A novel adeno-associated virus and its application

Abstract

The present application relates to the field of biomedicine, and in particular to a novel adeno-associated virus and its application. The present application discloses an adeno-associated virus AAV-WM34 capsid protein, which is a capsid protein obtained by inserting the amino acid sequence shown in SEQ ID No. 4 between the 588th and 589th positions of the wild-type adeno-associated virus AAV2 capsid protein amino acid sequence. The adeno-associated virus AAV-WM34 can have a high efficiency of infection in the retinal tissue of the eye and can be widely used in gene therapy for related diseases.

Description

Technical Field

[0001] This specification relates to the field of biomedicine, and in particular to a new adeno-associated virus and its application. Background Art

[0002] Inherited eye diseases are caused by gene defects and often manifest as familial diseases. Blinding eye diseases seriously affect people's quality of life. Among them, inherited retinal diseases (IRDs) are relatively rare blinding eye diseases caused by genetic mutations. They are also the leading cause of legal blindness in China and the world. IRDs are also called retinal dystrophy and inherited retinal degeneration. They are a variety of genetic diseases caused by pathogenic mutations in key genes of retinal function. They usually manifest as damage or death of retinal pigment epithelial cells (RPE) and photoreceptor cells, and there is no effective treatment. In recent years, as gene therapy has gradually matured, clinical research related to IRDs gene therapy has gradually accelerated, especially gene supplementation therapy using AAV as a vector, which is expected to bring bright prospects for patients with blinding eye diseases.

[0003] Retinal pigment epithelium (RPE) is a basic component of the retina and plays a vital role in visual function. Damage to the structure and function of the RPE can lead to a variety of retinal diseases, such as retinitis pigmentosa (RP), Stargardt disease (STGD), crystalline retinopathy (BCD), age-related macular degeneration (AMD), macular dystrophy (MD), etc. Retinitis pigmentosa is a common hereditary eye disease that is closely related to the degeneration of rod and cone photoreceptor cells and the degeneration of RPE cells. Traditional drug therapy is not effective for these diseases, while gene therapy can achieve therapeutic purposes by delivering exogenous genes, small RNAs or gene editing tools to correct or compensate for diseases caused by genetic defects and abnormalities.

[0004] A key to gene therapy is delivery, and the effectiveness and harmlessness of the vector are crucial. Among them, adeno-associated virus (AAV), as a safe and effective gene delivery vector, has been successful in the field of gene therapy. In recent years, researchers have used AAV as a vector to conduct some experiments in the field of gene therapy, trying to treat retinal diseases by delivering normal RPE cell genes. AAV vectors can stably express exogenous genes in cells for a long time, thereby correcting gene defects and abnormalities. However, how to optimize surgical administration has also been a hot topic in recent years. The administration methods include intravitreal injection, subretinal injection, and suprachoroidal injection. For indications where the target is RPE or photoreceptor cells, subretinal injection is still the most commonly used route of administration. Although suprachoroidal injection is also being actively explored, the current technical requirements are relatively high. In addition, the location, bleb, time, and patient factors of surgical injection all have a certain impact on the effectiveness and safety of gene therapy drugs. In order to overcome these problems, it is necessary to further optimize and develop AAV capsids to obtain better AAV vectors that can be administered by intravitreal injection and are suitable for gene therapy of eye diseases, simplify surgical operations, and improve the specificity and expression effect of tissue delivery in order to more effectively treat related hereditary retinopathy and other eye diseases.

[0005] In ophthalmology, so far, gene therapy for eye diseases based on AAV viral vectors requires the viral vector to be injected directly under the retina. This technology can only be performed in specialized hospitals with high-level experts and equipment, and this injection method has the risk of damaging fragile retinal tissue. Another disadvantage of this method is that due to the weak lateral diffusion ability of AAV virus, each injection can only target a small number of cells near the injection point. Therefore, it is necessary to develop a vector that can efficiently reach the retina through vitreous injection to reduce the difficulty of surgery and improve the treatment effect. Summary of the invention

[0006] In order to solve the above technical problems, the present application provides a novel adeno-associated vector AAV-WM34, which can mediate the specific expression of the target gene in the whole retina of adult mice under the condition of vitreous injection.

[0007] The present application provides an adeno-associated virus AAV-WM34 capsid protein, wherein the adeno-associated virus AAV-WM34 capsid protein is a capsid protein obtained by inserting the amino acid sequence shown in SEQ ID No. 4 between the 588th and 589th positions of the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein; the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein is shown in SEQ ID No. 1.

[0008] The present application also provides a polynucleotide, which encodes the above-mentioned adeno-associated virus AAV-WM34 capsid protein.

[0009] The present application also provides a nucleic acid construct, wherein the construct contains the above-mentioned polynucleotide.

[0010] The present application also provides a host cell, wherein the host cell comprises the above-mentioned construct or the above-mentioned polynucleotide is integrated heterologously into the genome, or the host cell comprises the above-mentioned adeno-associated virus AAV-WM34 capsid protein.

[0011] The present application also provides an adeno-associated virus vector system, which comprises a packaging plasmid, an expression plasmid and a helper plasmid, wherein the packaging plasmid is the above-mentioned nucleic acid construct.

[0012] The present application also provides an adeno-associated virus AAV-WM34, which contains the above-mentioned adeno-associated virus AAV-WM34 capsid protein, or is obtained by viral packaging through the above-mentioned adeno-associated virus vector system.

[0013] The present application also provides a cell, which is an engineered cell obtained by transformation using the adeno-associated virus AAV-WM34 mentioned above.

[0014] The present application also provides a pharmaceutical composition, which comprises the above-mentioned adeno-associated virus AAV-WM34 and a pharmaceutically acceptable carrier or excipient.

[0015] The present application also provides the use of the above-mentioned adeno-associated virus AAV-WM34 capsid protein, or the above-mentioned construct, or the above-mentioned host cell, or the above-mentioned adeno-associated virus vector system, or the above-mentioned adeno-associated virus AAV-WM34, or the above-mentioned cell, or the above-mentioned pharmaceutical composition in the preparation of drugs for preventing and / or treating diseases.

[0016] The beneficial effects brought about by the present application include but are not limited to: (1) providing a novel adeno-associated vector AAV-WM34, which can mediate the expression of target genes specifically in the retinal RPE cells of adult mice under the condition of vitreous injection; (2) the novel adeno-associated vector AAV-WM34 mediates the expression of target genes more flexibly and efficiently than traditional transgenic methods, and is more convenient to use and has lower cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The present application will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not restrictive, and include:

[0018] Figure 1 The plasmid map of RC-WM34 shown in some embodiments of the present application.

[0019] Figure 2AAV-WM34 structure diagram of computer simulation according to some embodiments of the present application, Figure 2 Figure a is a schematic diagram of the AAV-WM34 sequence. Figure 2 Middle b is a simulation diagram of the AAV-WM34 structure.

[0020] Figure 3 This is a retinal section of a mouse injected with rAAV-WM34-CMV-EGFP virus according to some embodiments of the present application, EGFP: green shows the fluorescent protein expressed by virus infection, DAPI: blue is cell nucleus staining. The results show that rAAV-WM34-CMV-EGFP has a high infection property for RPE cells and can be used for ophthalmic gene therapy.

[0021] Figure 4 According to the infection of rAAV-WM34-CMV-EGFP and AAV2-CMV-EGFP in ocular tissues shown in some embodiments of the present application, Figure 4 Middle a is a retinal section of mice injected with rAAV-WM34-CMV-EGFP and AAV2-CMV-EGFP viruses, EGFP: green shows the fluorescent protein expressed by virus infection, DAPI: blue shows cell nucleus staining; Figure 4 Figure b is a statistical diagram of the distribution of EGFP signals in retinal tissue. The results show that the EGFP signal of WM34 is concentrated in the RPE layer, and the EGFP signal of AAV2 is concentrated in the INL and RGC layers, indicating that WM34 can specifically infect RPE cells. DETAILED DESCRIPTION

[0022] In order to more clearly illustrate the technical solutions of the embodiments of this specification, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some examples or embodiments of this specification. For ordinary technicians in this field, this specification can also be applied to other similar scenarios based on these drawings without creative work. Unless it is obvious from the language environment or otherwise explained, the same reference numerals in the figures represent the same structure or operation.

[0023] As shown in this specification and claims, unless the context clearly indicates an exception, the words "a", "an", "an" and / or "the" do not refer to the singular and may also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements that have been clearly identified, and these steps and elements do not constitute an exclusive list. The method or device may also include other steps or elements.

[0024] Flowcharts are used in this specification to illustrate the operations performed by the system according to the embodiments of this specification. It should be understood that the preceding or following operations are not necessarily performed precisely in order. Instead, the steps may be processed in reverse order or simultaneously. At the same time, other operations may also be added to these processes, or one or more operations may be removed from these processes.

[0025] The present application provides an adeno-associated virus AAV-WM34 capsid protein, wherein the adeno-associated virus AAV-WM34 capsid protein is a capsid protein obtained by inserting the amino acid sequence shown in SEQ ID No. 4 between the 588th and 589th positions of the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein; the amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein is shown in SEQ ID No. 1.

[0026] The term "AAV" is an abbreviation for adeno-associated virus and may be used to refer to the virus itself or its derivatives.

[0027] In some embodiments, the amino acid sequence of the adeno-associated virus AAV-WM34 capsid protein may be as shown in SEQ ID No. 3. In some embodiments, the amino acid sequence of the adeno-associated virus AAV-WM34 capsid protein may have a sequence identity of 85% or more with SEQ ID No. 3, and have the function of the amino acid sequence defined by SEQ ID No. 3.

[0028] The present application also provides a polynucleotide, which encodes the above-mentioned adeno-associated virus AAV-WM34 capsid protein.

[0029] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single-stranded or double-stranded form. Unless otherwise expressly limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implies conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as sequences explicitly shown. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0030] In some embodiments, the nucleotide sequence of the polynucleotide may be as shown in SEQ ID No.2.

[0031] The present application also provides a nucleic acid construct, wherein the construct contains the above-mentioned polynucleotide.

[0032] "Construct" herein refers to a polynucleotide that can carry at least one polynucleotide fragment. The construct can deliver fragments of nucleic acids, individual polynucleotides, into a host cell. It can include at least one expression cassette comprising a regulatory sequence for correctly expressing the polynucleotides incorporated therein. The polynucleotides to be introduced into the cell (e.g., polynucleotides encoding a target product or a selective marker) can be inserted into an expression cassette of a vector for expression therefrom. Constructs according to the present application can exist in circular or linear (linearized) forms, and also include expression construct fragments. The term "construct" also includes artificial chromosomes or similar individual polynucleotides that allow the transfer of exogenous nucleic acid fragments.

[0033] The present application also provides a host cell, wherein the host cell comprises the above-mentioned construct or the above-mentioned polynucleotide is integrated heterologously into the genome, or the host cell comprises the above-mentioned adeno-associated virus AAV-WM34 capsid protein.

[0034] In some embodiments, the host cell does not include fertilized eggs of plant cells and animal cells.

[0035] In some embodiments, the host cell may be selected from any one of mammalian cells (such as CHO, COS and N2A), human cells (human cervical cancer cells such as HELA and human embryonic kidney cells such as HEK293T), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9). In some embodiments, preferably, the host cell may be an animal cell, and more preferably a human cell. In some embodiments, the host cell may be a passage cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). In some embodiments, the host cell may be an adherent cell or a suspended cell, i.e., a cell grown in the form of a suspension.

[0036] The present application also provides an adeno-associated virus vector system, which comprises a packaging plasmid, an expression plasmid and a helper plasmid, wherein the packaging plasmid is the above-mentioned nucleic acid construct.

[0037] In some embodiments, the packaging plasmid may further comprise a rep gene fragment of an adeno-associated virus, wherein the rep gene fragment comprises an intron, and the intron comprises a transcription termination sequence.

[0038] In some embodiments, the expression plasmid may comprise a heterologous nucleotide sequence encoding a product of interest.

[0039] In some embodiments, the target product can be a nucleic acid or a protein. The target product can be selected as needed, for example, different target products are selected according to different targets, which is a routine technique in the art. The heterologous nucleotide sequence encoding the target product is a construct, and the construct is a nucleic acid containing the target product. The construct is constructed by inserting the nucleic acid encoding the target product into a suitable expression vector. A person skilled in the art can select a suitable expression vector, for example, the expression vector is selected from any one of pAAV-CAG, pAAV-TRE, pAAV-EF1a, pAAV-GFAP, pAAV-Lgr5, pAAV-Sox2, pAAV-Syn or pAAV-CMV expression vectors.

[0040] In some embodiments, after the packaging plasmid, expression plasmid, and helper virus plasmid are transferred into cells, all nucleic acid sequences therein are integrated into the cells to produce adeno-associated virus.

[0041] The present application also provides an adeno-associated virus AAV-WM34, which contains the above-mentioned adeno-associated virus AAV-WM34 capsid protein, or is obtained by viral packaging through the above-mentioned adeno-associated virus vector system.

[0042] The term "packaging" refers to the series of intracellular processes that lead to the assembly and encapsulation of AAV particles.

[0043] In some embodiments, the adeno-associated virus AAV-WM34 further comprises a heterologous nucleotide sequence encoding a product of interest.

[0044] The present application also provides a cell, which is an engineered cell obtained by transformation using the adeno-associated virus AAV-WM34 mentioned above.

[0045] As representative examples of suitable cells, any one of mammalian cells (such as CHO, COS and N2A), plant cells, human cells (human cervical cancer cells such as HELA and human embryonic kidney cells such as HEK293FT), bacterial cells (such as Escherichia coli, Streptomyces, Salmonella typhimurium), fungal cells (such as yeast), and insect cells (such as Sf9) is selected. Preferably, the host cell is an animal cell, and more preferably a human cell. The cell is a passage cell or a primary cell, i.e., a cell directly isolated from an organism (such as a human). The cell is an adherent cell or a suspended cell, i.e., a cell grown in a suspension form.

[0046] The present application also provides a pharmaceutical composition, which comprises the above-mentioned adeno-associated virus AAV-WM34 and a pharmaceutically acceptable carrier or excipient.

[0047] The excipients include various excipients and diluents, which are not necessary active ingredients and have no excessive toxicity after administration. The excipients include sterile water or saline, stabilizers, excipients, antioxidants (such as ascorbic acid), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surfactants (PEG, Tween, etc.), chelating agents (EDTA, etc.) or adhesives. The excipients also include other low molecular weight polypeptides, serum albumin, glycine, glutamine, asparagine, arginine, polysaccharides, monosaccharides, mannitol or sorbitol. When the excipients are used for injection of aqueous solution, they are selected from saline, glucose isotonic solution, D-sorbitol isotonic solution, D-mannose isotonic solution, D-mannoses or sugar alcohol isotonic solution. The injection aqueous solution contains a solubilizer. The solubilizer is selected from alcohol (ethanol), polyol (propylene glycol or PEG) and / or non-ionic surfactant (Tween 80 or HCO-50).

[0048] In the pharmaceutical composition provided in the present application, the adeno-associated virus AAV-WM34 is a single active ingredient, and can also be combined with one or more other active components useful for the treatment of eye diseases to form a combined preparation.

[0049] The content of the active ingredient in the pharmaceutical composition is a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the adeno-associated virus AAV-WM34 and the active ingredient of the pharmaceutical composition depends on the patient's weight, the type of application, the condition and severity of the disease.

[0050] In some embodiments, the pharmaceutical composition is one or more of an injection, a tablet, a capsule, an aerosol, an eye drop, or a nasal drop.

[0051] The present application also provides the use of the above-mentioned adeno-associated virus AAV-WM34 capsid protein, or the above-mentioned construct, or the above-mentioned host cell, or the above-mentioned adeno-associated virus vector system, or the above-mentioned adeno-associated virus AAV-WM34, or the above-mentioned cell, or the above-mentioned pharmaceutical composition in the preparation of drugs for preventing and / or treating diseases.

[0052] The term "prevention and / or treatment" (and grammatical variations thereof) refers to an attempt to alter the natural course of a disease in a treated individual, and may be a clinical intervention performed for prevention or during the course of clinical pathology. Desired effects of treatment include, but are not limited to, preventing the occurrence or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, ameliorating or alleviating the disease state, and eliminating or improving prognosis.

[0053] In some embodiments, the disease may be an ophthalmic disease. In some embodiments, preferably, the ophthalmic disease may be a retinal disease. In some embodiments, more preferably, the ophthalmic disease may be selected from one or more of retinitis pigmentosa, Stargardt disease, crystalline retinal degeneration, age-related macular degeneration or macular dystrophy.

[0054] In some embodiments, the drug may be a vitreous administration drug. In some embodiments, the drug may target retinal pigment epithelial cells.

[0055] The present application also provides a method for treating an eye disease, comprising administering an effective amount of the adeno-associated virus, host cell, vector system or pharmaceutical composition of the present application to a subject in need thereof.

[0056] In the present application, the adeno-associated virus or host cell or vector system or pharmaceutical composition of the present application can be administered to the patient. A person skilled in the art can determine the appropriate administration method and dosage.

[0057] The delivery of one or more therapeutic genes by the adeno-associated virus provided in the present application can be used alone or in combination with other treatment methods or therapeutic components.

[0058] The adeno-associated virus of the present application is used to infect cells, thereby delivering genes and / or linked (for example, but not limited to, covalently linked) biologically active polypeptides to cells. Therefore, the present application provides a method for delivering heterologous genes to cells, the method infecting cells by allowing one or more adeno-associated viruses of the present application to be delivered to cells, wherein the adeno-associated virus comprises one or more heterologous genes.

[0059] The present application also provides a method for producing a stable adeno-associated virus vector production cell line, comprising:

[0060] (a) introducing an adeno-associated viral vector as defined herein into a culture of mammalian host cells; and / or,

[0061] (b) selecting in culture mammalian host cells that possess the nucleic acid sequence encoded on the vector integrated into an endogenous chromosome of the mammalian host cell.

[0062] The AAV vector production cell is a mammalian cell. In some embodiments, the mammalian cell is selected from HEK293 cells, CHO cells, Jurkat cells, K562 cells, PerC6 cells, HeLa cells or derivatives thereof. In some embodiments, the mammalian host cell is a HEK293 cell, or is derived from a HEK293 cell. In some embodiments, the HEK293 cell is a HEK293T cell.

[0063] The genomic sequences of various serotypes of AAV, as well as the sequences of native ITRs, Rep proteins, and capsid proteins are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. The disclosures thereof are incorporated herein by reference for AAV nucleic acid and amino acid sequences.

[0064] In the compounds of the present application and their applications, when adeno-associated virus is used in combination with other therapeutic agents, the active compound is co-administered with the other therapeutic agents. "Co-administered" means to be administered simultaneously in the same preparation or in two different preparations via the same or different routes, or to be administered sequentially via the same or different routes.

[0065] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged.

[0066] Example 1 - Acquisition of a novel adeno-associated virus AAV-WM34

[0067] a. Construction of Rep-Cap plasmid of AAV-WM34

[0068] The serotype of AAV is determined by the sequence of the Cap protein in the Rep-Cap plasmid required for AAV packaging. Therefore, AAVs produced by packaging with different Cap sequences have different infection tropisms. The existing natural serotype was modified by inserting a random peptide Seq ID No. 4 with a length of 7 amino acids between the 588R and 589Q sites of the amino acid sequence of Seq ID No. 1 derived from AAV2: SGRDLTP ( Figure 2 In a), the random peptide nucleotide sequence was TCTGGTCGTGATCTGACGCCG (Seq ID No. 5), thus constructing a new AAV serotype plasmid named RC-WM34 ( Figure 1 ), whose nucleotide sequence is Seq ID No.2 and amino acid sequence is Seq ID No.3. The outer surface of the capsid shows the presence of capsid fragments from the inserted polypeptide and indicates that the three-fold symmetry axis of AAV-WM34 is affected by the inserted sequence ( Figure 2 (b)

[0069] Seq ID No.1:

[0070] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL*

[0071] Seq ID No.2:

[0072]

[0073] Seq ID No.3:

[0074] MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRSGRDLTPQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL*

[0075] b. Preparation and purification of rAAV-WM34 virus

[0076] The sequence encoded by the Cap gene of WM34 was synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and the Rep-Cap plasmid of AAV-WM34, namely RC-WM34, was obtained through plasmid construction. The sequence was verified to be correct. The obtained RC-WM34 was co-transfected with the genomic plasmid pAAV-CMV-EGFP expressing a green fluorescent protein EGFP and the pHelper plasmid in appropriate amounts into HEK-293T cells, and the AAV virus was purified by iodixanol density gradient centrifugation. The final product was rAAV-WM34-CMV-EGFP. The virus titer was measured at 2E+13 GC / mL as the appropriate concentration, and it was placed at -80℃ for use.

[0077] Example 2 - In vivo validation of the novel adeno-associated virus rAAV-WM34 in the visual system

[0078] Place an anesthetized adult mouse under a stereo microscope and drop 1-2 drops of tropicamide eye drops on the eyeball to dilate the pupil. Apply levofloxacin eye ointment on the eyeball, hold the eyeball from the optic disc with the elbow forceps in the left hand, hold a 1mL syringe or glass needle in the right hand to puncture the cornea to reduce intraocular pressure, and gently wipe off the periocular fluid with a tissue. Use a microsyringe to draw 1.1μL of virus, hold the eyeball with forceps in the left hand, hold the microsyringe in the right hand, insert the needle at 50° between the posterior edge of the cornea and the iris plane, and slowly inject rAAV-WM34-CMV-EGFP virus with a titer of 1.1E13 GC / mL. After the injection is completed, the glass needle stays for 30s and then slowly withdraws. Apply erythromycin ointment on the wound, put the mouse in a cage in a 41℃ water bath to keep warm, and move the mouse to the mouse room for breeding after it wakes up. After 21 days, the mice were killed by spinal dislocation, and the eyeball tissue was removed. After fixation in 4% PFA for 1 hour, the cornea was punctured with a 1mL syringe to release the aqueous humor. The eyeball was placed in a small culture dish filled with PBS solution, and the eyeball tissue was dissected under a microscope. The cornea was clamped with pointed forceps, and the cornea was cut off along the circumference of the cornea and sclera from the corneal opening with ophthalmic scissors. The lens was removed with forceps, and the optic nerve was retained for about 2mm. The dissected eye cup was placed in 4% PFA and fixed at 4°C for 12 hours. The fixed eye cup was placed in 30% sucrose and dehydrated at 4°C for 12 hours. The eyeball tissue was then embedded, frozen and sectioned, and sections with better results and complete tissue were selected for staining under a fluorescence microscope. Immunofluorescence results showed that rAAV-WM34-CMV-EGFP can infect retinal pigment epithelial cells (RPE), as shown in the following figure. Figure 3 At the same time, the present application also analyzed the infection of retinal cells by rAAV-WM34 and AAV2 viruses. The immunofluorescence results are shown in Figure 4As shown in a, the distribution of EGFP signals in the retinal tissue of the eye tissue sections of WM34 and AAV2 verified animals was statistically analyzed. The EGFP signal of WM34 was concentrated in the RPE layer, and the EGFP signal of AAV2 was mainly concentrated in the INL and RGC layers. The results are shown in Figure 4 As shown in middle b, it shows that WM34 can specifically infect RPE cells.

[0079] The basic concepts have been described above. Obviously, for those skilled in the art, the above detailed disclosure is only for example and does not constitute a limitation of this specification. Although not explicitly stated here, those skilled in the art may make various modifications, improvements and corrections to this specification. Such modifications, improvements and corrections are suggested in this specification, so such modifications, improvements and corrections still belong to the spirit and scope of the exemplary embodiments of this specification.

[0080] At the same time, this specification uses specific words to describe the embodiments of this specification. For example, "one embodiment", "an embodiment", and / or "some embodiments" refer to a certain feature, structure or characteristic related to at least one embodiment of this specification. Therefore, it should be emphasized and noted that "one embodiment" or "an embodiment" or "an alternative embodiment" mentioned twice or more in different positions in this specification does not necessarily refer to the same embodiment. In addition, certain features, structures or characteristics in one or more embodiments of this specification can be appropriately combined.

[0081] In some embodiments, numbers describing the number of components and attributes are used. It should be understood that such numbers used in the description of the embodiments are modified by the modifiers "about", "approximately" or "substantially" in some examples. Unless otherwise specified, "about", "approximately" or "substantially" indicate that the numbers are allowed to vary by ±20%. Accordingly, in some embodiments, the numerical parameters used in the specification and claims are approximate values, which may change according to the required features of individual embodiments. In some embodiments, the numerical parameters should take into account the specified significant digits and adopt the general method of retaining the digits. Although the numerical domains and parameters used to confirm the breadth of the range in some embodiments of this specification are approximate values, in specific embodiments, the setting of such numerical values ​​is as accurate as possible within the feasible range.

[0082] Finally, it should be understood that the embodiments described in this specification are only used to illustrate the principles of the embodiments of this specification. Other variations may also fall within the scope of this specification. Therefore, as an example and not a limitation, alternative configurations of the embodiments of this specification may be considered consistent with the teachings of this specification. Accordingly, the embodiments of this specification are not limited to the embodiments explicitly introduced and described in this specification.

Claims

1. An adeno-associated virus AAV-WM34 capsid protein, characterized in that The adeno-associated virus AAV-WM34 capsid protein is a capsid protein obtained by inserting the amino acid sequence shown in SEQ ID No. 4 between the 588th and 589th positions of the wild-type adeno-associated virus AAV2 capsid protein amino acid sequence; The amino acid sequence of the wild-type adeno-associated virus AAV2 capsid protein is shown in SEQ ID No.

1.

2. The adeno-associated virus AAV-WM34 capsid protein according to claim 1, characterized in that The amino acid sequence of the adeno-associated virus AAV-WM34 capsid protein is shown in SEQ ID No.

3.

3. A polynucleotide, characterized in that The polynucleotide encodes the adeno-associated virus AAV-WM34 capsid protein according to claim 1 or 2.

4. The polynucleotide according to claim 3, characterized in that The nucleotide sequence of the polynucleotide is shown as SEQ ID No.

2.

5. A nucleic acid construct, characterized in that The construct contains the polynucleotide of claim 3 or 4.

6. A host cell, characterized in that The host cell comprises the construct of claim 5 or a heterologous polynucleotide of claim 3 or 4 integrated into the genome, or the host cell comprises the adeno-associated virus AAV-WM34 capsid protein of claim 1 or 2, and the host cell does not include fertilized eggs of plant cells and animal cells.

7. An adeno-associated virus vector system, characterized in that: The adeno-associated virus vector system comprises a packaging plasmid, an expression plasmid and a helper plasmid, and the packaging plasmid is the nucleic acid construct according to claim 5.

8. An adeno-associated virus AAV-WM34, characterized in that The adeno-associated virus contains the adeno-associated virus AAV-WM34 capsid protein described in claim 1 or 2, or is obtained by viral packaging through the adeno-associated virus vector system described in claim 7.

9. A cell, characterized in that The cells are engineered cells transformed with the adeno-associated virus AAV-WM34 described in claim 8, and the cells do not include fertilized eggs of plant cells and animal cells.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the adeno-associated virus AAV-WM34 described in claim 8 and a pharmaceutically acceptable carrier or excipient.

11. The pharmaceutical composition according to claim 10, characterized in that The pharmaceutical composition is one or more of an injection, a tablet, a capsule, an aerosol, an eye drop or a nasal drop.

12. Use of the adeno-associated virus AAV-WM34 capsid protein of claim 1 or 2, or the construct of claim 5, or the host cell of claim 6, or the adeno-associated virus vector system of claim 7, or the adeno-associated virus AAV-WM34 of claim 8, or the cell of claim 9, or the pharmaceutical composition of claim 10 in the preparation of a medicament for treating a disease, wherein the disease is retinitis pigmentosa.

13. The use according to claim 12, characterized in that The drug is a drug for vitreous administration.

Images