Tomato brown wrinkled fruit virus-resistant mutant and its application

Abstract

The present invention discloses a mutant resistant to tomato brown wrinkled fruit virus and its application, belonging to the technical field of biological control of viral diseases. 2 The mutation of tyrosine at position 767 of the LRR domain to phenylalanine conferred weak resistance to ToBRFV. Further site-directed saturation mutagenesis was used to convert Tm‑2 2 The tyrosine at position 767 of the gene-encoded protein mutated into 18 other amino acids, obtaining 18 Tm‑2 2 The mutant plasmid was found to be Tm-2, which was generated by the mutation of tyrosine at position 767 to tryptophan. 2 ‑Mut3‑1 showed the strongest resistance to ToBRFV, while retaining resistance to TMV, ToMV, and ToMMV. 2 The tyrosine 767 in the LRR domain of ‑Mut3‑1 was mutated to phenylalanine and the mutant Tm‑2 obtained in previous studies 2 The isoleucine at position 354 of the NB-ARC domain of ‑Mut2 was mutated to methionine for combined mutation to obtain the mutant Tm‑2 2 ‑Mut4, and found that Tm‑2 2 ‑Mut4 could significantly reduce the accumulation of ToBRFV capsid protein, which was similar to the mutant pFGCTm‑2 2 ‑Mut2 and the newly obtained mutant Tm‑2 2 Compared with ‑Mut3‑1, its resistance to ToBRFV was significantly improved.

Description

Technical Field

[0001] The invention relates to the technical field of biological control of viral diseases, and in particular to a mutant resistant to tomato brown wrinkled fruit virus and application thereof. Background Art

[0002] Tomato brown rugose fruit virus (ToBRFV) belongs to the genus Tobamovirus. It mainly harms tomatoes and peppers, causing blister spots, narrow leaves and mosaic symptoms on leaves, brown wrinkling and necrosis of tomato fruits, necrosis of petioles, pedicels and calyxes, and diseased plants often show dwarfing (Panno et al., 2019; Yan et al., 2020b). ToBRFV is very stable and easy to spread and infect. It can survive for a long time in water, on the surface of objects and in the absence of living plants and retain its infectivity. Studies have shown that the presence of a few tomato plants infected by ToBRFV in a tomato greenhouse is enough to destroy the entire crop of tomatoes in a short period of time (Panno et al., 2020a). At present, there is no effective prevention and control method for ToBRFV. Once diseased plants and fruits appear in the field, they can only be eradicated and burned.

[0003] Tomato Tm-2 2 The gene belongs to the NBS-LRR family and is an important resistance gene for controlling tobacco mosaic virus. It is commonly found in commercial tomato varieties. However, ToBRFV completely breaks the Tm-2 gene in tomatoes. 2 Resistance, that is, the commercial products contain Tm-2 2 Tomato varieties with the same gene are susceptible to ToBRFV.

[0004] Therefore, in order to improve plant resistance to ToBRFV, it is necessary to further develop the disease resistance gene Tm-2 2 The mutants were transformed to obtain those that are resistant to ToBRFV. Summary of the invention

[0005] In view of the above prior art, the present invention aims to provide a mutant resistant to tomato brown wrinkled fruit virus and its application. 2 Through artificial evolution, two new mutants resistant to tomato brown wrinkled fruit virus were obtained, providing a new direction for the prevention and control of ToBRFV.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a mutant resistant to tomato brown wrinkled fruit virus is provided, wherein the mutant is Tm-2 2 -Mut3-1 or Tm-2 2-Mut4;

[0008] Tm-2 2 - The amino acid sequence of Mut3-1 is shown in SEQ ID NO.2;

[0009] Tm-2 2 -The amino acid sequence of Mut4 is shown in SEQ ID NO.4.

[0010] The mutant Tm-2 2 -Mut3-1, is a tomato Tm-2 2 The tyrosine (Y) at position 767 of the gene-encoded protein mutated to tryptophan (W). 2 -Mut4, a tomato Tm-2 2 The 354th amino acid of the gene-encoded protein mutated from isoleucine (I) to methionine (M), and the 767th tyrosine (Y) mutated to tryptophan (W).

[0011] The second aspect of the present invention provides a gene encoding the above-mentioned mutant resistant to tomato brown wrinkled fruit virus.

[0012] Preferably, the coding gene is a nucleic acid molecule shown in any one of the following i)-iv):

[0013] i) the nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1;

[0014] ii) a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 other than i);

[0015] iii) the nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.3;

[0016] iv) a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.4 except iii).

[0017] The above coding gene, wherein the nucleic acid molecules shown in i) and ii) are mutant Tm-2 2 -Mut3-1 encoding gene; iii) and iv) the nucleic acid molecules shown are mutant Tm-2 2 -The gene encoding Mut4.

[0018] The third aspect of the present invention provides a recombinant expression vector or an engineered bacterium comprising the above encoding gene.

[0019] The fourth aspect of the present invention provides the use of the above-mentioned mutant resistant to tomato brown wrinkled fruit virus in the following (1) or (2):

[0020] (1) Prevent and control tomato brown fruit virus;

[0021] (2) Prepare products for preventing and controlling tomato brown wrinkled fruit virus.

[0022] The fifth aspect of the present invention provides the use of the coding gene of the above-mentioned mutant resistant to tomato brown wrinkled fruit virus or the recombinant expression vector or engineered bacteria containing the above-mentioned coding gene in the following (1) or (2):

[0023] (1) Prevent and control tomato brown fruit virus;

[0024] (2) Cultivate plant varieties that are resistant to tomato brown fruit virus.

[0025] Preferably, the plant variety is tomato or tobacco.

[0026] A sixth aspect of the present invention provides a method for improving plant resistance to ToBRFV, comprising the following steps:

[0027] Plant Tm-2 2 The nucleotide at position 2300 of the coding region sequence of the gene mutated from A to G, and the nucleotide at position 2301 mutated from C to G;

[0028] Alternatively, plant Tm-2 2 The nucleotide 1062 of the coding region sequence of the gene mutated from A to G, the nucleotide 2300 mutated from A to G, and the nucleotide 2301 mutated from C to G;

[0029] Alternatively, a gene encoding a mutant resistant to tomato brown crinkle fruit virus is exogenously introduced into the plant.

[0030] Beneficial effects of the present invention:

[0031] (1) The present invention obtains a mutant with weak resistance to ToBRFV by random mutagenesis, and further obtains a mutant with weak resistance to ToBRFV by site-directed saturation mutagenesis. 2 The tyrosine at position 767 of the gene-encoded protein mutated to 18 other amino acids, resulting in 18 Tm-2 2 The results showed that the different mutation directions of tyrosine at position 767 would affect the resistance to ToBRFV. Only the mutation of tyrosine at position 767 to tryptophan mediated the strongest resistance to ToBRFV, while retaining the resistance to TMV, ToMV and ToMMV.

[0032] (2) Combined with previous studies, the present invention increases Tm-2 2 The mutant Tm-2 was obtained by combining mutations at two sites in the LRR domain and the NB-ARC domain. 2 -Mut4, it was found that Tm-2 2-Mut4 can significantly reduce the accumulation of ToBRFV capsid protein (CP), which is similar to the mutant pFGCTm-2 screened in previous studies. 2 -Mut2 and the newly obtained mutant pFGCTm-2 2 -Mut3-1 has further improved resistance to ToBRFV. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 :Tm-2 2 With Tm-2 2 -Mut2, Tm-2 2 -Mut3-1, Tm-2 2 -Mut4 nucleotide sequence alignment.

[0034] Figure 2 :Tm-2 2 With Tm-2 2 -Mut2, Tm-2 2 -Mut3-1, Tm-2 2 -Mut4 amino acid sequence alignment.

[0035] Figure 3 : Screening mutants that can react with ToBRFV MP and induce cell necrosis.

[0036] Figure 4 :With Tm-2 2 -Mut3-2 compared to Tm-2 2 -Mut3-1 has a more significant effect in reducing ToBRFV accumulation.

[0037] Figure 5 :Tm-2 2 -Mut3-1 reacts with ToBRFV MP and TMV, ToMV and ToMMV MP to induce cell necrosis; Left: with wild-type Tm-2 2 In comparison, Tm-2 2 -Mut3-1 can produce hypersensitivity necrosis reaction with ToBRFV MP; right: Tm-2 2 -Mut3-1 can also recognize MPs of TMV, ToMV and ToMMV.

[0038] Figure 6 :Tm-2 2 -Mut3-1 significantly reduced the accumulation of ToBRFV as well as TMV, ToMV and ToMMV.

[0039] Figure 7 :Tm-2 2-Mut4 reacts with ToBRFV MP and TMV, ToMV and ToMMV MP to induce cell necrosis; Left: with wild-type Tm-2 2 In comparison, Tm-2 2 -Mut4 can produce hypersensitive necrosis reaction with ToBRFV MP; right picture: Tm-2 2 -Mut4 can also recognize MPs of TMV, ToMV and ToMMV.

[0040] Figure 8 :Tm-2 2 And different Tm-2 2 Effect of mutants on ToBRFV accumulation. DETAILED DESCRIPTION

[0041] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0042] As mentioned earlier, ToBRFV completely breaks down Tm-2 in tomatoes 2 Therefore, further investigation of Tm-2 is needed. 2 Carry out transformation.

[0043] The inventors modified and designed two Tm-2 2 Mutant, Tm-2 with NCBI accession number: AF536201.1 2 Gene sequence comparison, Tm-2 2 -Tm-2 of Mut1 2 Three nucleotide mutations occurred in the gene coding region, namely A138 G, T418C, and A1425 G, and the corresponding amino acid mutations were R46R, C140R, and S475S. 2 -Tm-2 of Mut2 2 One nucleotide mutation occurred in the gene coding region, the mutation was A1062G, and the corresponding amino acid mutation was I354M.

[0044] These two Tm-2 2 All mutants have anti-ToBRFV activity, which is of great significance for the prevention and treatment of ToBRFV.

[0045] To further discover new Tm-2 2 The inventors have continued to conduct in-depth research on anti-ToBRFV mutants. Patent CN116847729A mentions: Tm-2 2The presence of tyrosine, phenylalanine or tryptophan at position 767 of the protein and at least one of the following mutations: C848R, N822C, N822F, N822Y, N822W, N825H, N825K and N825T can confer ToBRFV resistance to tomato plants. The patent does not specify that a change at position 767 alone can confer Tm-2 2 Recognize the ability of ToBRFV MP to induce cell necrosis; in addition, the patent also tested 7 different amino acid variants and found that in the absence of the C848R mutation, none of the variants improved the ability to detect and respond to MP.

[0046] The applicant found through random mutagenesis that Y767F has a weak necrosis ability against MP and a slight resistance to ToBRFV. 2 The inventors used site-directed saturation mutagenesis to mutate the tyrosine at position 767 of the protein into 18 other amino acids, obtained 18 mutant plasmids, and screened mutants that produced allergic cell necrosis in response to ToBRFV MP. ​​The results showed that only the mutant that mutated the tyrosine at position 767 into tryptophan had enhanced resistance to ToBRFV. The mutant was named Tm-2 2 -Mut3-1, and further co-expression of this mutant with ToBRFV revealed that: Tm-2 2 -Mut3-1 also retains resistance to TMV, ToMV and ToMMV.

[0047] pFGCTm-2 2 -Tm-2 in Mut3-1 2 The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO. 1. The amino acid sequence encoded by the gene is shown in SEQ ID NO. 2.

[0048] Since the mutation is located at Tm-2 2 The LRR domain of the mutant pFGCTm-2 2 -Mut2 mutation site is located in the NB-ARC domain. We envision that combining mutations in two different domains may improve resistance to ToBRFV. 2 -Mut3-1 and Tm-2 2 -The two mutation sites in Mut2 are combined to obtain Tm-2 2 Mutant plasmid pFGCTm-2 2 -Mut4.

[0049] Tm-2 with NCBI accession number: AF536201.12 Gene sequence comparison, Tm-2 2 -Three nucleotide mutations occurred in the coding region of Mut4: mutation A1062G, and the corresponding amino acid mutation was I354M; mutations A2300G and C2301G corresponded to amino acid mutations Y767W.

[0050] pFGCTm-2 2 -Tm-2 in Mut4 2 The nucleotide sequence of the coding region of the gene is shown in SEQ ID NO.3; the amino acid sequence encoded by the gene is shown in SEQ ID NO.4.

[0051] The mutant plasmid pFGCTm-2 2 -Mut4 was co-expressed with ToBRFV, and it was found that Tm-22-Mut4 could significantly reduce the accumulation of ToBRFV capsid protein (CP), which was different from the mutant pFGCTm-2 obtained in previous studies. 2 -Mut2 and the newly obtained mutant pFGCTm-2 2 -Mut3-1 has further improved resistance to ToBRFV.

[0052] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0053] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out in accordance with conventional test methods or the operating instructions recommended by the supplier. 2 The accession number of the gene in NCBI is: AF536201.1. The accession number of the ToBRFV-SD isolate used in the present invention in NCBI is MT018320; the accession number of TMV in NCBI is MH595920; the accession number of ToMMV in NCBI is MW37351; and the accession number of ToMV in GenBank is KY967221.1.

[0054] Example 1: Tm-2 2 -Construction of Mut3-1 mutant and study of disease resistance

[0055] 1. Tm-2 2 - Construction of Mut3-1 mutant

[0056] The following primers were used to amplify Tm-2 by site-directed saturation mutagenesis. 2 Amplified fragment of the gene with amino acid mutation at position 767.

[0057] Primer pair 1-Tm-2 2 -Y767A-F:TAGCCGCCTTTAGTGTAGACCGTTATATACTGG; (SEQ ID NO.5)

[0058] Primer pair 1-Tm-2 2 -Y767A-R: CTAAAGGCGGCTAGAGTAAGCTTGATGAGATTT.

[0059] (SEQ ID NO.6)

[0060] Primer pair 2-Tm-2 2 -Y767R-F: TAGCCCGCTTTAGTGTAGACCGTTATATACTGG; (SEQ ID NO.7)

[0061] Primer pair 2-Tm-2 2 -Y767R-R: CTAAAGCGGGCTAGAGTAAGCTTGATGAGATTT.

[0062] (SEQ ID NO.8)

[0063] Primer pair 3-Tm-2 2 -Y767N-F: CTAGCCAACTTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.9)

[0064] Primer pair 3-Tm-2 2 -Y767N-R:ACTAAAGTTGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.10)

[0065] Primer pair 4-Tm-2 2 -Y767D-F:CTAGCCGACTTTAGTGTAGACCGTTATATACTGG; (SEQ IDNO.11)

[0066] Primer pair 4-Tm-2 2 -Y767D-R: CTAAAGTCGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.12)

[0067] Primer pair 5-Tm-2 2 -Y767C-F: CTAGCCTGCTTTAGTGTAGACCGTTATATACTGG; (SEQ IDNO.13)

[0068] Primer pair 5-Tm-2 2 -Y767C-R: CTAAAGCAGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.14)

[0069] Primer pair 6-Tm-2 2 -Y767E-F:CTAGCCGAATTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.15)

[0070] Primer pair 6-Tm-2 2 -Y767E-R:ACTAAATTCGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.16)

[0071] Primer pair 7-Tm-2 2 -Y767Q-F:CTAGCCCAATTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.17)

[0072] Primer pair 7-Tm-2 2 -Y767Q-R:ACTAAATTGGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.18)

[0073] Primer pair 8-Tm-2 2 -Y767G-F:TAGCCGGCTTTAGTGTAGACCGTTATATACTGG; (SEQ IDNO.19)

[0074] Primer pair 8-Tm-2 2 -Y767G-R: CTAAAGCCGGCTAGAGTAAGCTTGATGAGATTT. (SEQ IDNO.20)

[0075] Primer pair 9-Tm-2 2 -Y767H-F:TAGCCCACTTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.21)

[0076] Primer pair 9-Tm-2 2 -Y767H-R:ACTAAAGTGGGCTAGAGTAAGCTTGATGAGATTT. (SEQ IDNO.22)

[0077] Primer pair 10-Tm-2 2-Y767I-F:CTAGCCATCTTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.23)

[0078] Primer pair 10-Tm-2 2 -Y767I-R:CACTAAAGATGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.24)

[0079] Primer pair 11-Tm-2 2 -Y767L-F:CTAGCCCTCTTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.25)

[0080] Primer pair 11-Tm-2 2 -Y767L-R:ACTAAAGAGGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.26)

[0081] Primer pair 12-Tm-2 2 -Y767K-F:CTAGCCAAATTTAGTGTAGACCGTTATATACTGGC; (SEQ IDNO.27)

[0082] Primer pair 12-Tm-2 2 -Y767K-R:CACTAAATTTGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.28)

[0083] Primer pair 13-Tm-2 2 -Y767M-F: CTAGCCATGTTTAGTGTAGACCGTTATATACTGG; (SEQ IDNO.29)

[0084] Primer pair 13-Tm-2 2 -Y767M-R: CTAAATACGGCTAGAGTAAGCTTGATGAGATTTG. (SEQ IDNO.30)

[0085] Primer pair 14-Tm-2 2 -Y767P-F: CTAGCCCCCTTTAGTGTAGACCGTTATATACTGG; (SEQ IDNO.31)

[0086] Primer pair 14-Tm-2 2-Y767P-R:CTAAAGGGGGCTAGAGTAAGCTTGATGAGATTTG。(SEQ IDNO.32)

[0087] Liquid 15-Tm-2 2 -Y767S-F:CTAGCCCTCCTTTAGTGTAGACCGTTATATACTGGC;(SEQ IDNO.33)

[0088] Liquid 15-Tm-2 2 -Y767S-R:ACTAAAGGAGGCTAGAGTAAGCTTGATGAGATTTG。(SEQ IDNO.34)

[0089] Indicator 16-Tm-2 2 -Y767T-F:TAGCCACCTTTAGTGTAGACCGTTATATACTGGC;(SEQ IDNO.35)

[0090] Indicator 16-Tm-2 2 -Y767T-R:ACTAAAGGTGGCTAGAGTAAGCTTGATGAGATTT。(SEQ IDNO.36)

[0091] Indicator 17-Tm-2 2 -Y767W-F:TAGCCTGGTTTAGTGTAGACCGTTATATACTGGC;(SEQ IDNO.37)

[0092] Indicator 17-Tm-2 2 -Y767W-R:ACTAAACCAGGCTAGAGTAAGCTTGATGAGATTT。(SEQ IDNO.38)

[0093] Indicator 18-Tm-2 2 -Y767V-F:TAGCCGTCTTTAGTGTAGACCGTTATATACTGGC;(SEQ IDNO.39)

[0094] Indicator 18-Tm-2 2 -Y767V-R:ACTAAAGACGGCTAGAGTAAGCTTGATGAGATTT。(SEQ IDNO.40)

[0095] First, prepare 50 μL of mutation PCR reaction system, which includes: 25 μL of buffer, 1 μL of 10 mM dNTP, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 1 μL of 1 U / μL DNA high-fidelity polymerase, 0.5 μL of 30 ng / μL pFGCTm-22, and 20.5 μL of double distilled water.

[0096] Then, the mutation PCR reaction was carried out, and the reaction procedure was as follows: 95℃ pre-denaturation for 3min, 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 2min 35s, 15 cycles, 48℃ annealing for 30s, and 72℃ extension for 5min. The amplified product was transferred into E. coli DH5α competent cells, from which plasmids were extracted and the plasmids with the correct plasmid size were screened. A total of 18 Tm-2 2 Mutant plasmids.

[0097] The infectious clone pCBToBRFV was constructed by conventional PCR (reference Yan ZY, Ma HY, Wang L, Tettey C, Zhao MS, Geng C, Tian YP, and Li XD. Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm-2 2 MP was amplified from the pCam-35S binary expression vector (resistance gene.Molecular Plant Pathology.2021,11,(22):1347–1357), and the amplified product was cloned into the pCam-35S binary expression vector between the 35S promoter and the NOS terminator by homologous recombination to obtain pCamToBRFV-MP. The sequence of MP is the sequence encoded by the ToBRFV-SD isolate (NCBI accession number MT018320).

[0098] The 18 Tm-2 2 The mutant plasmid and the pCamToBRFV-MP plasmid expressing ToBRFV MP were transformed into Agrobacterium GV3101 competent cells. 2 OD of Agrobacterium containing mutant plasmid and pCamToBRFV-MP 600 Adjust to 0.5, and then mix the two in a volume ratio of 1:1. Inject the mixed Agrobacterium into the leaves of Nicotiana benthamiana, and observe the necrosis of the leaves in the inoculated area 2 days after inoculation.

[0099] The results showed that the 18 Tm-2 2 In the mutant plasmid, mutant Tm-2 2 -Mut3-1(Y767W) can react with ToBRFV MP to induce obvious cell necrosis, while mutant Tm-2 2 -Mut3-2(Y767F) reacted with ToBRFV MP to induce weak cell necrosis ( Figure 3 ).

[0100] The obtained pFGCTm-2 2 -Mut3-1, pFGCTm-2 2 -Mut3-2, empty vector pFGC5941, wild-type pFGCTm-2 2 and the infectious clone pCBToBRFV were transformed into competent Agrobacterium GV3101. 2 -Mut3 Agrobacterium, pFGC5941 Agrobacterium, pFGCTm-2 2 OD of Agrobacterium tumefaciens and pCBToBRFV Agrobacterium 600 Adjust to 0.5, then carry pFGCTm-2 2 -Mut3 Agrobacterium, pFGC5941 Agrobacterium and pFGCTm-2 2 Agrobacterium carrying pCBToBRFV was mixed with Agrobacterium carrying pCBToBRFV at a volume ratio of 1:1. The mixed Agrobacterium was injected into Nicotiana benthamiana leaves. Three days after inoculation, the total protein of the leaves in the inoculated area was extracted. The accumulation of coat protein (CP) was detected by Western blot.

[0101] The results are as follows Figure 4 As shown, the results showed that compared with the control (empty vector pFGC5941, wild-type pFGCTm-2 2 ) compared to Tm-2 2 -Mut3-1, Tm-2 2 -Mut3-2 can reduce the accumulation of ToBRFV capsid protein (CP), among which Tm-2 2 -Mut3-1 has a more significant effect. Based on this result, subsequent experiments will mainly focus on Tm-2 2 -Mut3-1 was the research object to explore its resistance to ToBRFV.

[0102] Mutant Tm-2 2 -Mut3-1 nucleotide mutations were A2300G, C2301G ( Figure 1 ), the corresponding amino acid mutation is Y767W( Figure 2 ).

[0103] 2. Tm-2 2 -Study on disease resistance of Mut3-1 mutant

[0104] pFGCTm-2 2 and pFGCTm-2 2 -Mut3-1 was co-expressed with TMV and ToBRFV MP. 2 Mutant plasmid (or pFGCTm-2 2 OD of Agrobacterium tumefaciens with pCamToBRFV-MP 600 Adjust to 0.5, and then mix the two in a volume ratio of 1:1. Inject the mixed Agrobacterium into the leaves of Nicotiana benthamiana, and observe the necrosis of the leaves in the inoculated area 2 days after inoculation.

[0105] The obtained pFGCTm-2 2 -Mut3-1 was co-expressed with plasmids expressing TMV MP, ToMV MP, and ToMMV MP, respectively.

[0106] Phenotypic observations showed that Tm-2 2 Can react with TMV MP to induce cell necrosis, but not with ToBRFV MP; Tm-2 2 -Mut3-1 not only reacts with TMV MP, but also reacts with ToBRFV MP to induce cell necrosis ( Figure 5 In addition, the co-expression experiment results showed that Tm-2 2 -Mut3-1 can also react with ToMV and ToMMV MP to induce cell necrosis (right). The above results show that Tm-2 2 -Mut3-1 can mediate resistance to ToBRFV while retaining resistance to TMV, ToMV and ToMMV.

[0107] The obtained pFGCTm-2 2 -Mut3-1, empty vector pFGC5941, wild-type pFGCTm-2 2 and the infectious clone pCBToBRFV were transformed into competent Agrobacterium GV3101. 2 -Mut3-1 Agrobacterium, pFGC5941 Agrobacterium, pFGCTm-2 2 OD of Agrobacterium tumefaciens and pCBToBRFV Agrobacterium 600 Adjust to 0.5, then carry pFGCTm-2 2 -Mut3-1 Agrobacterium, pFGC5941 Agrobacterium and pFGCTm-2 2Agrobacterium carrying pCBToBRFV was mixed with Agrobacterium carrying pCBToBRFV at a volume ratio of 1:1. The mixed Agrobacterium was injected into Nicotiana benthamiana leaves. Three days after inoculation, the total protein of the leaves in the inoculated area was extracted. The accumulation of coat protein (CP) was detected by Western blot.

[0108] Using the same method as above, pFGCTm-2 2 -Mut3-1 and empty vector pFGC5941 were co-expressed with infectious clones of TMV, ToMV, and ToMMV, respectively. The construction of TMV infectious clone was based on Yan ZY, Ma HY, Wang L, Tettey C, Zhao MS, Geng C, Tian YP, and Li XD. Identification of genetic determinants of tomato brown rugose fruit virus that enable infection of plants harbouring the Tm-22 resistance gene. Molecular Plant Pathology.2021,11,(22):1347–1357; The construction of ToMV infectious clone was carried out by amplifying the full length of ToMV using primers PCB301-ToMV-F: TTTCATTTGGAGAGGGTATTTATTATTACAACAATTACC, PCB301-ToMV-R: GATATAAGTACAGACTGGGCCCCTACCGGGGGTTCCGG and cloning it between the 35S promoter and NOS terminator of the binary expression vector pCB301; The construction of ToMMV infectious clone was based on the reference Tettey Carlos, Yan, ZY, Ma, HY, Zhao MS, Geng C, Tian YP, LiXD. Tomato mottle mosaic virus: characterization, resistance gene effectiveness, and quintuplex RT-PCR detection system. Journal of Integrative Agriculture.2022,21,(9):2641-2651. Western blot was used to detect the accumulation of coat protein (CP).

[0109] The results are as follows Figure 6As shown, the results showed that compared with the control (empty vector pFGC5941, wild-type pFGCTm-2 2 ) compared to Tm-2 2 -Mut3-1 can significantly reduce the accumulation of ToBRFV capsid protein (CP). In addition, the co-expression experiment results showed that Tm-2 2 -Mut3-1 also significantly reduced the accumulation of TMV, ToMV, and ToMMV CP.

[0110] Example 2: Tm-2 2 -Construction of Mutant 4 and Study on Disease Resistance

[0111] 1. Tm-2 2 - Construction of Mut4 mutant

[0112] The mutant Tm-2 was obtained by site-directed mutagenesis using the following primers: 2 -Amplified fragment of the mutation at nucleotide position 1062 of Mut3-1.

[0113] Primer pair 19-Tm-2 2 -A1062G-F:gccgctagccatagtggtgactgcaggcatgttaag; (SEQ IDNO.41)

[0114] Primer pair 19-Tm-2 2 -A1062G-R: actatggctagcggcatacctccacatctcccaactata. (SEQ ID NO.42)

[0115] First, prepare 50 μL of mutation PCR reaction system, which includes: 25 μL buffer, 1 μL 10 mM dNTP, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 1 μL 1U / μL DNA high-fidelity polymerase, 30 ng / μL pFGCTm-2 2 0.5μL, double distilled water 20.5μL.

[0116] Then, the mutation PCR reaction was carried out, and the reaction procedure was as follows: 95℃ pre-denaturation for 3min, 95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 2min 35s, 15 cycles, 48℃ annealing for 30s, and 72℃ post-extension for 5min. The amplified product was transferred into Escherichia coli DH5α competent cells, plasmids were extracted from them, plasmids with the correct plasmid size were screened, and Tm-2 was constructed. 2 -Mut4 mutant.

[0117] The above primer pair 19 was used to amplify Tm-2 by site-directed mutagenesis.2 The amplified fragment of the 1062nd nucleotide mutation of the gene was constructed by the same method to obtain a single-site mutation plasmid (Tm-2 2 -Mut2 mutant plasmid).

[0118] 2. Tm-2 2 -Study on disease resistance of Mut4 mutant

[0119] pFGCTm-2 2 and pFGCTm-2 2 -Mut4 was co-expressed with TMV and ToBRFV MP. 2 Mutant plasmid (or pFGCTm-2 2 OD of Agrobacterium tumefaciens with pCamToBRFV-MP 600 Adjust to 0.5, and then mix the two in a volume ratio of 1:1. Inject the mixed Agrobacterium into the leaves of Nicotiana benthamiana, and observe the necrosis of the leaves in the inoculated area 2 days after inoculation.

[0120] The obtained pFGCTm-2 2 -Mut4 was co-expressed with plasmids expressing TMV MP, ToMVMP, and ToMMV MP, respectively.

[0121] Phenotypic observations showed that Tm-2 2 Can react with TMV MP to induce cell necrosis, but not with ToBRFV MP; Tm-2 2 -Mut4 not only reacts with TMV MP, but also reacts with ToBRFV MP to induce cell necrosis ( Figure 7 In addition, the co-expression experiment results showed that Tm-2 2 -Mut4 can also react with ToMV and ToMMV MP to induce cell necrosis ( Figure 7 The above results show that Tm-2 2 -Mut4 can mediate resistance to ToBRFV while retaining resistance to TMV, ToMV and ToMMV.

[0122] The obtained pFGCTm-2 2 -Mut4, pFGCTm-2 2 -Mut3-1, pFGCTm-2 2 -Mut2, wild-type pFGCTm-2 2 and the infectious clone pCBToBRFV were transformed into competent Agrobacterium GV3101. 2 -Mut4 Agrobacterium, pFGCTm-22 -Mut3-1 Agrobacterium, pFGCTm-2 2 -Mut2 Agrobacterium, pFGCTm-2 2 The OD600 of Agrobacterium tumefaciens and pCBToBRFV was adjusted to 0.5, and then the Agrobacterium carrying pFGCTm-2 2 Agrobacterium tumefaciens and pFGCTm-2 2 Agrobacterium carrying pCBToBRFV was mixed with Agrobacterium carrying pCBToBRFV at a volume ratio of 1:1. The mixed Agrobacterium was injected into Nicotiana benthamiana leaves, and the total protein of the leaves in the inoculated area was extracted 3 and 6 days after inoculation. The accumulation of coat protein (CP) was detected by Western blot.

[0123] The results are as follows Figure 8 The results showed that: on the 3rd and 6th days after inoculation, compared with the control (wild-type pFGCTm-2 2 ) compared to Tm-2 2 -Mut2, Tm-2 2 -Mut3, Tm-2 2 -Mut4 can significantly reduce the accumulation of ToBRFV capsid protein (CP). On the third day after inoculation, the three mutants had almost no difference in the accumulation of ToBRFV capsid protein (CP), but on the sixth day after inoculation, Tm-2 2 -Mut4 is better than Tm-2 2 -Mut2, Tm-2 2 -Mut3-1 can significantly reduce the accumulation of ToBRFV capsid protein (CP). We believe that Tm-2 2 -Mut4 has both Tm-2 2 -Mut2, Tm-2 2 - Advantages of Mut3-1, compared with Tm-2 2 -Mut2 enhances recognition of ToBRFVMP, compared with Tm-2 2 -Mut3-1 enhances the activation of Tm-2 2 The efficiency of inducing necrosis was significantly reduced in the three mutants. On the third day, all three mutants could significantly inhibit the infection of ToBRFV. 2 -Mut4 has a stronger inhibitory effect and produces fewer viruses after co-expression with ToBRFV. 2 -Mut2 and Tm-2 2 -Mut3-1 protein cannot completely resist ToBRFV infection, and the virus proliferates rapidly. 2 -Mut4's advantages are reflected. In actual production, Tm-2 2-Mut4's inhibitory effect on ToBRFV is more conducive to the plant's ability to almost completely inhibit the proliferation of ToBRFV in the early stages of virus infection, avoiding the risk of virus outbreaks in the later stages.

[0124] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A mutant resistant to tomato brown fruit virus, characterized in that: The mutant is Tm-2 2 -Mut3-1 or Tm-2 2 -Mut4; Tm-2 2 - The amino acid sequence of Mut3-1 is shown in SEQ ID NO.2; Tm-2 2 -The amino acid sequence of Mut4 is shown in SEQ ID NO.

4.

2. The gene encoding the mutant according to claim 1.

3. The coding gene according to claim 2, characterized in that The coding gene is a nucleic acid molecule shown in any one of the following i)-iv): i) the nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.1; ii) a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 other than i); iii) the nucleotide sequence is the nucleic acid molecule shown in SEQ ID NO.3; iv) a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.4 except iii).

4. A recombinant expression vector or engineered bacteria comprising the coding gene according to claim 3.

5. Use of the mutant according to claim 1 in the following (1) or (2): (1) Prevent and control tomato brown wrinkled fruit virus disease; (2) Preparation of products for preventing and treating tomato brown wrinkled fruit virus disease; The plant is tomato or tobacco.

6. Use of the coding gene according to claim 2 or 3 or the recombinant expression vector or engineered bacteria according to claim 4 in the following (1) or (2): (1) Prevent and control tomato brown wrinkled fruit virus disease; (2) Cultivate plant varieties resistant to tomato brown fruit virus; The plant is tomato or tobacco.

7. A method for improving the resistance of tomatoes or tobacco to ToBRFV, characterized in that: The following steps are involved: Tomato Tm-2 2 The nucleotide at position 2300 of the coding region sequence of the gene is mutated from A to G, and the nucleotide at position 2301 is mutated from C to G, thereby encoding the amino acid sequence shown in SEQ ID NO.2; Or, tomato Tm-2 2 The nucleotide at position 1062 of the coding region sequence of the gene is mutated from A to G, the nucleotide at position 2300 is mutated from A to G, and the nucleotide at position 2301 is mutated from C to G, thereby encoding the amino acid sequence shown in SEQ ID NO.4; Alternatively, the gene encoding the mutant resistant to tomato brown wrinkled fruit virus according to claim 3 is exogenously introduced into tomatoes or tobacco.

Images