A polyketide compound trichodinerin and its preparation method and application

Abstract

The present invention provides a polyketide compound trichodinerin and a preparation method and application thereof, and relates to the field of compound preparation and biochemical pesticide technology. The trichodinerin is a new polyketide compound, which is a metabolite of Trichoderma sp. QTS‑92 with a deposit number of CCTCC NO: M2024723, can be prepared by microbial fermentation, and has certain antibacterial activity and is non-cytotoxic. The present invention overcomes the deficiencies of the prior art, and the obtained compound can be used to prepare antibacterial agents, providing new compounds or small molecule lead compounds for the development of antibacterial agents, and also providing new drug source molecules with application value for the medical industry.

Description

Technical Field

[0001] The invention relates to the technical field of compound preparation and biochemical pesticides, and in particular to a polyketide compound trichodinerin and a preparation method and application thereof. Background Art

[0002] Finding new bactericidal and insecticidal active substances or drug precursors from endophytic fungi in plants is not only an economical and quick way to effectively create new drugs, but also a rational development and utilization of plant resources. The origin of Trichoderma microorganisms is China. Trichoderma colonies were cultured on PDA plates for 3 days, with a diameter of 55-75mm; moderate thickness; flat, velvety surface; white on the front; slightly yellow on the back; no exudate. Microorganisms are not restricted by the growing season and can be artificially cultured on a large scale. Compared with other biological resources, they will not cause ecological damage and are easy to solve the problem of drug sources. Therefore, they have unique advantages in subsequent development and research.

[0003] Polyketides are a class of organic compounds that exist in nature and are one of the many types of secondary metabolites. Existing technologies have shown that polyketides have multiple biological activities such as anti-inflammatory, anti-tumor and antibacterial. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides a polyketide compound trichodinerin and a preparation method and application thereof. The trichodinerin is a new polyketide compound with good antibacterial activity and no cytotoxicity.

[0005] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0006] A polyketide compound trichodinerin, the structural formula of the polyketide compound trichodinerin is as follows:

[0007]

[0008] The preparation method of the polyketide compound trichodinerin comprises the following steps:

[0009] (1) selecting the endophytic fungus Trichoderma sp. QTS-92 with a deposit number of CCTCC NO: M2024723 as a raw material fungus for fermentation culture to prepare a fermentation product, and extracting the fermentation product to prepare a polar solvent extract;

[0010] (2) Separating the polar solvent extract by silica gel column chromatography and reverse phase column chromatography in sequence to obtain trichodinerin, a polyketide compound.

[0011] Preferably, the fermented product is the fermentation broth and mycelium of Trichoderma sp. QTS-92.

[0012] Preferably, the method for preparing the polar solvent extract comprises the following steps:

[0013] S1-1, inoculate Trichoderma sp. QTS-92 strains onto PDA slant medium and activate them at 28°C for 5-7 days to obtain activated strains for later use;

[0014] S1-2, inoculating the activated strain into the fermentation medium and culturing at 28°C and 200 rpm for 5-7 days to obtain fermentation liquid and mycelium;

[0015] S1-3, mixing the fermentation broth with ethyl acetate in a volume ratio of 1:1 to obtain a mixed fermentation broth, mixing the mycelium with acetone in a volume ratio of 1:1 to extract, extracting and stratifying to obtain a mycelium extract, and combining the mixed fermentation broth and the mycelium extract to obtain a polar solvent extract.

[0016] Preferably, the fermentation medium in step S1-2 is cotton PDB medium, and the ingredients in the cotton PDB medium are 200 g potato, 20 g glucose, 2 g defatted cotton, and 1 L water; and the inoculation amount of the activated bacteria is 1 wt%.

[0017] Preferably, the silica gel column chromatography in step (2) comprises the following steps:

[0018] S2-1, dissolving the polar solvent extract with a dichloromethane-methanol solution with a volume ratio of 1:1;

[0019] S2-2, sequentially using petroleum ether and a dichloromethane-methanol system with a volume ratio of 100:0, 50:1, and 10:1 for elution, collecting the dichloromethane solution elution segment with a volume ratio of 50:1 to obtain a reverse phase column chromatography chromatographic liquid.

[0020] Preferably, the reverse phase column chromatography separation comprises the following steps:

[0021] The reverse phase column chromatography liquid was concentrated and dried, dissolved with methanol, separated by silica gel column, the eluent was a mixture of petroleum ether and acetone in a volume ratio of 3:1, analyzed by thin layer chromatography, and divided into 3 parts. The first part was dissolved with methanol, separated again by silica gel column, the eluent was a mixture of petroleum ether and acetone in a volume ratio of 2:1, and the polyketide compound trichodinerin was obtained.

[0022] The polyketide compound trichodinerin can be used to prepare antibacterial agents.

[0023] The present invention provides a polyketide compound trichodinerin and a preparation method and application thereof, which have the following advantages over the prior art:

[0024] The richodinerin provided by the present invention is a new polyketide compound, which is a metabolite of the endophytic fungus Trichoderma sp. QTS-92 of the genus Trichoderma and can be prepared by microbial fermentation. The preparation method has the advantages of mild culture conditions, simple and easy culture medium preparation, short fermentation time, easy large-scale production, etc., which not only meets the needs of modern environmental protection and low-carbon economy, but also has certain antibacterial activity and can be used for preparing antibacterial agents. At the same time, new compounds or small molecule lead compounds are provided, and new drug source molecules with application value are also provided for the medical industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a colony characteristic diagram of the endophytic fungi isolated in Example 1 of the present invention;

[0026] Figure 2 is the key HMBC of trichodinerin in Example 3 of the present invention, 1 H- 1 H COSY, NOESY correlation analysis results diagram;

[0027] Figure 3 is the antimicrobial active compound trichodinerin in Example 3 of the present invention 1 H-NMR spectrum results;

[0028] Figure 4 is the antimicrobial active compound trichodinerin in Example 3 of the present invention 13 C-NMR and DEPT spectrum results;

[0029] Figure 5 This is the HMBC spectrum result diagram of trichodinerin, an antimicrobial active compound in Example 3 of the present invention;

[0030] Figure 6 This is a HSQC spectrum result diagram of trichodinerin, an antimicrobial active compound in Example 3 of the present invention;

[0031] Figure 7 This is the 1H-1HCOSY spectrum result of trichodinerin, an antibacterial active compound in Example 3 of the present invention;

[0032] Figure 8 The NOESY spectrum result diagram of trichodinerin, an antimicrobial active compound in Example 3 of the present invention;

[0033] Fig. 9 This is a high-resolution mass spectrometry result diagram of trichodinerin in Example 3 of the present invention;

[0034] Fig.10 This is the electronic circular dichroism spectrum result diagram of trichodinerin in Example 3 of the present invention;

[0035] Fig.11 The UV spectrum result diagram of trichodinerin in Example 3 of the present invention;

[0036] Fig.12 This is the infrared spectrum result of trichodinerin in Example 3 of the present invention. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] The biological deposit information of the endophytic fungus QTS-92 of the genus Trichoderma used in the present invention is:

[0039] The endophytic fungus Trichoderma sp.QTS-92 of the genus Trichoderma was deposited in the China Center for Type Culture Collection on April 19, 2024. The deposit address is Wuhan University, Wuhan, China. The deposit name is Trichoderma sp.QTS-92, and the deposit number is CCTCC NO: M2024723. The viability of the culture was tested by the collection center on April 26, 2024, and the result was survival.

[0040] Embodiment 1:

[0041] The isolation and identification of the endophytic fungus Trichoderma sp. QTS-92 of the genus Trichoderma are as follows:

[0042] (1) Pretreatment

[0043] Take freshly collected Yunnan Bacillus yunnanensis (collected in Yunnan Province, immediately put into a sealed bag and stored at 4°C after sample collection; isolation of endophytic fungi was completed within 36 h after collection), remove the surface sediment, and then rinse with tap water for about 1 h;

[0044] (2) Surface disinfection

[0045] In the clean bench, soak in sodium hypochlorite solution with an effective chlorine content of 50%, soak in 75% ethanol solution for 30 seconds, rinse with sterile water 3 times, soak in 75% ethanol solution for 30 seconds, rinse with sterile water 4 times, and dry with sterile filter paper for later use;

[0046] In order to check whether the tissue surface is thoroughly disinfected, a control experiment is required. 50 μL of the sterile water used for the last wash is directly added to the separation plate, and then spread on the PDA medium with a spreading rod and cultured under the same conditions as a control group. If no colonies grow in all control groups, it proves that the surface disinfection in the above steps is thorough, thus ensuring that the isolated microorganisms are plant endophytes rather than microorganisms attached to the air or tissue surface.

[0047] (3) Isolation of endophytic fungi

[0048] Use a sterilized scalpel to cut the thoroughly disinfected cap of the blue-headed mushroom into several small sections or pieces of 0.2×0.2cm2, and implant the processed samples into the PDA culture medium plates that have been poured in advance. Each plate is divided into four areas, A, B, C, and D, and 3 to 4 sections of samples are placed in each area. Seal the culture dishes with sealing film and number them, invert them in a 28℃ constant temperature incubator, and check them once a day; if new colonies are found to grow, immediately inoculate them on new PDA culture medium plates;

[0049] (4) Purification of endophytic fungi (plate streak method)

[0050] After hyphae grow on the PDA medium plate, the grown hyphae are repeatedly streaked and separated and cultured until a pure strain is obtained.

[0051] (5) Preservation of endophytic fungi

[0052] For short-term storage of purified fungal strains, they can be directly inoculated on the slant. After the strains grow out, seal the test tubes with sealing film and store them in a refrigerator at 4°C.

[0053] (6) Identification of endophytic fungi

[0054] The endophytic fungus (tentative name QTS) isolated in step (5) grew rapidly and had uniform edges when cultured on PDA. At 28°C, it reached a diameter of 3.0 cm within three days. The surface of the colony was flat, and the conidia were dense, forming a deep conidial layer. The colony was white overall. No exudate was observed, and there was no obvious odor, such as Figure 1 shown.

[0055] Morphological characteristics and molecular identification were combined, specifically by analyzing the rRNA internal transcribed spacer (ITS) region (mycelial samples were sent to Qingke Biotechnology Co., Ltd. for extraction, amplification and sequencing), and the sequencing results were entered into GenBank (www.ncbi.nlm.nih.gov), using homologous sequences in GenBank.

[0056] The rRNA internal transcribed spacer (ITS) of the endophytic fungus Trichoderma sp. QTS-92 is as follows:

[0057] TTGGGGATTCTACCTGATCCGAGGTCAACATTTCAGAAGTTGGGTGTTTTACGGACGTGGACGCGCCGCCGCTCCCGGTGCGAGTTGTGCAAACTACTGCGCAGGAGAGGCTGCGGCGAGACCGCCACTGTATTTCGGGGCCGGGATC CCGTCTTAGGGGTTCCCGATCCCCAACGCCGGACCCCCGGAGGGGTTCGAGGGTTGAAATGACGCTCGGACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACA TTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTTGAATTTTTGCTCAGAGCTGTAAGAAATAACGTCCGCGAGGGGACTACAGAAAGAGTTTGGTTGGTCCCTCC GGCGGGCGCCTGGTTCCGGGGCTGCGACGCACCCGGGGCGTGACCCCGCCGAGGCAACAGTTTGGTATGGTTCACATTGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTCACCCCTACGGAGGGGATTTTTTTGGAG

[0058] Depend on Figure 1 The results showed that the similarity between the endophytic fungus QTS-92 and Trichoderma sp. in NCBI reached 99.65%, thereby confirming that the endophytic fungus isolated in the present invention is an endophytic fungus of the genus Trichoderma sp. QTS-92, and it was named and biologically preserved with the preservation number of CCTCC NO: M2024723.

[0059] Embodiment 2:

[0060] Preparation method of trichodinerin:

[0061] (1) Activation of strains: The endophytic fungus Trichoderma sp. QTS-92 isolated in Example 1 was inoculated onto a PDA slant culture medium, cultured at 28° C. for 7 days, and stored in a refrigerator at 4° C. for later use.

[0062] (2) Preparation of fermentation medium: Add 200 g of clean potatoes, 20 g of glucose, and 2 g of defatted cotton to 1 L of water, boil the mixture, and seal and sterilize the mixture in a device to prepare cotton PDB medium. Sterilize the mixture at 121°C for 30 min, and cool the mixture to obtain the fermentation medium.

[0063] (3) The activated Trichoderma endophytic fungi of step (1) are inoculated into the fermentation medium prepared in step 2 at an inoculum amount of 1 wt %, and the medium is covered and cultured at 28° C. and 200 rpm for 7 days to obtain a Trichoderma fungal fermentation product.

[0064] (4) The volume of the fermentation liquid prepared in step (3) was mixed with ethyl acetate in a volume ratio of 1:1, and the volume of the mycelium was mixed with acetone in a volume ratio of 1:1 for extraction. The extraction layers were separated, and the fermentation liquid and mycelium extract were combined to obtain 38.2 g of crude fermentation extract.

[0065] (5) 38.2 g of the crude extract of Trichoderma fermentation was dissolved in 10 mL of a dichloromethane-methanol solution with a volume ratio of 1:1, mixed with 45.8 g of 200-300 mesh silica gel, concentrated under reduced pressure to remove the solvent, and loaded into a column; the mass ratio of the crude extract of fermentation to the silica gel is preferably 1:1.2, and the solvent in the obtained mixture is removed by concentrated under reduced pressure.

[0066] Gradient elution was performed with petroleum ether, dichloromethane-methanol volume ratio of 100:0, 50:1 and 10:1 in sequence; the flow rate of gradient elution was preferably 20 mL / min;

[0067] The dichloromethane elution portion with a volume ratio of 50:1 was concentrated and dried by spin drying, and eluted by reverse phase column chromatography, and the elution flow rate was preferably 1.0 mL / min. The diameter of the pre-packed column for reverse phase column chromatography separation of the present invention was preferably 8.0 cm, and the column length was preferably 0.7 m. The eluate was obtained and concentrated, and analyzed by TLC into 3 parts. The first part was dissolved in methanol, separated by a silica gel column (eluent was petroleum ether: acetone = 3: 1), and separated again by a silica gel column (eluent was petroleum ether: acetone = 2: 1) to obtain a compound trichodinerin (3.3 mg).

[0068] Embodiment 3:

[0069] The structure of the compound trichodinerin prepared in Example 2 was identified:

[0070] The compound trichodinerin prepared in Example 2 was structurally identified by 1D / 2D NMR (one-dimensional nuclear magnetic resonance spectroscopy and two-dimensional nuclear magnetic resonance spectroscopy) and HR-ESI-MS (high-resolution electrospray ionization mass spectrometry). The results are as follows: Figure 3 shown.

[0071] The compound trichodinerin is a black amorphous powder. The quasi-molecular ion peak of the compound is HR-ESI-MS (m / z 339.2146 [M+Na] +, calcd. for C 17 H 32 O5Na:339.2147), indicating that its molecular formula is C 17 H 32 O5, unsaturation is 2.

[0072] The H NMR data of trichodinerin showed a methoxy signal at δH 3.58 (s) and a methyl signal at δH 0.95 (d, J = 6.8 Hz). The 13C NMR data (Table 1) showed 1 methyl, 9 methylene, 5 methine and 1 quaternary carbon. 1 H and 13 C NMR data showed that the compound was presumed to be trichodinerin. 1 H- 1 The structure was also confirmed by H COSY correlation showing H-6 / H-1 / H-2, H-6 / H-7 / H-8, H-10 / H-11, H-12 / H-13, HMBC correlation showing H-3 with C-5; H-6 with C-4; H-7 with C-5; H-8 with C-6 and C-10; H-12 with C-10; H-13 with C-11; H-16 with C-14; H-17 with C-5. The relative configuration was determined by NOESY correlation showing H-1 / H-4 / H-6, H-6 / H-8β / H-10.

[0073] The structural formula of trichodinerin is available as:

[0074]

[0075] Table 1 Trichodinerin 1 H(400MHz) and 13 C (100 MHz) NMR data

[0076]

[0077]

[0078] Embodiment 4:

[0079] Verification of the antibacterial activity of trichodinerin:

[0080] Antimicrobial Activity:

[0081] Weigh an appropriate amount of the compound trichodinerin and the positive control nystatin in a 1.5 mL EP tube, dissolve the sample with DMSO, and finally make the concentration of each sample 10.24 mg / mL. Using the two-fold dilution method, dilute each sample concentration to 512, 256, 128, 64, 32, 16, 8, 4, 2, 1 μg / mL on a 96-well plate, corresponding to wells 1-10 on the 96-well plate, and add 10 μL of diluted Fusarium asiaticum and Alternaria tenuissim bacterial solution to each well. According to the above operation, two parallel experiments were carried out, and the specific results are shown in Table 2 below:

[0082] Table 2 Screening of trichodinerin antibacterial activity (MICs at μg / mL)

[0083] sample Fusariumasiaticum Alternariatenuissim trichodinerin 4 64 Nystatin 1 1

[0084] From the above results, it can be seen that trichodinerin has certain antibacterial activity and is non-cytotoxic. The method of producing trichodinerin in large quantities and simply based on microbial fermentation has the advantages of mild culture conditions, simple and easy culture medium preparation, short fermentation time, and easy large-scale production.

[0085] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A polyketide compound trichodinerin, characterized in that The structural formula of the polyketide compound trichodinerin is as follows: 。 2. A method for preparing the polyketide compound trichodinerin as claimed in claim 1, characterized in that: The preparation method comprises the following steps: (1) Select the endophytic fungus Trichoderma with the deposit number of CCTCC NO: M2024723 Trichoderma sp. QTS-92 was used as the raw material for fermentation culture to prepare a fermentation product, and the fermentation product was extracted to prepare a polar solvent extract; The preparation method of the polar solvent extract comprises the following steps: S1-1, inoculate Trichoderma sp. QTS-92 strains onto PDA slant medium and activate them at 28°C for 5-7 days to obtain activated strains for later use; S1-2, inoculating the activated strain into the fermentation medium and culturing at 28°C and 200 rpm for 5-7 days to obtain fermentation liquid and mycelium; S1-3, mixing the fermentation broth with ethyl acetate in a volume ratio of 1:1 to obtain a mixed fermentation broth, mixing the mycelium with acetone in a volume ratio of 1:1 to extract, extracting and stratifying to obtain a mycelium extract, and combining the mixed fermentation broth and the mycelium extract to obtain a polar solvent extract; (2) subjecting the polar solvent extract to silica gel column chromatography and reverse phase column chromatography to obtain trichodinerin, a polyketide compound; The silica gel column chromatography comprises the following steps: S2-1, dissolving the polar solvent extract with a dichloromethane-methanol solution with a volume ratio of 1:1; S2-2, sequentially eluting with petroleum ether and a dichloromethane-methanol system with a volume ratio of 100:0, 50:1, and 10:1, collecting the dichloromethane-methanol elution segment with a volume ratio of 50:1 to obtain a reverse phase column chromatography liquid; The reverse phase column chromatography separation comprises the following steps: The reverse phase column chromatography liquid is concentrated and spin-dried, dissolved with methanol, separated by silica gel column, the eluent is a mixture of petroleum ether and acetone in a volume ratio of 3:1, and analyzed by thin layer chromatography, and divided into 3 parts. The first part is dissolved with methanol, separated by silica gel column, the eluent is a mixture of petroleum ether and acetone in a volume ratio of 3:1, and separated by silica gel column again, the eluent is a mixture of petroleum ether and acetone in a volume ratio of 2:1, to obtain the polyketide compound trichodinerin.

3. The preparation method according to claim 2, characterized in that: The fermented product is Trichoderma sp. QTS-92 fermentation broth and mycelium.

4. The preparation method according to claim 2, characterized in that: In step S1-2, the fermentation medium is cotton PDB medium, and the components of the cotton PDB medium are 200 g potato, 20 g glucose, 2 g defatted cotton, and 1 L water; and the inoculation amount of the activated bacteria is 1 wt%.

5. A use of the polyketide compound trichodinerin as claimed in claim 1 in the preparation of an antibacterial agent, wherein the bacterium is Fusarium asiatica ( Fusarium asiaticum ) or Alternaria tenuissima ( Alternaria tenuissim ).

Images