A recombinant Yarrowia lipolytica strain producing sakura sakura

Abstract

The present invention relates to the field of genetic engineering and the field of microbial fermentation technology, and discloses a recombinant Yarrowia lipolytica strain for producing sakura chlorophyll, a construction method and an application thereof, wherein the recombinant Yarrowia lipolytica strain is obtained by genetically modifying a starting strain, and compared with the starting strain, the Ku70 gene of the recombinant Yarrowia lipolytica strain is replaced by the OsNOMT gene; the activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced. The present invention constructs a Yarrowia lipolytica strain by genetic engineering, and the strain can increase the activity of NOMT, thereby increasing the amount of sakura chlorophyll synthesis.

Description

Technical Field

[0001] The invention relates to the fields of genetic engineering and microbial fermentation technology, and in particular to a recombinant Yarrowia lipolytica strain for producing sakura sakura extract, a construction method and application thereof. Background Art

[0002] Sakurain is a 7-O-methylated derivative of the citrus flavanone naringenin, which was first isolated from cherry bark. Studies have shown that sakurain has anti-inflammatory, antibacterial, anti-tumor and immunomodulatory effects, and has been widely used in the cosmetics and pharmaceutical industries. In terms of chemical structure, the chemical name of sakurain is 4'-5-dihydroxy-7-methoxyflavanone, which consists of two fused rings A and C and a benzene ring B, which is connected to the C ring at the C-2 position. Sakurain is synthesized in plants from the general precursor of flavanone naringenin under the catalysis of naringenin 7-O-methyltransferase (NOMT). In this process, S-adenosylmethionine (SAH) is used as a methyl donor to provide the methyl part to produce the corresponding sakurain product. In the case of excessive accumulation of the precursor naringenin, increasing the supply of SAM is expected to increase the production of sakurain. However, in the process of naringenin using SAM to transmethylate sakurain, a byproduct S-adenosyl-L-homocysteine ​​(SAH) is produced. The accumulation of this byproduct inhibits the activity of NOMT, thereby causing a significant decrease in the synthesis of sakurain.

[0003] Yarrowia lipolytica ( Yarrowia lipolytica ) is an unconventional yeast belonging to the Hemiascomycetes. As one of the most widely studied unconventional yeasts, it has relatively clear physical and chemical characteristics and genetic background and is considered to be a GRAS strain. At the same time, it has excellent properties such as strong stress resistance, rich substrate spectrum, the ability to use a variety of cheap renewable substrates as carbon sources, and the production of abundant precursor acetyl-CoA in the cell. It has been developed as a microbial cell factory for a variety of fine chemicals and natural products, including citric acid, polyunsaturated fatty acids, isoprenoid compounds, etc.

[0004] Those skilled in the art should understand that there is more than one metabolic pathway for microorganisms, and improving different metabolic pathways will bring unexpected technical effects. However, there are currently few reports on the use of Yarrowia lipolytica to increase the activity of NOMT and thus increase the amount of sakura glycoside synthesis. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a recombinant Yarrowia lipolytica strain for producing sakura vinifera, a construction method and an application. The present invention constructs a Yarrowia lipolytica strain through genetic engineering, and the strain can increase the activity of NOMT, thereby increasing the synthesis amount of sakura vinifera.

[0006] The present invention provides a recombinant Yarrowia lipolytica strain for producing sakura chlorophyll. The recombinant Yarrowia lipolytica strain is obtained by genetically modifying a starting strain. Compared with the starting strain, the Ku70 gene of the recombinant Yarrowia lipolytica strain is replaced by the OsNOMT gene.

[0007] The activities of S-adenosylhomocysteine ​​hydrolase (SAHH), adenosine kinase (ADO) and adenosine deaminase (TAD) of the recombinant Yarrowia lipolytica strain are enhanced.

[0008] Furthermore, the nucleotide sequence of the OsNOMT gene is shown in SEQ ID No.1.

[0009] Furthermore, the nucleotide sequence of the Ku70 gene is shown in SEQ ID No.2.

[0010] Furthermore, the starting strain is Yarrowia lipolytica Po1f MYA-2613.

[0011] Furthermore, the nucleotide sequence of the S-adenosylhomocysteine ​​hydrolase is shown in SEQ ID No.6.

[0012] Furthermore, the nucleotide sequence of the adenosine kinase is shown in SEQ ID No.7.

[0013] Furthermore, the nucleotide sequence of the adenosine deaminase is shown in SEQ ID No.8.

[0014] Furthermore, the activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced by overexpressing the following genes (a)-(c):

[0015] (a) From the promoter P TEF The gene encoding the regulated S-adenosylhomocysteine ​​hydrolase;

[0016] (b) by promoter P EXP Gene encoding the regulated adenosine kinase;

[0017] (c) by promoter P GPD The gene encoding the regulated adenosine deaminase.

[0018] Furthermore, the promoter P TEF The nucleotide sequence is shown in SEQ ID No.3.

[0019] Furthermore, the promoter P EXP The nucleotide sequence is shown in SEQ ID No.4.

[0020] Furthermore, the promoter PGPD The nucleotide sequence is shown in SEQ ID No.5.

[0021] The present invention also provides a method for constructing the recombinant Yarrowia lipolytica strain producing sakura chlorophyll, the method comprising:

[0022] The starting strain is genetically modified, the Ku70 gene in the starting strain is replaced by the OsNOMT gene to obtain an intermediate strain, and the intermediate strain is further genetically modified to obtain a recombinant Yarrowia lipolytica strain with enhanced activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase.

[0023] Furthermore, the starting strain is Yarrowia lipolytica Po1f MYA-2613.

[0024] Furthermore, the nucleotide sequence of the OsNOMT gene is shown in SEQ ID No.1.

[0025] Furthermore, the nucleotide sequence of the Ku70 gene is shown in SEQ ID No.2.

[0026] Furthermore, the method for preparing the intermediate strain is: integrating a linear vector carrying the homologous arms at both ends of the Ku70 gene and the integration expression frame of the OsNOMT gene into the site of the Ku70 gene of the starting strain by the lithium acetate method, and integrating the OsNOMT gene into the strain while knocking out the Ku70 gene of the starting strain to serve as the intermediate strain.

[0027] Furthermore, the preparation steps of the recombinant Yarrowia lipolytica strain include:

[0028] The prepared intermediate strain was used as the starting strain, and the intermediate strain was cultured to the exponential growth phase, the cells were collected, centrifuged and the supernatant was discarded, and P was added. TEF -SAHH-P EXP -ADO-P GPD -TAD expression cassette, mixed well, incubated at 37°C for 1 hour, and then coated on uracil-deficient solid culture medium plates to screen out recombinant Yarrowia lipolytica strains.

[0029] The present invention also provides application of the recombinant Yarrowia lipolytica strain in fermentation synthesis of sakura glycosides.

[0030] Further, the fermentation medium synthesized by fermentation includes 2g / L-4g / L of amino-free yeast nitrogen source, 1g / L-3g / L of yeast extract, 4g / L-8g / L of ammonium sulfate, 40g / L-60g / L of glucose, 0.1g / L-0.3g / L of calcium chloride, 0.4g / L-0.8g / L of potassium sulfate, 0.6g / L-0.8g / L of sodium chloride, 6mg / L-9mg / L of ferrous sulfate heptahydrate, 4mg / L-6mg / L of calcium pantothenate, 2mg / L-5mg / L of manganese chloride tetrahydrate, 0.06mg / L-0.1mg / L of sodium molybdate dihydrate, 6mg / L-8mg / L of vitamin B6, and 1.5mg / L of vitamin B12. 4mg / L-6mg / L, L-leucine 0.15g / L-0.2g / L, L-methionine 0.2g / L-0.4g / L, L-tyrosine 0.08g / L-0.12g / L, L-histidine 0.02g / L-0.06g / L, naringenin 1g / L-1.8g / L.

[0031] Furthermore, the pH of the fermentation medium is 5.6.

[0032] Furthermore, the fermentation culture conditions include: culture temperature 26°C-29°C, culture at 170rpm-190rpm for 23h-25h.

[0033] Furthermore, the inoculation amount of the recombinant Yarrowia lipolytica strain is 1% of the volume of the fermentation medium.

[0034] The embodiments of the present invention have the following technical effects:

[0035] 1. The recombinant Yarrowia lipolytica strain of the present invention overexpresses endogenous S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase. The metabolic pathway can effectively promote the hydrolysis of S-adenosyl-L-homocysteine, a byproduct of the synthesis of sakura glycosides, effectively reduce its inhibitory effect on NOMT, and improve the synthesis of sakura glycosides in the genetically engineered strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 It is a data diagram provided by the embodiments and comparative examples of the present invention.

[0038] Figure 2 It is a schematic diagram of the overexpressed gene provided in the embodiment of the present invention.

[0039] Figure 3 It is the result of sakura pigment produced over time in the examples and comparative examples of the present invention. DETAILED DESCRIPTION

[0040] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0041] In a first aspect, some embodiments of the present invention provide a recombinant Yarrowia lipolytica strain for producing sakura chlorophyll, wherein the recombinant Yarrowia lipolytica strain is obtained by genetically modifying a starting strain, and compared with the starting strain, the Ku70 gene of the recombinant Yarrowia lipolytica strain is replaced by the OsNOMT gene;

[0042] The activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced.

[0043] In the present invention, by replacing some genes in the recombinant Yarrowia lipolytica, it is beneficial for the recombinant Yarrowia lipolytica strain to ferment and synthesize sakuramin, and by increasing the activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain, the yield of sakuramin synthesized by the recombinant Yarrowia lipolytica strain is increased.

[0044] In some embodiments, the nucleotide sequence of the OsNOMT gene is shown as SEQ ID No.1.

[0045] In some embodiments, the nucleotide sequence of the Ku70 gene is shown as SEQ ID No.2.

[0046] In some embodiments, the starting strain is Yarrowia lipolytica Po1f MYA-2613.

[0047] In some embodiments, the activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced by overexpressing the following genes (a)-(c):

[0048] (a) From the promoter P TEF The gene encoding the regulated S-adenosylhomocysteine ​​hydrolase;

[0049] (b) by promoter P EXP Gene encoding the regulated adenosine kinase;

[0050] (c) by promoter P GPD The gene encoding the regulated adenosine deaminase.

[0051] In some embodiments, the promoter P TEF The nucleotide sequence is shown in SEQ ID No.3.

[0052] In some embodiments, the promoter P EXP The nucleotide sequence is shown in SEQ ID No.4.

[0053] In some embodiments, the promoter P GPD The nucleotide sequence is shown in SEQ ID No.5.

[0054] In some embodiments, the nucleotide sequence of the S-adenosylhomocysteine ​​hydrolase is shown as SEQ ID No.6.

[0055] In some embodiments, the nucleotide sequence of the adenosine kinase is shown as SEQ ID No.7.

[0056] In some embodiments, the nucleotide sequence of the adenosine deaminase is shown as SEQ ID No.8.

[0057] In a second aspect, some embodiments of the present invention also provide a method for constructing the recombinant Yarrowia lipolytica strain producing sakura chlorophyll, the method comprising:

[0058] The starting strain is genetically modified, the Ku70 gene in the starting strain is replaced by the OsNOMT gene to obtain an intermediate strain, and the intermediate strain is further genetically modified to obtain a recombinant Yarrowia lipolytica strain with enhanced activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase.

[0059] In some embodiments, the starting strain is Yarrowia lipolytica Po1f MYA-2613.

[0060] In some embodiments, the nucleotide sequence of the OsNOMT gene is shown as SEQ ID No.1.

[0061] In some embodiments, the nucleotide sequence of the Ku70 gene is shown as SEQ ID No.2.

[0062] In some embodiments, the method for preparing the intermediate strain is: integrating a linear vector carrying the homologous arms at both ends of the Ku70 gene and the integration expression frame of the OsNOMT gene into the site of the Ku70 gene of the starting strain by the lithium acetate method, and integrating the OsNOMT gene into the strain while knocking out the Ku70 gene of the starting strain to serve as an intermediate strain.

[0063] In some embodiments, the steps of preparing the recombinant Yarrowia lipolytica strain include:

[0064] The prepared intermediate strain was used as the starting strain, and the intermediate strain was cultured to the exponential growth phase, the cells were collected, centrifuged and the supernatant was discarded, and P was added. TEF -SAHH-P EXP -ADO-P GPD -TAD expression cassette, mixed and incubated at 37°C for 1 hour, and then coated on uracil-deficient solid culture medium plates to screen out recombinant Yarrowia lipolytica strains.

[0065] In a third aspect, some embodiments of the present invention also provide the use of the recombinant Yarrowia lipolytica strain in fermentation synthesis of sakuramin.

[0066] In some embodiments, the fermentation medium synthesized by fermentation includes 2g / L-4g / L of amino-free yeast nitrogen source, 1g / L-3g / L of yeast extract, 4g / L-8g / L of ammonium sulfate, 40g / L-60g / L of glucose, 0.1g / L-0.3g / L of calcium chloride, 0.4g / L-0.8g / L of potassium sulfate, 0.6g / L-0.8g / L of sodium chloride, 6mg / L-9mg / L of ferrous sulfate heptahydrate, 4mg / L-6mg / L of calcium pantothenate, 2mg / L-5mg / L of manganese chloride tetrahydrate, 0.06mg / L-0.1mg / L of sodium molybdate dihydrate, 6mg / L-8mg / L of vitamin B6, and 1.5mg / L of vitamin B12. 4mg / L-6mg / L, L-leucine 0.15g / L-0.2g / L, L-methionine 0.2g / L-0.4g / L, L-tyrosine 0.08g / L-0.12g / L, L-histidine 0.02g / L-0.06g / L, naringenin 1g / L-1.8g / L.

[0067] In some embodiments, the pH of the fermentation medium is 5.6.

[0068] In some embodiments, the fermentation culture conditions include: culture temperature of 26° C.-29° C., and culture at 170 rpm-190 rpm for 23 h-25 h.

[0069] In some embodiments, the inoculation amount of the recombinant Yarrowia lipolytica strain is 1% of the volume of the fermentation medium.

[0070] The following is described in conjunction with some embodiments:

[0071] Embodiment 1:

[0072] Starting strain: Yarrowia lipolytica Po1f MYA-2613 (purchased from American Type Culture Collection, ATCC MYA-2613).

[0073] Solid plate YPD culture medium, its ingredients include: peptone 20g / L, yeast extract 10g / L, glucose 20g / L, agar 20g / L.

[0074] The uracil-deficient plate culture medium comprises the following components: 1.7 g / L amino-free yeast nitrogen source, 5 g / L ammonium sulfate, 20 g / L glucose, 0.5 g / L L-leucine, and 20 g / L agar.

[0075] The pH of the seed culture medium is 5.6, and its ingredients include: 1.7 g / L amino-free yeast nitrogen source, 2.8 g / L yeast extract, 2.4 g / L ammonium sulfate, 30 g / L glucose, 0.15 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.8 g / L sodium chloride, 6 mg / L ferrous sulfate heptahydrate, 3 mg / L calcium pantothenate, 3 mg / L manganese chloride tetrahydrate, 0.05 mg / L sodium molybdate dihydrate, 6 mg / L vitamin B6, and 2 mg / L vitamin B12.

[0076] The pH of the fermentation medium is 5.6, and its ingredients include: 3.5 g / L amino-free yeast nitrogen source, 2.5 g / L yeast extract, 5 g / L ammonium sulfate, 60 g / L glucose, 0.2 g / L calcium chloride, 0.6 g / L potassium sulfate, 0.8 g / L sodium chloride, 8 mg / L ferrous sulfate heptahydrate, 5 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.08 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, 4 mg / L vitamin B12, 0.2 g / L L-leucine, 0.4 g / L L-methionine, 0.12 g / L L-tyrosine, 0.06 g / L L-histidine, and 1.8 g / L naringenin.

[0077] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride.

[0078] (1) Based on the sequence information of the Ku70 gene in Yarrowia lipolytica Po1f MYA-2613, primers Ku70UP-F, Ku70UP-R, Ku70DOWN-F and Ku70DOWN-R as shown in SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 and SEQ ID No.12 were designed. The genome of Yarrowia lipolytica Po1f MYA-2613 was used as a template, and the primers Ku70UP-F, Ku70UP and Ku70DOWN-F, Ku70DOWN-R were used to configure the PCR reaction system using PrimeStar high-fidelity DNA polymerase to amplify the upstream (SEQ ID No.13) and downstream (SEQ ID No.14) fragments of the Ku70 gene, thereby obtaining the upstream and downstream fragments of the Ku70 gene as the upstream and downstream homology arms for homologous recombination. The PCR reaction program was: 95°C for 5 min, 95°C for 30 s, 58°C for 30 s, and 72°C for 40 s. 33 cycles were set starting from the second step. The PCR products were verified by agarose gel electrophoresis and then recovered and purified.

[0079] (2) The vector plasmid pUC-HUH-TEF was digested with restriction endonuclease EcoRI, verified by agarose gel electrophoresis and recovered. Enzyme digestion system (50μL): 4000μg of vector plasmid, 2μL of EcoRI enzyme, 5μL of 10×QCutBuffer, 50μL of ddH2O upto. The digested vector pUC-HUH-TEF fragment was connected with the Ku70 upstream homology arm fragment (SEQ ID No.13) amplified using SEQ ID No.9 and SEQID No.10 mentioned above by one-step cloning to obtain the upstream homology arm vector pUC-Ku70UP-HUH-TEF. One-step cloning system (10μL): 4μL of target gene fragment, 1μL of vector digested fragment, 5μL of 2×ClonExpressMix, 50℃ connection for 50min. The ligation product was further transformed into E. coli DH5α competent cells, and the transformation method was as follows:

[0080] 1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0081] 2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0082] 3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0083] 4) Take 200 μL and spread it on LB plate containing 100 μg / mL ampicillin. Invert and culture at 37°C overnight. Select positive transformants, extract plasmids, and sequence verification results show that the connection is successful, and obtain the upstream homology arm vector pUC-Ku70UP-HUH-TEF.

[0084] (3) The vector plasmid pUC-Ku70UP-HUH-TEF was digested with restriction endonuclease NotI, verified by agarose gel electrophoresis and recovered. Enzyme digestion system (50μL): 4000μg of vector plasmid, 2μL of NotI enzyme, 5μL of 10×QCutBuffer, 50μL of ddH2O. The digested vector pUC-Ku70UP-HUH-TEF fragment was connected with the Ku70 downstream homology arm fragment (SEQ ID No.14) amplified using SEQ ID No.11 and SEQ ID No.12 by one-step cloning to obtain the homology arm vector pUC-Ku70-HUH-TEF. One-step cloning system (10μL): 4μL of target gene fragment, 1μL of vector digested fragment, 5μL of 2×ClonExpressMix, 50℃ connection for 50min. Repeat the above transformation steps to obtain the homology arm vector pUC-Ku70-HUH-TEF.

[0085] (4) Based on the sequence information of the OsNOMT gene in Oryza sativa (SEQ ID No.1), the gene was synthesized by Bioengineering and the primers OsNOMT-F and OsNOMT-R as shown in SEQ ID No.15 and SEQ ID No.16 were designed. The synthesized DNA was used as a template, and the primers OsNOMT-F and OsNOMT-R were used to configure the PCR reaction system using PrimeStar high-fidelity DNA polymerase. The primers contained sequences homologous to the homology arm vector pUC-Ku70-HUH-TEF. The PCR reaction program was: 95℃ 5min, 95℃ 30s, 58℃ 30s, 72℃ 40s, and 33 cycles were set from the second step. After the PCR product was obtained, it was verified by agarose gel electrophoresis and then excised and recovered and purified.

[0086] (5) The vector plasmid pUC-Ku70-HUH-TEF was digested with restriction endonuclease BamHI, verified by agarose gel electrophoresis and recovered. Enzyme digestion system (50μL): 4000μg of vector plasmid, 2μL of BamHI enzyme, 5μL of 10×QCutBuffer, 50μL of ddH2O. The vector pUC-Ku70-HUH-TEF fragment after enzyme digestion was connected with the OsNOMT gene fragment (SEQ ID No.6) amplified using SEQ ID No.15 and SEQ ID No.16 to obtain the recombinant vector pUC-Ku70-HUH-TEF-OsNOMT. One-step cloning system (10μL): 4μL of target gene fragment, 1μL of vector enzyme digestion fragment, 5μL of 2×ClonExpressMix, 50℃ connection for 50min. Repeat the above transformation steps to obtain the recombinant vector pUC-Ku70-HUH-TEF-OsNOMT.

[0087] (6) Using Yarrowia lipolytica Po1f MYA-2613 as the starting strain, the Po1f strain was cultured in 2 mL of YPD medium until the exponential growth phase (16 h-24 h), and the Po1f cells in 1 mL of fermentation broth were collected. After centrifugation and discarding the supernatant, a total volume of 100 μL of 80 μL of 50% (w / v) PEG4000 solution, 5 μL of lithium acetate (2 M), 5 μL of single-stranded DNA (salmon sperm), 5 μL of dithiothreitol DTT (2 M) and 5 μL of Ku70UP-NOMT-Ku70Down expression cassette (obtained by digesting the recombinant vector pUC-Ku70-HUH-TEF-OsNOMT obtained in step 5 with EcoRI and NotI) was added. After mixing, the mixture was incubated at 37°C for 1 h, and then the uracil-deficient solid culture medium plates were coated to screen for the uracil selection marker URA (nucleotide sequence as shown in SEQ ID A single colony of the recombinant strain in which the Ku70 gene (the nucleotide sequence is shown in SEQ ID No.2) was replaced by NOMT (the nucleotide sequence is shown in SEQ ID No.17).

[0088] (7) Select a single colony on the uracil-deficient plate in step (6) for colony PCR verification, and use primers UPTEST-F, UPTEST-R and DOWNTEST-F, DOWNTEST-R as shown in SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20 and SEQ ID No. 21 to verify the upstream and downstream integration of the Ku70 site, respectively. The colony PCR results of the two sites are correct, indicating that the Ku70 gene has been successfully knocked out and the NOMT gene has been integrated in situ. Subsequently, the correct strain obtained is streaked on YPD containing 1 mg / L 5-fluoroorotic acid (5-FOA) to remove the URA marker used for screening, and the recombinant strain obtained is the Yarrowia lipolytica Po1f-Ku70::OsNOMT strain (intermediate strain).

[0089] Recombinant vector pUC-HUH-P TEF -SAHH-P EXP -ADO-P GPD -TAD construction, such as Figure 2 As shown:

[0090] (1) Based on the sequence information of SAHH, ADO and TAD genes in Yarrowia lipolytica Po1f, primers SAHH-F, SAHH-R, ADO-F, ADO-R, TAD-F and TAD-R were designed as shown in SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25, SEQ ID No.26 and SEQ ID No.27, respectively. Using Po1f genome as template, primers SAHH-F, SAHH-R and ADO-F, ADO-R and TAD-F, TAD-R were used to configure the PCR reaction system using PrimerStar high-fidelity DNA polymerase to amplify the SAHH gene fragment (SEQ ID No.6), ADO gene fragment (SEQ ID No.7) and TAD gene fragment (SEQ ID No.8). The PCR reaction program was: 95°C for 5 min, 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. 33 cycles were set starting from the second step. After the PCR product was obtained and verified by agarose gel electrophoresis, it was recovered and purified.

[0091] (2) Digest the vector plasmid pUC-HUH with restriction endonuclease PacI, verify by agarose gel electrophoresis and recover the fragments. Enzyme digestion system (50 μL): 4000 μg of vector plasmid, 2 μL of PacI enzyme, 5 μL of 10×QCutBuffer, and 50 μL of ddH2O;

[0092] The vector pUC-HUH fragment after enzyme digestion was connected with the SAHH gene fragment (SEQ ID No.6) amplified using SEQ ID No.22 and SEQ ID No.23 by one-step cloning to obtain the vector pUC-HUH-P TEF -SAHH. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme digested fragment, 5 μL 2×ClonExpressMix, 50°C ligation for 50 min.

[0093] (3) The ligation product is transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0094] 1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0095] 2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0096] 3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0097] 4) Take 200 μL and spread it on LB plate containing 50 μg / mL ampicillin. Invert and culture at 37°C overnight. Select positive transformants, extract plasmids, and sequence verification results show that the connection is successful, and obtain the upstream homology arm vector pUC-HUH-P TEF -SAHH.

[0098] (4) Digest the vector plasmid pUC-HUH-P with restriction endonuclease NdeI TEF -SAHH, verified by agarose gel electrophoresis and gel recovery. Enzyme digestion system (50μL): vector plasmid 4000μg, NdeI enzyme 2μL, 10×QCutBuffer 5μL, ddH2O up to 50μL.

[0099] (5) The digested vector pUC-HUH-P was cloned into TEF -SAHH fragment and the ADO gene fragment (SEQ ID No.7) amplified using SEQ ID No.24 and SEQ ID No.25 were connected to obtain vector pUC-HUH-P TEF -SAHH-P EXP -ADO. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme-digested fragment, 5 μL 2×ClonExpressMix, 50°C ligation for 50 min.

[0100] (6) Repeat step (3) to obtain the vector pUC-HUH-PTEF -SAHH-P EXP -ADO.

[0101] (7) Digest the vector plasmid pUC-HUH-P with restriction endonuclease XbaI TEF -SAHH-P EXP -ADO, verified by agarose gel electrophoresis and gel recovery. Enzyme digestion system (50μL): vector plasmid 4000μg, XbaI enzyme 2μL, 10×QCutBuffer 5μL, ddH2O up to 50μL.

[0102] (8) The digested vector pUC-HUH-P was cloned into TEF -SAHH-P EXP -ADO fragment and the TAD gene fragment (SEQ ID No.8) amplified using SEQ ID No.26 and SEQ ID No.27 were connected to obtain vector pUC-HUH-P TEF -SAHH-P EXP -ADO-P GPD -TAD. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme digested fragment, 5 μL 2×ClonExpressMix, 50°C ligation for 50 min.

[0103] (9) Repeat step (3) to obtain the vector pUC-HUH-P TEF -SAHH-P EXP -ADO-P GPD -TAD.

[0104] Recombinant strain Yarrowia lipolytica Po1f-Ku70::OsNOMT-P TEF -SAHH-P EXP -ADO-P GPD -TAD construction:

[0105] The prepared Yarrowia lipolytica strain Po1f-Ku70::OsNOMT was used as the starting strain, and Po1f-Ku70::OsNOMT was cultured in 3 mL of YPD medium until the exponential growth phase (16-24 h), and Po1f bacteria in 1 mL of fermentation broth were collected. After centrifugation and discarding the supernatant, a total volume of 100 μL containing 80 μL of 50% (w / v) PEG4000 solution, 5 μL of lithium acetate (2 M), 5 μL of single-stranded DNA (salmon sperm), 5 μL of dithiothreitol DTT (2 M) and 5 μL of P was added. TEF -SAHH-P EXP -ADO-P GPD-TAD expression cassette (recombinant vector pUC-HUH-P obtained by digestion with EcoRI and NotI) TEF -SAHH-P EXP -ADO-P GPD -TAD was obtained), mixed and incubated at 37°C for 1 hour, and then coated on a uracil-deficient solid culture medium plate to screen for uracil selection markers URA (nucleotide sequence as shown in SEQ ID No. 17) and P TEF -SAHH-P EXP -ADO-P GPD -TAD expression frame recombinant strain single colony. The resulting strain is the recombinant strain Yarrowia lipolytica Po1f-Ku70::OsNOMT-P TEF -SAHH-P EXP -ADO-P GPD -TAD strain.

[0106] Recombinant strain Yarrowia lipolytica Po1f-Ku70::OsNOMT-P TEF -SAHH-P EXP -ADO-P GPD -Determination of sakurain in TAD engineered strains:

[0107] (1) Fermentation seed culture: The genetically engineered strain Po1f-Ku70::OsNOMT-P TEF -SAHH-P EXP -ADO-P GPD -TAD and the intermediate strain Po1f-Ku70::OsNOMT (control strain) were inoculated with single colonies in 250 mL conical flasks (containing 50 mL of seed culture medium), and cultured at 28 °C and 180 rpm in a shaking incubator for 24 h to obtain the Yarrowia lipolytica seed solution;

[0108] (2) Shake flask fermentation: The Yarrowia lipolytica seed solution obtained in step (1) was inoculated into the fermentation medium at an inoculum rate of 1% v / v, and the fermentation was carried out in a shaker at a temperature of 28° C. and a rotation speed of 180 rpm for 96 h, and samples were taken every 24 h to measure the sakura glycoside production;

[0109] (3) Determination of sakurain content: The sakurain content in the samples obtained from the sampling and the fermentation liquid obtained after the fermentation was determined by liquid chromatography. The results are shown in Figure 1 .

[0110] Figure 1 The results showed that the content of sakuramotoxin in the recombinant strain Yarrowia lipolytica genetically engineered strain overexpressing SAHH, ADO and TAD obtained by the method of the present invention reached 84.1 mg / L, which was 95.7% higher than that of the starting strain.

[0111] Fed-batch fermentation of the recombinant strain Yarrowia lipolytica in a 5 L fermenter:

[0112] (1) The recombinant strain Yarrowia lipolytica was inoculated into a 250-mL conical flask containing 15 mL of YPD medium at an inoculum volume of 1% of the culture medium volume, and cultured in a shaking incubator at 28°C and 220 rpm for 24 h to obtain a primary seed solution.

[0113] (2) The obtained first-level seed solution was inoculated into a 500-mL conical flask containing 150 mL of YPD medium at an inoculum volume of 1% of the culture medium volume. The solution was cultured in a shaking incubator at 28°C and 220 rpm for 24 h to obtain the second-level seed solution.

[0114] (3) The obtained secondary seed liquid was inoculated into a sterilized 5L fermenter containing 3L fermentation medium at an inoculation rate of 1% of the culture medium volume, and fermented for 144 hours at 30°C, aeration rate of 1.5vvm, and stirring speed of 300rpm. The pH was controlled at 5.5 and adjusted by 1M hydrochloric acid and 10M sodium hydroxide solution. The glucose concentration was maintained at 15-30g / L and fed with 800g / L glucose solution.

[0115] (4) As shown in steps (1), (2), and (3), the intermediate strain Po1f-Ku70::OsNOMT was cultured in batches using the same method as the control strain fermentation results.

[0116] (5) Samples were taken at different time points during fermentation and the content of sakurain in the fermentation supernatant was determined by liquid chromatography. The sakurain production in the fermentation tank changed over time. Figure 3 As shown. Figure 3 It can be seen that the yield of sakurabin fermented by the recombinant strain Yarrowia lipolytica genetically engineered strain of the present invention is significantly higher than that of the control strain, and can reach up to 147.3 mg / L, which is 1.61 times that of the control strain (the maximum yield of the control strain is 91.2 mg / L). It can be seen that the recombinant strain effectively relieves feedback inhibition, improves NOMT activity, and significantly increases the yield of sakurabin.

[0117] It should be noted that the terms used in the present invention are only for describing specific embodiments, rather than limiting the scope of the present application. As shown in the present specification, unless the context clearly indicates an exception, the words "one", "a", "a kind of" and / or "the" do not specifically refer to the singular, but may also include the plural. The terms "include", "comprise" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method or device. In the absence of more restrictions, the elements defined by the sentence "include one..." do not exclude the presence of other identical elements in the process, method or device including the elements.

[0118] It should also be noted that the terms "center", "up", "down", "left", "right", "vertical", "horizontal", "inside", "outside", etc., indicating the orientation or positional relationship, are based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention. Unless otherwise clearly specified and limited, the terms "installed", "connected", "connected", etc. should be understood in a broad sense, for example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be a direct connection, or it can be an indirect connection through an intermediate medium, or it can be a connection between the two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present invention.

[0120] Nucleotide sequence SEQ ID No.1:

[0121]

[0122] Nucleotide sequence SEQ ID No.2:

[0123]

[0124] Nucleotide sequence SEQ ID No. 3:

[0125] AGAGACCGGGTTGGCGGCGTATTTGTGTCCCAAAAAACAGCCCCAATTGCCCCAATTGACCCCAAATTGACCCAGTAGCGGGCCCAACCCCGGCGAGAGCCCCCTTCACCCCACATATCAAACCTCCCCCGGTTCCCACACTTGCCGTTAAGGGCGTAGGGTACTGCAGTCTGGAATCTACGCTTGTTCAGACTTTGTACTAGTTTCTTTGTCTGGCCATCCGGGTAACCCATGCCGGACGCAAAATAGACTACTGAAAATTTTTTTGCTTTGTGGTTGGGACTTTAGCCAAGGGTATAAAAGACCACCGTCCCCGAATTACCTTTCCTCTTCTTTTCTCTCTCTCCTTGTCAACTCACACCCGAAATCGTTAAGCATTTCCTTCTGAGTATAAGAATCATTCAAA。

[0126] Nucleotide sequence SEQ ID No. 4:

[0127] GgagtttggcgcccgttttttcgagCCCCACACGTTTCGGTGAGTATGAGCGGCGGCAGATTCGAGCGTTTCCGGTTTCCGCGGCgGGACGAGAGCCCATGATGGGGGCTCCCACCACCAGCAATCAGGGCCCTGATTACACACCCACCTGTAATGTCATGCTGTTCATCGTGGTTAATGCTGCTGTGTGCTGTGTGTGTGTGTTGTTTGGCGCTCATTGTTGCGTTATGCAGCGTACACCACAATATTGGAAGCTTATTAGCCTTTCTATTTTTTCGTTTGCAAGGCTTAACAACATTGCTGTGGAGAGGGATGGGGATATGGAGGCCGCTGGAGGGAGTCGGAGAGGCGTTTTGGAGCGGCTTGGCCTGGCGCCCACTCGCGAAACGCACCTAGGACCCTTTGGCACGCCGAAATGTGCCACTTTTCAGTCTAGTAACGCCTTACCTACGTCATTCCATGCATGCATGTTTGCGCCTTTTTTCCCTTGCCCTTGATCGCCACACAGTACAGTGCACTGTACAGTGGAGGTTTTGGGGGGGTCTTAGATGGGAGCTAAAAGCGGCCTAGCGGTACACTAGTGGGATTGTATGGAGTGGCATGGAGCCTgGGTGGAGCCTGACAGGACGCACGACCGGCTAGCCCGTGACAGACGATGGGTGGCTCCTGTTGTCCACCGCGTACAAATGTTTGGGCCAAAGTCTTGTCAGCCTTGCTTGCGAACCTAATTCCCAATTTTGTCACTTCGCACCCCCATTGATCGAGCCCTAACCCCTGCCCATCAGGCAATCCAATTAAGCTCGCATTGTCTGCCTTGTTTAGTTTGGCTCCTGCCCGTTTCGGCGTCCACTTGCACAAACACAAACAAGCATTATATATAAGGCTCGTCTCTCCCTCCCAACCACACTCACTTTTTTGCCCGTCTTCCCTTGCTAACACAAAAGTCAAGAACACAAACAACCACCCCAACCCCCTTACACACAAGACATATCTACAGCA。

[0128] Nucleotide sequence SEQ ID No.5:

[0129] CGCAGTAGGATGTCCTGCACGggtctttttgtggggtgtggagaaaggggtgcttggagatggaagccggtagaaccgggctgcttggggggatttggggccgctgggctccaaagaggggtaggcatttcgttggggttacgtaattgcggcatttgggtcctgcgcgcatgtcccattggtcagaattagtccggataggagacttatcagccaatcacagcgccggatccacctgtaggttgggttgggtgggagcacccctccacagagtagagtcaaacagcagcagcaacatgatagttgggggtgtgcgtgttaaaggaaaaaaaaagaagcttgggttatattcccgctctatttagaggttgcgggatagacgccgacggagggcaatggcgccatggaaccttgcggatatcgatacgccgcggcggactgcgtccgaaccagctccagcagcgttttttccgggccattgagccgactgcgaccccgccaacgtgtcttggcccacgcactcatgtcatgttggtgttgggaggccactttttaagtagcacaaggcacctagctcgcagcaaggtgtccgaaccaaagaagcggctgcagtggtgcaaacggggcggaaacggcgggaaaaagccacgggggcacgaattgaggcacgccctcgaatttgagacgagtcacggccccattcgcccgcgcaatggctcgccaacgcccggtcttttgcaccacatcaggttaccccaagccaaacctttgtgttaaaaagcttaacatattataccgaacgtaggtttgggcgggcttgctccgtctgtccaaggcaacatttatataagggtctgcatcgccggctcaattgaatcttttttcttcttctcttctctatattcattCTTGAATTAAACACACATCAACA。

[0130] Nucleotide sequence SEQ ID No.6:

[0131]

[0132] Nucleotide sequence SEQ ID No.7:

[0133]

[0134] Nucleotide sequence SEQ ID No.8:

[0135]

[0136] Nucleotide sequence SEQ ID No.9:

[0137] aaacgacggccagtgaattcacttgtagatgctGTAGAAG.

[0138] Nucleotide sequence SEQ ID No.10:

[0139] CACTGGAAGATCCGGGAATTTTTCAAAAAGCGCGGTTCG.

[0140] Nucleotide sequence SEQ ID No.11:

[0141] GGCTTTAATTTGCCAAGCTTCTAGGGAGGCACATCTAAAC.

[0142] Nucleotide sequence SEQ ID No.12:

[0143] TTACGCCAAGCTGCGGCCGCGGCAGCTACACAGATGTTGT.

[0144] Nucleotide sequence SEQ ID No.13:

[0145]

[0146] Nucleotide sequence SEQ ID No.14:

[0147]

[0148] Nucleotide sequence SEQ ID No.15:

[0149] GAGTATAAGAATCATTCAAAATGGGAGACATGGTGAGCCC.

[0150] Nucleotide sequence SEQ ID No.16:

[0151] TGACATAACTAATTACATGATTACTTTGTGAACTCGAGAG.

[0152] Nucleotide sequence SEQ ID No.17:

[0153]

[0154] Nucleotide sequence SEQ ID No.18:

[0155] agatgttggagCAGATGGCT.

[0156] Nucleotide sequence SEQ ID No.19:

[0157] GCTGCACTTGAAGCAATGTC.

[0158] Nucleotide sequence SEQ ID No.20:

[0159] GGCGACTGCAAGCCTACCTA.

[0160] Nucleotide sequence SEQ ID No.21:

[0161] ATGCAGAGGCCCACATTCAG.

[0162] Nucleotide sequence SEQ ID No.22:

[0163] GAGTATAAGAATCATTCAAAatgtccgcccccgcctccaa.

[0164] Nucleotide sequence SEQ ID No.23:

[0165] TGACATAACTAATTACATGAttagtatcggtaaatgtcgg.

[0166] Nucleotide sequence SEQ ID No.24:

[0167] CACAAGACATATCTACAGCAatgtccactcccgcttaccc.

[0168] Nucleotide sequence SEQ ID No.25:

[0169] Acaagttccgtagttggatcttactggggagacttcttgg.

[0170] Nucleotide sequence SEQ ID No.26:

[0171] GAATTAAACACACATCAACAatgataccccaggttgtgat.

[0172] Nucleotide sequence SEQ ID No.27:

[0173] TGTAAAGAGTGATAAATAGCctaaatatcgccagtctcct。

Claims

1. A recombinant Yarrowia lipolytica strain producing sakura chlorophyll, characterized in that: The recombinant Yarrowia lipolytica strain is obtained by genetically modifying the starting strain. Compared with the starting strain, the Ku70 gene of the recombinant Yarrowia lipolytica strain is replaced by the OsNOMT gene. The activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced; The nucleotide sequence of the OsNOMT gene is shown in SEQ ID No. 1; The nucleotide sequence of the Ku70 gene is shown in SEQ ID No. 2; The starting strain is Yarrowia lipolytica Po1f MYA-2613; The nucleotide sequence of the S-adenosylhomocysteine ​​hydrolase is shown in SEQ ID No.6; The nucleotide sequence of the adenosine kinase is shown in SEQ ID No.7; The nucleotide sequence of the adenosine deaminase is shown in SEQ ID No.8; The activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase of the recombinant Yarrowia lipolytica strain are enhanced by overexpressing the following genes (a)-(c): (a) From the promoter P TEF The gene encoding the regulated S-adenosylhomocysteine ​​hydrolase; (b) by promoter P EXP Gene encoding the regulated adenosine kinase; (c) by promoter P GPD The gene encoding the regulated adenosine deaminase.

2. The recombinant Yarrowia lipolytica strain according to claim 1, characterized in that The promoter P TEF The nucleotide sequence is shown in SEQ ID No.3; The promoter P EXP The nucleotide sequence is shown in SEQ ID No.4; The promoter P GPD The nucleotide sequence is shown in SEQ ID No.

5.

3. The method for constructing a recombinant Yarrowia lipolytica strain producing sakura chlorophyll according to any one of claims 1 to 2, characterized in that: The construction method comprises: The starting strain is genetically modified, the Ku70 gene in the starting strain is replaced by the OsNOMT gene to obtain an intermediate strain, and the intermediate strain is further genetically modified to obtain a recombinant Yarrowia lipolytica strain with enhanced activities of S-adenosylhomocysteine ​​hydrolase, adenosine kinase and adenosine deaminase.

4. The construction method according to claim 3, characterized in that: The method for preparing the intermediate strain is as follows: a linear vector carrying the homologous arms at both ends of the Ku70 gene and the integration expression frame of the OsNOMT gene is integrated into the site of the Ku70 gene of the starting strain by the lithium acetate method, and the OsNOMT gene is integrated into the strain while the Ku70 gene of the starting strain is knocked out to serve as the intermediate strain.

5. The construction method according to claim 3, characterized in that: The preparation steps of the recombinant Yarrowia lipolytica strain include: The prepared intermediate strain was used as the starting strain, and the intermediate strain was cultured to the exponential growth phase, the cells were collected, centrifuged and the supernatant was discarded, and P was added. TEF -SAHH-P EXP -ADO-P GPD -TAD expression cassette, mixed well, incubated at 37°C for 1 hour, and then coated on uracil-deficient solid culture medium plates to screen out recombinant Yarrowia lipolytica strains.

6. Use of the recombinant Yarrowia lipolytica strain according to any one of claims 1 to 2 or the construction method according to any one of claims 3 to 5 in fermentation synthesis of sakuramin, characterized in that: The fermentation medium synthesized by fermentation includes 2g / L-4g / L of amino-free yeast nitrogen source, 1g / L-3g / L of yeast extract, 4g / L-8g / L of ammonium sulfate, 40g / L-60g / L of glucose, 0.1g / L-0.3g / L of calcium chloride, 0.4g / L-0.8g / L of potassium sulfate, 0.6g / L-0.8g / L of sodium chloride, 6mg / L-9mg / L of ferrous sulfate heptahydrate, 4mg / L-6mg / L of calcium pantothenate, 2mg / L-5mg / L of manganese chloride tetrahydrate, 0.06mg / L-0.1mg / L of sodium molybdate dihydrate, 6mg / L-8mg / L of vitamin B6, and 1.5mg / L of vitamin B12. 4mg / L-6mg / L, L-leucine 0.15g / L-0.2g / L, L-methionine 0.2g / L-0.4g / L, L-tyrosine 0.08g / L-0.12g / L, L-histidine 0.02g / L-0.06g / L, naringenin 1g / L-1.8g / L.

7. The use according to claim 6, characterized in that: The pH of the fermentation medium is 5.

6.

8. The use according to claim 6, characterized in that: The fermentation culture conditions include: culture temperature of 26° C.-29° C., and culture at 170 rpm-190 rpm for 23 h-25 h.

9. The use according to claim 6, characterized in that: The inoculation amount of the recombinant Yarrowia lipolytica strain was 1% of the volume of the fermentation medium.

Images