTCACTCG-3' (SEQ ID NO. 4).

[0010] The second aspect of the present invention provides the use of the above-mentioned specific primers in detecting tet(X)-positive variable Acinetobacter.

[0011] Specifically, the method for detecting tet(X)-positive variable Acinetobacter comprises the following steps:

[0012] S1. Use the above-mentioned specific primers to perform PCR amplification on the genomic DNA or bacterial suspension of the strain to be tested;

[0013] S2. If two DNA-specific bands of 620 bp and 240 bp are found in the gel electrophoresis test results, the strain is determined to be tet(X)-positive variable Acinetobacter.

[0014] Specifically, in step S1, the minimum detection concentration of genomic DNA is 0.08 ng / μL.

[0015] Specifically, in step S1, the PCR amplification system includes: 12.5 μL of 2×Taq Master Mix, 0.5 μL of each primer, 1 μL of PCR template, and 9.5 μL of sterile water.

[0016] Furthermore, in step S1, the reaction procedure of the PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s, 30 cycles; final extension at 72°C for 10 min; and storage at 4°C.

[0017] The third aspect of the present invention provides a tet(X)-positive variable Acinetobacter detection kit, which includes the above-mentioned specific primers.

[0018] Through the above technical solution, the present invention achieves the following beneficial effects:

[0019] The tet(X) positive variable acinetobacter detection primers of the present invention are composed of two pairs of primers, variabilis-3635F / variabilis-3635R and mono-F / mono-R. The above primers are used for PCR amplification, and two clear bands of 620bp and 240bp are respectively presented by 1.2% agarose gel electrophoresis, and sequencing verification is correct. The detection rate of the tet(X) positive variable acinetobacter genome and bacterial suspension is 100%, the minimum DNA detection limit is only 0.08ng / μL, and the entire bacterial liquid detection process only takes 3h. It can be seen that the tet(X) positive variable acinetobacter detection method provided by the present invention is simple to operate, highly sensitive, highly accurate and time-consuming. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the optimal PCR annealing temperature for tet(X)-positive variable Acinetobacter in Example 2 of the present invention;

[0021] Figure 2 This is the minimum PCR detection limit of the tet(X)-positive variable immobile rod in Example 3 of the present invention. DETAILED DESCRIPTION

[0022] The specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described herein is only used to illustrate and explain the present invention, and is not used to limit the present invention.

[0023] The instruments, reagents, materials, etc. involved in the following examples, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through conventional commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0024] Example 1 Design and verification of specific PCR primers

[0025] (1) Design of PCR primers for tet(X)-positive variable Acinetobacter

[0026] Using the conserved genes of tet(X)-positive Acinetobacter variabilis (i.e., glycosyltransferase gene and flavin-dependent monooxygenase gene) as reference, two pairs of primers, i.e., variabilis-3635F / variabilis-3635R and mono-F / mono-F, were obtained online using the NCBI primer design platform. The specific information of the primers is shown in SEQ ID NO.1-SEQ ID NO.4.

[0027] (2) Genome preparation of tet(X)-positive variable Acinetobacter B10-3

[0028] The tet(X)-positive variable Acinetobacter B10-3 was streaked in three zones on a blank LB agar medium and cultured at 37°C for 20 hours before purification. A mung bean-sized bacterial lawn was scraped into 500 μL of sterile water, centrifuged to remove the supernatant, and then the tet(X)-positive variable Acinetobacter genomic DNA was extracted using the Tiangen Bacterial Genomic DNA Extraction Kit at a concentration of 167.0 ng / μL.

[0029] (3) Establishment of a PCR detection method for tet(X)-positive variable Acinetobacter

[0030] PCR was performed using the genome of tet(X)-positive variable Acinetobacter B10-3 as a template. The PCR system and procedure were as follows, and three parallels were set up for each group.

[0031] The PCR detection system was: 2×Taq Master Mix (Novagen), 12.5 μL; template, 1 μL; upstream and downstream primers, 0.5 μL each; and finally, sterile water was used to make up to 25 μL.

[0032] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, (denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 30 s) × 30 cycles, final extension at 72°C for 10 min, and storage at 4°C.

[0033] (4) Determination of PCR amplification results

[0034] The PCR amplification products were subjected to 1.2% agarose gel electrophoresis, and the electrophoresis bands were detected using a gel imager. The results showed that the amplified bands of variabilis-3635F / variabilis-3635R and mono-F / mono-R were clear, the sizes of the target genes were 620 bp (as shown in SEQ ID NO.5) and 240 bp (as shown in SEQ ID NO.6), respectively, and the Sanger first-generation sequencing results were aligned correctly.

[0035] SEQ ID NO.5:

[0036] TTATTTGGACATAGAGAGCCGTTATAATCATCTTCAGGTCGAAAAGAAGACTTATTATCCGGATAGCAATATTCATAGCTATAGTAACTGGGGCAGCAGCGAGTCGTCAGTTTTGCCTAGCTATAGCAAGAATAAGAACGCTTTTGATTCGATCATTCGTCAGGCCGCCCAGACTTATGGTGTGTCTGAAGGTTTAATTAAAGCAGTCATGCATACTGAATCCGGCTTTAATACCCATGCCCGCTCCCCTGTGGGTGCACAAGGTTTGATGCAGCTGATGCCAGCCACTGCACGTCGCTTTAATGTCAGTAATGCTTATGATCCTCATCAGAATATTATGGCGGGTGCTAAATATCTGGCTTGGTTATTAAAGCGTTTTAATGGCAATACCAGCCTGGCACTGGCGGGCTACAATGCCGGTGAAGGCAATGTCAGCAAATATGGTGGAATCCCGCCTTTCCGGGAAACTCAGGATTATGTACGCCGTGTGACCAGCCGTTATCAAAATCTGTATACTCATGGCCTGAGTGCAAGTACAACCACGTCTAGCACATCATCCAGTGAAGGCCGCATCATTGCCAGTTCAGCGAACTACTCCAGGAAAAAAGCAGCAAAACCCA

[0037] SEQ ID NO.6:

[0038] CAGACTACATGGGTGTAATATTGCTGATGAAAAAGGCAATATTTTATCCACAAAAAATGTAAAGCCCGAAAATCGATTTGACAATCCTGAAATAAACAGAAATGACTTAAGGGCTATCTTGTTGAATAGTTTAGAAAACGACACGGTTATTTGGGATAGAAAACTTGTTATGCTTGAACCTGGTAAGAAGAAGTGGACACTAACTTTTGAGAATAAACCGAGTGAAACAGCAGATAAAAA。

[0039] Example 2: Determination of the Optimal PCR Annealing Temperature

[0040] The genome of tet(X)-positive variable acinetobacter B10-3 was used as a template for PCR amplification, and the annealing temperature gradient of the primers was set to 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, 56°C, 57°C and 58°C. A volume of 6 μL of PCR product was subjected to 1.2% agarose gel electrophoresis, detected using an agarose gel imager, and grayscale analysis was performed using ImageJ version 1.8.0 software. The results are shown in Figure 1 As shown, the optimum annealing temperature is 50°C.

[0041] Example 3 Determination of the minimum DNA concentration detection limit of PCR

[0042] The genome of tet(X)-positive variable Acinetobacter B10-3 was diluted 2-fold with sterile water to a final concentration of 0.005 ng / μL. The genome dilution was used as a template and PCR amplification was performed at an annealing temperature of 50°C. Figure 2 It can be seen that from 2 -12 The band at the beginning of the gradient changes from presence to absence, and the corresponding minimum DNA detection concentration is 0.08 ng / μL.

[0043] Example 4 Accuracy detection of tet(X) positive variable Acinetobacter - genome

[0044] A total of 72 strains were tested, including tet(X)-positive variable Acinetobacter (n=22), tet(X)-positive Acinetobacter amyesii (n=6), tet(X)-positive Acinetobacter indicus (n=9), tet(X)-positive Empedobacter falsenii (n=28), tet(X)-negative variable Acinetobacter DSM 102977, tet(X)-negative Acinetobacter baumannii ATCC19606, tet(X)-negative Acinetobacter baylyi ADP1, tet(X)-negative Salmonella enterica ATCC 14028, tet(X)-negative Klebsiella pneumoniae ATCC 700603, tet(X)-negative Escherichia coli (Escherichia coli) C600 and tet(X) negative Escherichia coli ATCC25922. PCR amplification was performed using their genomes as templates at an annealing temperature of 50°C. The results are shown in Table 1. The tet(X) positive variable Acinetobacter all showed two clear bands (positive results), with sizes of 620 bp and 240 bp, respectively, while other strains such as tet(X) negative variable Acinetobacter DSM 102977 had only one band or none (negative results), that is, the accuracy of the tet(X) positive variable Acinetobacter genome detection was 100%.

[0045] Example 5 Accuracy determination of tet(X)-positive variable Acinetobacter - bacterial suspension

[0046] Scrape the bacterial moss of the above-mentioned strains to be tested and add it to 700 μL of 0.9% sterile saline. Use a multifunctional microplate reader to measure and adjust the bacterial solution concentration to OD 600 =0.5. Using the prepared bacterial suspension as a template, PCR amplification was performed at an annealing temperature of 50°C, and the entire bacterial liquid detection process took only 3 hours. As shown in Table 1, tet(X)-positive variable acinetobacter all had two clear bands of 620 bp and 240 bp, showing a positive result, while all other strains were negative. Therefore, the accuracy of tet(X)-positive variable acinetobacter detection based on bacterial suspension was 100%.

[0047] Table 1 Results of tet(X) positive variable immobile rod accuracy determination

[0048]

[0049]

[0050]

[0051] Note: ++, 2 PCR bands; +, 1 PCR band; -, no band.

[0052] The preferred implementation modes of the present invention are described in detail above in combination with the embodiments; however, the present invention is not limited to the specific details in the above implementation modes. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical scheme of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0053] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0054] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A test tet (X) A primer specific for positive variable Acinetobacter, characterized in that Includes the following two pairs of primers: variabilis-3635F:5'-CAGTTGCGTGATAAAAACGG-3' variabilis-3635R: 5'-TGCTGCTATCATTGGAGT-3'; mono-F: 5'-GCGGGATTGTTACAAACTTA-3' mono-R: 5'-ATCTGCTGTTTCACTCG-3'.

2. A tet (X) A positive variable Acinetobacter detection kit, characterized in that: The method comprises the specific primer according to claim 1.

Images