qPCR kit for detecting E1A residual DNA

Abstract

The present invention belongs to the field of biotechnology and molecular diagnosis, and particularly relates to a qPCR kit for detecting residual E1A DNA. Specifically, the present disclosure provides a specific primer and probe combination for qPCR reaction for detecting residual E1A DNA in a sample. The detection kit provided by the present application has good specificity, accuracy and precision. While detecting whether E1A DNA exists in the test sample, the length of the existing E1A fragment can also be analyzed. The detection range of E1A DNA in the test sample is 5E+6~5E+1 copies / μL, and the quantitative limit is 50 copies / μL.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and molecular diagnosis, and particularly relates to a qPCR kit for detecting E1A residual DNA. Background Art

[0002] In recent years, cell and gene therapy (CGT) has developed rapidly, and a large number of CGT products have entered the clinical trial stage. The main forms of CGT products include gene therapy vectors, oncolytic virus products, cell products (eg. CAR-T, NK cells), etc. The treatment strategies include in vivo and in vitro. Commonly used vectors include non-viral polymer micelles, liposome particles, plasmids, etc., as well as viral lentivirus (LV), adenovirus (AdV), adeno-associated virus (AAV), retrovirus, etc. It is known that animal cell-based expression platforms can produce complex biological molecules, such as recombinant proteins and viral vectors. Among them, most therapeutic biomolecule drugs are produced in Chinese hamster ovary (CHO) cells. However, compared with human HEK293 cells, mouse cells lack the human cell post-translational modification system, so there are differences in the proteins expressed by the human system. Therefore, some recombinant proteins are better produced in HEK293, and most therapeutic viral vectors are also produced in HEK293.

[0003] In the viral vector production process, HEK293 cell lines will inevitably produce not only residual host cell DNA and RNA impurities, but also residual SV40 large T antigen (LTA) DNA, E1A and E1B DNA, etc. These impurities will not only reduce the effectiveness of viral vector-related drugs, but also pose risks such as potential toxicity of transgenics, and may also bring safety issues such as infectiousness or tumorigenicity.

[0004] However, the amount of residual DNA in the sample is generally small, and the detection limit is high and the detection accuracy is poor when using traditional methods for analysis and detection. PCR is a chain amplification technology. As the PCR reaction proceeds, the PCR reaction products continue to accumulate, and the detectable fluorescent signal will become stronger and stronger. The content of the target is quantitatively detected through the gradient change of fluorescence intensity. However, the operation steps of qPCR reaction are cumbersome, and the different operating methods between operators will lead to large differences in test results, affecting the accuracy of the test.

[0005] Therefore, it is urgent to develop a new E1A residual DNA detection kit and method. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the purpose of the present application is to provide a qPCR kit for detecting E1A residual DNA.

[0007] In one aspect, the present invention provides a specific primer and probe combination for qPCR reaction for detecting E1A residual DNA in a sample, wherein the specific primer and probe combination is selected from one or more of the following combinations:

[0008] (1) a forward primer as shown in SEQ ID NO.1, a reverse primer as shown in SEQ ID NO.4 and a probe as shown in SEQ ID NO.7;

[0009] (2) a forward primer as shown in SEQ ID NO.2, a reverse primer as shown in SEQ ID NO.5 and a probe as shown in SEQ ID NO.8;

[0010] (3) A combination of a forward primer shown in SEQ ID NO.3, a reverse primer shown in SEQ ID NO.6 and a probe shown in SEQ ID NO.9.

[0011] In some embodiments, the primer and probe combination comprises a forward primer as shown in SEQ ID NO.1, a reverse primer as shown in SEQ ID NO.4, and a probe combination as shown in SEQ ID NO.7.

[0012] In some embodiments, the primer and probe combination comprises a forward primer as shown in SEQ ID NO.2, a reverse primer as shown in SEQ ID NO.5, and a probe combination as shown in SEQ ID NO.8.

[0013] In some embodiments, the primers and probes comprise a forward primer as shown in SEQ ID NO.3, a reverse primer as shown in SEQ ID NO.6, and a probe as shown in SEQ ID NO.9.

[0014] In some embodiments, the primer and probe combination comprises (1) a forward primer as shown in SEQ ID NO.1, a reverse primer as shown in SEQ ID NO.4, and a probe combination as shown in SEQ ID NO.7; (2) a forward primer as shown in SEQ ID NO.2, a reverse primer as shown in SEQ ID NO.5, and a probe combination as shown in SEQ ID NO.8; and (3) a forward primer as shown in SEQ ID NO.3, a reverse primer as shown in SEQ ID NO.6, and a probe combination as shown in SEQ ID NO.9. In some embodiments, based on the 100 bp fragment ratio as 100%, after fragment size analysis, the 300 bp fragment ratio in the AAV stock solution sample is 84%, and the 500 bp fragment ratio is 61%.

[0015] In some embodiments, the E1A residual DNA is the E1A gene of HEK293 cells, and its nucleotide sequence is shown in SEQ ID NO.10.

[0016] In some embodiments, the size of the amplification product of the primers and probe is 124 bp.

[0017] In some embodiments, the sample is selected from lentivirus, adenovirus or retrovirus packaged by HEK293 cells.

[0018] In another aspect, the present invention provides a qPCR reaction kit for detecting residual E1A DNA in a sample, wherein the kit comprises the aforementioned specific primer and probe combination.

[0019] In some embodiments, the E1A residual DNA is the E1A gene of HEK293 cells, and its nucleotide sequence is shown in SEQ ID NO.10.

[0020] In some embodiments, the kit includes an E1A DNA standard. In some embodiments, the kit also includes a qPCR reaction solution. In some embodiments, the qPCR reaction solution includes: a dNTP mixture, an endonuclease RNase H, a hot start PCR enzyme, Mg 2+ solution and nuclease-free water.

[0021] In some embodiments, the qPCR reaction solution is Premix Ex Taq reagent, which is a commercial reagent of Takara, the full name is Premix Ex Taq (Probe qPCR), the product number is RR390A, and contains TaKaRa Ex Taq HS, dNTP mixture, Mg 2+ , Tli RNaseH, etc.

[0022] In some embodiments, the specific primer and probe combination or kit has a detection range of 5E+6 to 5E+1 copies / μL for E1A residual DNA.

[0023] In some embodiments, the specific primer and probe combination or kit has a minimum quantification limit of 50 copies / μL for E1A residual DNA.

[0024] In some embodiments, the sample is selected from lentivirus, adenovirus or retrovirus packaged by HEK293 cells.

[0025] On the other hand, the present invention provides a qPCR reaction method for detecting E1A residual DNA in a sample, characterized in that the method comprises the step of using the aforementioned specific primer and probe combination or the aforementioned kit.

[0026] In some embodiments, the method comprises the following steps:

[0027] a) preparing a series of standard solutions of E1A DNA;

[0028] b) preparing sample solution;

[0029] c) Prepare spiked sample solution;

[0030] d) preparing a qPCR mixed solution, which includes the step of mixing the components of the aforementioned forward primer sequence, reverse primer sequence and probe sequence with a qPCR reaction solution;

[0031] e) Add samples and perform qPCR detection;

[0032] f) Calculate and analyze the results.

[0033] In some embodiments, the method comprises the following steps:

[0034] a) preparing a series of standard solutions of E1A DNA;

[0035] Take 10 μL of E1A DNA standard, add 562 μL of NFW and mix well, mark it as ST0, and dilute it in a 1:9 volume ratio to prepare standard solutions of subsequent concentrations, named ST1-ST6;

[0036] b) preparing sample solution;

[0037] Vortex the sample to mix well, dilute the sample to be tested to an appropriate concentration with NFW, and set aside;

[0038] c) Prepare spiked sample solution;

[0039] Take 50 μL of diluted sample, add 10 μL of ST4, and mix well;

[0040] d) preparing a qPCR mixed solution, which includes the step of mixing the components of the aforementioned forward primer sequence, reverse primer sequence and probe sequence with a qPCR reaction solution;

[0041] e) Add samples and perform qPCR detection;

[0042] f) Calculate and analyze the results.

[0043] On the other hand, the present invention provides a use of the aforementioned specific primer and probe combination, the aforementioned kit or the aforementioned method for detecting and quantitatively analyzing E1A residual DNA in intermediates, semi-finished products and finished products of vaccines, recombinant proteins, antibodies, cells and gene drugs.

[0044] The beneficial technical effects of the present invention are at least as follows:

[0045] The present invention discloses a specific primer and probe combination and a kit thereof, which are used to detect residual E1A DNA in a sample. By designing primers and probes for different binding sites of E1A DNA gene fragments, the residual E1A DNA in an unknown sample is quantified by a standard curve using a qPCR method. When a linearized plasmid containing an extracted and purified complete E1A gene fragment is used as a standard, and a forward primer shown in SEQ ID NO.1, a reverse primer shown in SEQ ID NO.4, and a probe combination shown in SEQ ID NO.7 are used, the size of the amplified product is 124 bp. Therefore, the kit can detect whether E1A DNA exists in a sample and analyze the length of the existing E1A fragment. In addition, the detection kit provided by the present invention has good specificity, linearity, accuracy, and precision. The detection range of E1A DNA in the detection sample is 5E+6~5E+1 copies / μL, and the quantitative limit is 50 copies / μL. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Primer distribution and design diagram are shown. DETAILED DESCRIPTION

[0047] I. Definition

[0048] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. It should be understood that the present invention is not limited to specific methods, reagents, compounds, compositions or biosystems, and certainly the above can be changed. It should also be understood that the terms used in this application are only for the purpose of describing specific embodiments and are not intended to be limited.

[0049] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0050] As used herein, the term "polymerase chain reaction" (PCR) refers to a laboratory technique that allows millions to billions of copies of a specific DNA sequence to be rapidly replicated in vitro through temperature cycling. This technique is a cornerstone of the field of molecular biology and is widely used in medical diagnosis, forensics, and biological research.

[0051] As used herein, the term "real-time Quantitative PCR" (qPCR) refers to an advanced form of PCR that integrates the function of real-time monitoring of fluorescent signals to quantitatively detect DNA during PCR amplification. This method can not only provide qualitative results, but also provide quantitative information about the starting amount of DNA, and is an indispensable tool in modern biotechnology and clinical diagnosis. The qPCR reaction solution carries a probe, which is a single-stranded oligonucleotide that is complementary to the target DNA. There is a reporter group and a quencher group at both ends of the probe. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group, and no fluorescent signal is detected; when PCR amplification is performed, the polymerase in the qPCR reaction solution will enzymatically degrade the probe, separate the reporter group from the quencher group, and thus detect the fluorescent signal of the reporter group in real time. For each DNA chain synthesized, a probe will be cut and a unit of fluorescent signal will be generated, and the signal intensity is proportional to the probe on the DNA chain.

[0052] As used herein, the term "standard" refers to a substance with known properties (e.g., concentration, purity) used as a benchmark for comparison in an experiment. In qPCR experiments, standards are often used to create a standard curve for calibrating instruments and ensuring the accuracy of experimental results.

[0053] As used herein, the term "spiked sample" means that a certain amount of target compound is added to the sample, after which a certain concentration of the target compound can be detected. The target compound concentration minus the blank (the concentration of the target compound detected in the sample without spike) is the sample spike recovery rate.

[0054] As used herein, the term "recovery" represents the ratio between the amount of target analyte extracted and detected from a sample and the known amount actually added. It is an important indicator for evaluating the extraction efficiency and accuracy of quantitative analytical methods. Ideally, a recovery close to 100% indicates that the analytical method has a high accuracy.

[0055] As used in this article, the term "coefficient of variation" (%CV) refers to the ratio of the standard deviation to the sample mean, which is used to measure the repeatability or consistency of experimental results. A lower %CV value indicates that the difference between experimental data is small and the repeatability is good. It is an important parameter for evaluating the stability and reliability of experimental operations.

[0056] As used herein, the term "amplification efficiency" refers to the efficiency of the target DNA molecule to replicate in each cycle during the qPCR process. The ideal amplification efficiency is close to 100%, indicating that the amount of DNA doubles after each PCR cycle. The amplification efficiency is an important indicator for evaluating whether the qPCR reaction settings are optimized.

[0057] As used herein, the term "specificity" refers to the ability of primers and probes to bind and amplify only target DNA sequences in qPCR technology, but not to non-target sequences. High specificity ensures the purity of the amplified product, thereby improving the accuracy of the test results.

[0058] As used herein, the term "sensitivity" refers to the ability of a detection method to detect low-abundance target DNA. Highly sensitive qPCR methods are able to detect extremely small amounts of DNA, which is critical for early pathogen detection and low-level gene expression analysis.

[0059] As used herein, the term "stability" refers to the ability of primers, probes, and other reaction components to maintain their performance over multiple experiments or after long-term storage. Stability directly affects the repeatability and reliability of long-term experiments.

[0060] As used herein, the term "limit of detection (LOD)" is also called the detection limit, which refers to the corresponding amount of 3 times the instrument background signal generated by the matrix blank, or the average value of the background signal generated by the matrix blank plus 3 times the mean standard deviation. It is one of the important indicators of the sensitivity of the method (method detection limit MDL) and the instrument (instrument detection limit IDL). In the test kit, it refers to the minimum concentration or minimum amount of the substance to be tested that can be detected from the sample within a given reliability. The so-called detection refers to qualitative detection, that is, it is determined that the substance to be determined exists in the sample at a concentration higher than the blank.

[0061] As used herein, the term "limit of quantitation (LOQ)" refers to the lowest amount of an analyte in a sample that can be quantitatively determined with a certain degree of accuracy. The LOQ reflects whether the analytical method has sensitive quantitative detection capabilities.

[0062] As used herein, the English abbreviations in the application documents and their corresponding Chinese meanings are shown in Table 1 below.

[0063] Table 1 Abbreviations

[0064]

[0065] II. Examples

[0066] The present disclosure is described in more detail below with reference to specific examples, however, the examples are for illustrative purposes only and have no limiting effect on the present disclosure. The reagents and biological materials described in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0067] The information of the instruments and equipment used in the examples is shown in Table 2 below:

[0068] Table 2 Main instrument and equipment information

[0069]

[0070] Reagent information is as follows Table 3:

[0071] Table 3 Reagent information

[0072]

[0073] The information of the standards used in the experiment is as follows: E1A DNA standard, concentration: 11 ng / μL, copy concentration: 2.86E+9 copies / μL, storage conditions: -70±10℃;

[0074] See Table 4 for consumables information:

[0075] Table 4 Consumables information

[0076]

[0077] The specific experimental steps during the detection process are as follows:

[0078] (1) Preparation of standard solution

[0079] Take 10 μL of E1A DNA standard, add it to 562 μL of NFW, mix well, and mark it as ST0 (5E+7 copies / μL). Then prepare each group of standard solutions according to Table 5.

[0080] Table 5 Preparation of standard solutions

[0081]

[0082] (2) Preparation of test samples

[0083] After the sample is fully thawed, vortex to mix. Dilute the sample to be tested to an appropriate concentration with NFW (the dilution factor can be adjusted according to the residual amount of E1A DNA in the sample to be tested) and use it as the test sample.

[0084] (3) Preparation of spiked samples (ERC)

[0085] Take 50 μL of the diluted test sample, add 10 μL of ST4 (5E+3 copies / μL), mix well by pipetting, and the theoretical amount is 5E+4 copies.

[0086] (4) Preparation of qPCR mixed solution

[0087] Prepare the qPCR mixed solution according to Table 6. The solution should be prepared according to the number of (required reaction wells + 2) to avoid insufficient solution. After preparation, invert the solution at least 15 times to mix well and dispense into a qPCR 96-well plate, 45 µL / well.

[0088] Table 6 qPCR Mix Preparation

[0089]

[0090] (5) Add sample

[0091] According to Table 7, add the standard solution, test sample, spiked sample ERC and NTC (NFW) into the 96-well plate filled with qPCRMix, add 3 replicates to each well, 5 µL / well.

[0092] Table 7 Sample addition diagram

[0093]

[0094] (6) qPCR detection

[0095] Turn on the Bio-Rad qPCR instrument and software.

[0096] The instrument was set up for qPCR as follows: 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, 40 cycles; the sample volume was 50 µL.

[0097] Click Next→Create New Plate, click User Preferences, set Plate Type to BRWhite, and check FAM in the Fluorophores option.

[0098] Standard sample settings: Select the standard sample area, set Sample Type to Standard, click TechnicalReplicates, set Replicate Size to 3, set Starting Replicate to 1, and click Apply; click Dilution Series, set Starting Concentration to 5E+6, Replicates from 1 to 6, and set Dilution Factor to 10.

[0099] Sample settings: Select the remaining blank area, set the Sample Type of the sample to be tested to Unknown, set the NTC sample to NTC, set Replicate Size to 3, and set Starting Replicate to 1.

[0100] Click OK to save the Plate File; click Next, and click Run.

[0101] (7) Calculation of results

[0102] The calculation formula of the test plasmid residue is as follows:

[0103] E1A DNA residual amount (copies / μL) = reaction well reading value (copies / μL) × test sample dilution multiple

[0104] The formula for calculating the spike recovery is as follows:

[0105]

[0106] In addition, the method for determining the validity of the data is shown in Table 8:

[0107] Table 8 Data validity determination

[0108]

[0109] The specific experiments are shown in Examples 1-9.

[0110] Example 1: Detection kit for detecting E1A residual DNA

[0111] The inventors have developed a kit for detecting E1A residual DNA, which can be used to detect E1A residual DNA in AAV products fermented by HEK293 cells. It mainly includes a combination of specific primers and probes, and the specific information is shown in Table 9 below. The target DNA of the primers and probes is the E1A gene of HEK293 cells, and its nucleotide sequence is shown in SEQ ID NO.10.

[0112] The sequence of SEQ ID NO.10 is as follows:

[0113] GAATTCATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGAAATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATAATCTTCCACCTCCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTATGATTTAGACGTGACGGCCCCCGAAGATCCCAACGAGGAGGCGGTTTCGCAGATTTTTCCCGACTCTGTAATGTTGGCGGTGCAGGAAGGGATTGACTTACTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCACCTTTCCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAACCTTGTACCGGAGGTGATCGATCTTACCTGCCACGAGGCTGGCTTTCCACCCAGTGACGACGAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTGGAGCACCCCGGGCACGGTTGCAGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGCTTTGCTATATGAGGACCTGTGGCATGTTTGTCTACAGTCCTGTGTCTGAACCTGAGCCTGAGCCCGAGCCAGAACCGGAGCCTGCAAGACCTACCCGCCGTCCTAAAATGGCGCCTGCTATCCTGAGACGCCCGACATCACCTGTGTCTAGAGAATGCAATAGTAGTACGGATAGCTGTGACTCCGGTCCTTCTAACACACCTCCTGAGATACACCCGGTGGTCCCGCTGTGCCCCATTAAACCAGTTGCCGTGAGAGTTGGTGGGCGTCGCCAGGCTGTGGAATGTATCGAGGACTTGCTTAACGAGCCTGGGCAACCTTTGGACTTGAGCTGTAAACGCCCCAGGCCATAAGGATCC

[0114] Table 9 Information of Probes and Primers

[0115]

[0116] The primer distribution and design diagram are shown in Figure 1 The present invention designs a specific primer and probe combination for detecting E1A residual DNA, wherein the nucleotide sequence of the forward primer is shown in SRQ ID NO.1, and the sequence is located at the 693rd to 712th nucleotides of E1A DNA, the nucleotide sequence of the reverse primer is shown in SRQ ID NO.4, and the sequence is located at the 797th to 816th nucleotides of E1A DNA, and the nucleotide sequence of the probe is shown in SRQ ID NO.7, and the sequence is located at the 765th to 784th nucleotides of E1A DNA.

[0117] Example 2: Specificity Verification

[0118] To ensure that the E1A residual DNA detection kit can specifically detect residual E1A in a sample without cross-reacting with other similar biomolecules, this example verifies its specificity.

[0119] The experimental process is as follows: NFW, E. coli DNA quantitative reference, and linearized plasmid standard (without E1A gene sequence) are taken as specific samples and tested once using the aforementioned kit. The preparation of the qPCR mixed solution is shown in Table 6.

[0120] The acceptance criteria are: when the Ct values ​​of NFW, E. coli DNA quantitative reference, and linearized plasmid standard are >ST6 Ct value or N / A, and the spike recovery rate is between 50% and 150%, it indicates that the specificity of the detection kit is good.

[0121] The experimental results are shown in Table 10.

[0122] Table 10 Test results

[0123]

[0124] From the results in Table 10, it can be seen that the Ct values ​​of NFW, E. coli DNA quantitative reference, and linearized plasmid standard are all N / A, and the spiked recoveries are between 92% and 96%, which meet the acceptance criteria and have good specificity.

[0125] Example 3: Detection range verification

[0126] The accuracy of the qPCR method at different concentration levels was determined by verifying the recovery rate of the diluted samples of E1A DNA standard within a certain concentration range.

[0127] The experimental process is as follows: take the E1A DNA standard, dilute it with NFW to 5E+6 copies / μL, 5E+5 copies / μL, 5E+4 copies / μL, 5E+3 copies / μL, 5E+2 copies / μL, 5E+1 copies / μL, 5E+0 copies / μL as the range sample, test 3 replicates for each sample, and calculate the recovery rate. The results with a recovery rate between 70% and 130% are taken as the range concentration. The preparation of the qPCR mixed solution is shown in Table 6.

[0128] The test results are shown in Table 11.

[0129] Table 11 Test results

[0130]

[0131] As shown in Table 11, the recoveries of Range-1 to Range-6 were between 91% and 113%, all meeting the acceptance criteria, and it was determined that the detection range of the aforementioned kit was 5E+6 copies / μL to 5E+1 copies / μL.

[0132] Example 4: Quantitation Limit Verification

[0133] In this example, the limit of quantitation (LOQ) of the detection kit, ie, the lowest concentration of E1A DNA that can be accurately detected, was further verified.

[0134] The experimental process is as follows: dilute the E1A DNA standard with NFW, prepare 8 LOQ samples in parallel (5E+1 copies / μL), test 3 replicates for each, and calculate the detection value, %CV value and recovery rate of each LOQ sample based on the qPCR results. When the CV (%) of the 8 LOQ samples is ≤30% and the recovery rate of each LOQ sample is between 70% and 130%, its concentration can be used as the limit of quantification. The preparation of the qPCR mixed solution is shown in Table 6.

[0135] The test results are shown in Table 12.

[0136] Table 12 Test results

[0137]

[0138] From the test results in Table 12, it can be seen that the %CV of the 8 LOQ samples is 4%, and the recovery rate of each LOQ sample is between 93% and 105%, which meets the acceptance criteria, and the limit of quantification is 50 copies / μL.

[0139] Example 5: Accuracy Verification

[0140] The performance of the detection kit on samples with different spike levels was evaluated by the recovery rate of the spiked samples, and the accuracy of the qPCR detection kit was verified.

[0141] The experimental process is as follows: dilute the AAV stock solution sample 4 times with NFW, mark it as Accuracy-S, and prepare the spiked accuracy sample according to Table 13. When the recovery rate of high, medium, and low spiked samples is between 50% and 150%, the accuracy is acceptable. Among them, the preparation of qPCR mixed solution is shown in Table 6.

[0142] Table 13: Accuracy of spiked samples

[0143]

[0144] The experimental results are shown in Table 14.

[0145] Table 14 Test results

[0146]

[0147] From the experimental results in Table 14, it can be seen that the recoveries of high, medium and low spiked samples of AAV stock solution were 119%, 122% and 114%, respectively, all between 50% and 150%, meeting the acceptance criteria.

[0148] Example 6: Repeatability Verification

[0149] The repeatability of the AAV stock solution samples was verified by qPCR technology, that is, the consistency of the results obtained by the kit when continuously measuring the same sample under the same experimental conditions.

[0150] The experimental process is as follows: take the AAV stock solution sample, prepare 6 test samples and 6 spiked samples in parallel, and perform one test using the aforementioned kit and method. When the CV (%) of the 6 parallel test samples and spiked samples is ≤30%, the repeatability is acceptable. The preparation of the qPCR mixed solution is shown in Table 6.

[0151] The experimental results are shown in Table 15.

[0152] Table 15 Test results

[0153]

[0154] From the test results in Table 15, it can be seen that the %CV of the 6 AAV stock samples is 6%, and the %CV of the 6 spiked samples is 8%, both of which meet the acceptance criteria.

[0155] Example 7: Intermediate Precision Verification

[0156] Verify the intermediate precision of the aforementioned kit, that is, the consistency between repeated experiments under different experimental conditions.

[0157] The experimental process is as follows: the experimenter takes the samples for repeatability verification on different days, prepares 6 test samples and 6 spiked samples in parallel, and conducts one test. When the %CV of the 6 parallel test samples and spiked samples is ≤30%, and the %CV of the 12 test samples and spiked samples for repeatability is ≤30%, the intermediate precision is acceptable. The preparation of the qPCR mixed solution is shown in Table 6.

[0158] The experimental results are shown in Table 16.

[0159] Table 16 Test results

[0160]

[0161] From the test results in Table 16, it can be seen that the %CV of the 6 AAV stock samples and spiked samples were 7% and 10%, respectively, and the %CV of the 12 test samples and spiked samples for repeatability were 7% and 11%, respectively, both less than 30%, meeting the acceptance criteria.

[0162] Example 8: Linearity Verification

[0163] In order to further determine whether the aforementioned kit can accurately measure samples of different concentrations within a certain range, this example performs a linear verification on it. 2 The linearity of the method was determined by the value and slope. The preparation of the qPCR mixed solution is shown in Table 6.

[0164] Experimental method: Statistical repeatability, intermediate precision, range, and standard curve data in the quantitative limit experiment. When the standard curve R2 ≥ 0.98 and the slope is between -3.10 and -3.60, it indicates that its linearity is good.

[0165] The statistical results are shown in Table 17.

[0166] Table 17 Statistical results

[0167]

[0168] From the statistical results in Table 17, we can see that the standard curve R 2 All of them were greater than 0.98, and the slopes were between -3.10 and -3.60, meeting the acceptance criteria.

[0169] Example 9: Analysis of the size of residual E1A DNA fragments

[0170] The experimental process is as follows: repetitive AAV stock samples were taken, and F2-E1A 300bp, R2-E1A 300bp, P2-E1A 300bp and F1-E1A 500bp, R1-E1A 500bp, P1-E1A 500bp were used to amplify 300bp fragments and 500bp fragments in the AAV stock samples, respectively, and compared with the 100bp fragment. The primer information is shown in Table 3.

[0171] The test results are shown in Table 18.

[0172] Table 18 Test results

[0173]

[0174] As can be seen from Table 18, taking the 100bp fragment as 100%, the 300bp fragment accounts for 84% and the 500bp fragment accounts for 61% in the AAV stock solution sample.

[0175] In summary, the detection kit provided in this application has good specificity, linearity, accuracy and precision. The detection range of E1A DNA in the test sample is 5E+6~5E+1 copies / μL, and the quantitative limit is 50 copies / μL. At the same time, according to fragment size analysis, the 300bp fragment accounted for 84% of the AAV stock sample, and the 500bp fragment accounted for 61%.

[0176] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0177] The above-mentioned embodiments only express several implementation methods of the present disclosure, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present disclosure, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the patent of the present disclosure shall be subject to the attached claims.

Claims

1. A specific primer and probe combination for qPCR reaction for detecting E1A residual DNA in a sample, wherein: The specific primer and probe combination is: (1) a forward primer as shown in SEQ ID NO.1, a reverse primer as shown in SEQ ID NO.4 and a probe as shown in SEQ ID NO.7; (2) a forward primer as shown in SEQ ID NO.2, a reverse primer as shown in SEQ ID NO.5 and a probe as shown in SEQ ID NO.8; (3) a forward primer as shown in SEQ ID NO.3, a reverse primer as shown in SEQ ID NO.6 and a probe as shown in SEQ ID NO.9; The E1A residual DNA is the E1A gene of HEK293 cells, and its nucleotide sequence is shown in SEQ ID NO.

10.

2. The specific primer and probe combination according to claim 1, wherein: The size of the amplified product of the combination of the forward primer shown in SEQ ID NO.1, the reverse primer shown in SEQ ID NO.4 and the probe shown in SEQ ID NO.7 in the specific primer and probe combination is 124 bp.

3. The specific primer and probe combination according to claim 1, wherein: The sample is selected from lentivirus, adenovirus or retrovirus packaged by HEK293 cells.

4. A qPCR reaction kit for detecting E1A residual DNA in a sample, characterized in that: The kit comprises the specific primer and probe combination according to any one of claims 1 to 3.

5. The kit according to claim 4, wherein The kit also includes an E1A DNA standard and a qPCR reaction solution.

6. The kit according to claim 5, wherein The qPCR reaction solution includes: dNTP mixed solution, nuclease RNase H, hot start PCR enzyme, Mg 2+ solution and nuclease-free water.

7. The kit according to claim 4, wherein The detection range of the kit for E1A residual DNA is 5E+6~5E+1 copies / μL.

8. The kit according to claim 4, wherein The minimum quantitative limit of the kit for E1A residual DNA is 50 copies / μL.

9. A qPCR reaction method for detecting E1A residual DNA in a sample, characterized in that: The method comprises the steps of using the specific primer and probe combination according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 8; The method comprises the following steps: a) preparing a series of standard solutions of E1A DNA; b) preparing sample solution; c) Prepare spiked sample solution; d) preparing a qPCR mixed solution, comprising the step of mixing the components of the forward primer, reverse primer and probe according to claim 1 with a qPCR reaction solution; e) Add samples and perform qPCR detection; f) Calculate and analyze the results.

10. Use of the specific primer and probe combination according to any one of claims 1 to 3, the kit according to any one of claims 4 to 8, or the method according to claim 9 for the detection and quantitative analysis of E1A residual DNA in intermediates, semi-finished products and finished products of vaccines, recombinant proteins, antibodies, cells and gene drugs.

Images