Genetically engineered bacterium for constructing high-yield D-pantothenic acid based on cell division assisted engineering as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for constructing high-yield D-pantothenic acid based on cell division assisted engineering, a construction method and application. The method comprises the following steps: (1) knocking out Escherichia coli division negative regulation systems minC and minD; (2) knocking out an amidase regulation factor nlpD on a control cell wall; (3) knocking out a DNA replication influence factor rstA; (4) overexpressing a GTP hydrolysis promoting factor sulA from pseudomonas aeruginosa; and (5) controlling the ftsQAZ by using the dynamic promoter, changing the mode of strain cell division and reducing the energy consumed by strain reproduction under the condition of not influencing the strain growth, so that more energy flows to the production of the D-pantothenic acid, and the yield of the strain D-pantothenic acid reaches 8.88 g / L.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial metabolic engineering, and in particular relates to a genetically engineered bacterium for constructing high-yield D-pantothenic acid based on cell division-assisted engineering, a construction method and an application thereof. Background Art

[0002] D-Pantothenic acid (DPA), also known as vitamin B5, is a water-soluble vitamin and a key precursor for the biosynthesis of coenzyme A (CoA) and acyl carrier protein. Its chemical formula is C9H17NO5 and its relative molecular weight is 219.24. It is often used in industries such as healthcare, cosmetics, animal food and feed, and has high commercial value.

[0003] At present, D-pantothenic acid for industrial applications is mainly produced by chemical methods using the condensation of D-pantolactone and β-alanine in methanol or ethanol. However, the use of chemical synthesis methods involves toxic chemical reagents and expensive separation methods in some steps. With the continuous development of genetic engineering and synthetic biology, the use of environmentally friendly, cheap and simple biosynthetic methods to produce D-pantothenic acid has attracted widespread attention from scholars. The microbial synthesis of D-pantothenic acid is produced by the condensation reaction of D-pantolactone and β-alanine in organisms. Among them, β-alanine, as a derivative of aspartate family amino acids, is directly synthesized from aspartate by panD encoded aspartate 1-decarboxylase. D-pantolactone is produced from pyruvate through the catalysis of acetolactate synthase, ketoacid reductoisomerase, dihydroxyacid dehydratase, α-ketoisovalerate hydroxymethyltransferase and pantothenate reductase.

[0004] Cell growth and reproduction require division. There are many genes involved in cell division, and the core of them is the formation of the cell's Z ring. After the Z ring is formed, it shrinks and collapses, thus dividing into two. At present, the division process of Escherichia coli has been studied in detail. It is generally divided into three stages: B, C, and D (from cell birth to DNA replication, from the start to the end of DNA replication, and from the termination of DNA replication to the completion of cell division). Each stage is controlled by different genes. However, there are few studies on the use of these genes in metabolic engineering. It is known that the Liu Liming team of Jiangnan University uses dynamic regulation promoters to control the formation of cell Z rings for the production of L-homoserine; the Chen Guoqiang team of Tsinghua University increases the number of strain inclusion bodies by knocking out the Z ring regulation inhibition system minCD and the regulatory factors envC and nlpD of the key enzyme amidase in cell wall synthesis, thereby increasing the production of PHB; and the Liang Quanfeng team of Shandong University creates polyploid strains by inhibiting strain division to increase the production of L-threonine. These examples show that cell division auxiliary strategies can play a role in metabolic engineering, but they have not been reported in the enhancement of D-pantothenic acid biosynthesis. Summary of the invention

[0005] In order to improve the performance of strains in producing D-pantothenic acid, the present invention provides a genetically engineered bacterium for constructing a high-yield D-pantothenic acid based on cell division-assisted engineering, a construction method and an application. Specifically, by knocking out or expressing genes related to cell division, the morphology of the strain is changed, thereby indirectly affecting the production of the strain, and a genetically engineered bacterium for high-yield D-pantothenic acid is obtained.

[0006] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium with high yield of D-pantothenic acid, comprising: changing the cell morphology of the chassis strain; the method for changing the cell morphology of the chassis strain comprises at least one of the following:

[0007] (1) Knockout at least one of minCD, nlpD, and rstA in the genome;

[0008] (2) overexpression of sulA from Pseudomonas aeruginosa;

[0009] (3) Overexpression of ftsQAZ controlled by a dynamic promoter.

[0010] Cell division is one of the basic processes of prokaryotic and eukaryotic cell proliferation. At present, some studies have found that overexpression or knockout of cell division-related genes will change the morphology or division pattern of cells, thereby affecting cell metabolism. Therefore, the present invention constructs a genetically engineered bacterium with high production of D-pantothenic acid through cell division-assisted engineering.

[0011] Cell growth and reproduction require division. There are many genes involved in cell division, and the core of these is the formation of the cell's Z ring, which shrinks and collapses after formation, thus dividing into two cells. At present, the division process of E. coli has been studied in detail, and is generally divided into three stages: B, C, and D (from cell birth to DNA replication, from the start to the end of DNA replication, and from the end of DNA replication to the completion of cell division). Each stage is controlled by different genes.

[0012] The min system, which is important for controlling cell division, is controlled by the gene minCD, which plays a role in inhibiting the formation of the Z ring of the strain. The gene is expressed in all parts of the strain, but the intensity varies. The closer to the center of the strain, the less it is expressed, and the farther away from the center, the more it is expressed. Therefore, under normal circumstances, the Z ring of the strain will form in the center, thereby performing binary fission. After minCD is knocked out, the Z ring will form irregularly, thereby changing the morphology of the strain and affecting the metabolism of the strain. The expression of minCD requires the consumption of ATP, and knocking it out can also reduce the consumption of ATP in the strain. Amidase in Escherichia coli controls the synthesis of the cell wall, and the gene nlpD is a regulatory factor of amidase. Knocking out nlpD will cause the cell wall of the strain to not be synthesized normally, affecting the division of the strain, making the cells larger and longer, which may affect the metabolism of the strain. As a regulatory factor of cell DNA replication, rstA controls the timing of DNA replication. Knocking it out will delay the replication of the strain's DNA, thereby extending the maturation period of the cell, and further affecting the metabolism of the strain. The gene sulA promotes the hydrolysis of GTP in cells, and the formation of the cell Z ring consumes GTP. Overexpression of sulA inhibits the formation of the cell Z ring, causing the strain to fail to divide normally, and the cells to become longer, which in turn affects the cell metabolism. The Z ring, the core component of cell division, is controlled by the gene ftsZ. Related studies have shown that overexpression of ftsZ will accelerate the division process of the strain, but sometimes incorrect division will occur. Related studies have shown that using a dynamic promoter to control the expression of ftsZ will promote the production of homoserine in Escherichia coli.

[0013] Preferably, the method for changing the cell morphology of the chassis strain comprises: knocking out any one of minCD, nlpD, and rstA in the genome through the CRISPR-Cas9 system.

[0014] Preferably, the method for changing the cell morphology of the chassis strain comprises: knocking out minCD in the genome through the CRISPR-Cas9 system, and inserting sulA under the control of a strong promoter (such as TRC) into the minCD site.

[0015] Preferably, the method for changing the cell morphology of the chassis strain comprises: knocking out yfcU in the genome through the CRISPR-Cas9 system, and inserting ftsQAZ under the control of a dynamic promoter into the yfcU site.

[0016] Preferably, the dynamic promoter is PfliC.

[0017] Preferably, the nucleotide sequence of minCD is shown in SEQ ID NO.1; the nucleotide sequence of nlpD is shown in SEQ ID NO.2; the nucleotide sequence of rstA is shown in SEQ ID NO.3; the nucleotide sequence of sulA from Pseudomonas aeruginosa is shown in SEQ ID NO.4; and the nucleotide sequence of ftsQAZ is shown in SEQ ID NO.5.

[0018] Preferably, the bottom plate bacteria are: E.coli 3110derivates;

[0019] Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ΔptsG::galp-glk, denoted as DPAY1. Among them, strain E. coli 3110derivates;

[0020] Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk, denoted as DPA11, has been disclosed in CN113637618A. The chassis bacteria DPAY1 used in the present application is constructed by back-complementing galP and glK on the basis of DPA11, that is, the genotype of the chassis bacteria DPAY1 is DPA11ΔptsG::galp-glk.

[0021] The invention also provides a genetic engineering bacterium with high D-pantothenic acid production obtained by the method.

[0022] Preferably, the genetically engineered bacteria that produces high levels of D-pantothenic acid is any one of the following:

[0023] (1) DPAY1ΔminCD;

[0024] (2) DPAY1ΔnlpD;

[0025] (3) DPAY1ΔrstA;

[0026] (4)DPAY1ΔminCD::sulA P.A ;

[0027] (5)DPAY1ΔyfcU::PfliC-ftsQAZ.

[0028] The present invention also provides the use of the genetic engineering bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation.

[0029] Preferably, the application comprises: inoculating a genetically engineered bacterium with high D-pantothenic acid production into a fermentation medium, adding β-alanine, VB1, and VB12, and culturing at 25 to 35° C. and 150 to 200 rpm for 24 to 48 hours.

[0030] Beneficial effects of the present invention:

[0031] The present invention provides a recombinant Escherichia coli with high D-pantothenic acid production by metabolic engineering. Compared with the original strain, the recombinant Escherichia coli has higher production and higher sugar-acid conversion rate. By (1) knocking out minCD and nlpD to change the cell division mode of the strain; (2) overexpressing sulA to promote GTP hydrolysis and inhibit the formation of Z ring; (3) knocking out rstA to delay the replication of strain DNA and improve the sugar-acid conversion rate, the D-pantothenic acid production of the recombinant strain finally reached 8.88 g / L, and the sugar-acid conversion rate was 0.310. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The shake flask fermentation results of the engineered bacteria DPAY1 and DPAY1-1 in the examples of the present invention are shown.

[0033] Figure 2 The shake flask fermentation results of the engineered bacteria DPAY1 and DPAY1-2 in the examples of the present invention are shown.

[0034] Figure 3 This is the shake flask fermentation of the engineered bacteria DPAY1 and DPAY1-3 in the examples of the present invention.

[0035] Figure 4 The shake flask fermentation results of the engineered bacteria DPAY1-1 and DPAY1-4 in the examples of the present invention are shown.

[0036] Figure 5 The shake flask fermentation results of the engineered bacteria DPAY1 and DPAY1-5 in the examples of the present invention are shown.

[0037] Figure 6 This is a scanning electron microscope image of the engineered bacteria DPAY1-1 in the example of the present invention.

[0038] Figure 7 This is a scanning electron microscope image of the engineered bacteria DPAY1-2 in the example of the present invention.

[0039] Figure 8 This is a scanning electron microscope image of the engineered bacteria DPAY1-4 in the example of the present invention. DETAILED DESCRIPTION

[0040] The following describes the implementation of the present invention through specific embodiments, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific implementations, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0041] It should be noted that, in the absence of conflict, the following embodiments and features in the embodiments can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are all conventional methods, and the reagents used can be obtained from commercial sources.

[0042] The bottom plate bacteria are: E. coli 3110derivates;

[0043] Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ΔptsG::galp-glk, denoted as DPAY1. Among them, strain E. coli 3110derivates;

[0044] Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk, denoted as DPA11, has been disclosed in CN113637618A. The chassis bacteria DPAY1 used in the present application is constructed by back-complementing galP and glK on the basis of DPA11, that is, the genotype of the chassis bacteria DPAY1 is DPA11ΔptsG::galp-glk.

[0045] LB medium: yeast powder 5g / L, peptone 10g / L, NaCl 10g / L, LB solid medium with agar powder added to 20g / L.

[0046] Shake flask fermentation medium: 20 g / L glucose, 16 g / L (NH4)2S04, 1 g / L KH2PO4, 2 g / L yeast powder, 0.5 g / LMgSO4, 1 mL / L salt solution, 10 g / L CaCO3, sterilized at 115°C for 30 minutes, CaCO3 needs to be sterilized separately.

[0047] Salt solution: 0.02g / LNiCl2·7H2O, 10g / L CuCl2, 10g / LFeSO4·7H2O, 10g / LZnSO4·7H2O, 0.2g / L CuSO4.

[0048] Antibiotics: Kanamycin working concentration (50 mg / L), Spectinomycin (50 mg / L).

[0049] D-Pantothenic Acid Shake Flask Fermentation Method:

[0050] (1) Fermentation strain seed culture

[0051] The recombinant strain was streaked onto LB solid medium and cultured at 37°C for 12-16 hours. A single colony from the plate was inoculated into LB liquid medium and cultured at 37°C and 200 r / min for 12-14 hours to obtain seed solution.

[0052] (2) Shake flask fermentation

[0053] Add 2% seed solution inoculum (1 ml) to 50 ml fermentation medium, and add β-alanine (250 g / L), VB1 (0.2 mg / L), VB 12 Isoleucine (0.04 g / L) was added as needed and cultured at 30°C, 180 rpm for 48 h.

[0054] (3) D-pantothenic acid detection method

[0055] D-pantothenic acid was detected by high performance liquid chromatography (HPLC). Detection conditions: chromatographic column J&KC18-H (250x4.6 mm, 5um), mobile phase 50mL acetonitrile, 950uL phosphoric acid, dilute to 1L with ultrapure water (no gradient), flow rate 1mL / min, injection volume 10mL, column temperature 30℃, detection wavelength 200nm, detection time 16min.

[0056] The PCR amplification system is shown in Table 1, the fusion PCR system is shown in Table 2, and the colony PCR system is shown in Table 3.

[0057] Table 1 PCR amplification system

[0058] Components Volumes 2×PhantaMaxBuffer 25μL dNTPMix 1μL Primer1 1μL Primer2 1μL PhantaMax 1μL Template(pTargetgene) 1μL <![CDATA[ddH2O]]> Up to 50 μL

[0059] Table 2 Fusion PCR system

[0060]

[0061]

[0062] Table 3 Colony PCR system

[0063] Components Volumes T5SuperPCRMix 5μL Template(Singleclone) 1μL PrimerVF / VR 1μL each ddH2O Up to 10 μL

[0064] DNA purification:

[0065] Take the PCR amplification product, add 3 times the volume of Buffer PA (if less than 100uL, make up to 100mL), and mix well. Transfer the mixed solution to the preparation tube, centrifuge at 12000rpm for 1min at room temperature, and discard the filtrate. Add 700mL of BufferW2, centrifuge at 12000rpm for 1min at room temperature, discard the filtrate, and repeat this step once. Centrifuge at 12000rpm for 2min at room temperature, take out the preparation tube, open the preparation tube cover, and place it at room temperature for 2-5min. Add 40mL of preheated (50-65℃) ultrapure water, place it at room temperature for 2-5min, and centrifuge at 12000rpm for 1min. Use a nucleic acid micrometer to measure the DNA concentration and purity of the collected solution, and store it at -20℃ for later use.

[0066] Plasmid extraction:

[0067] Take 2mL of overnight cultured bacterial solution for 12-14h into an EP tube (the sampling volume can be adjusted according to the bacterial concentration), centrifuge at 12000rpm for 1min at room temperature, discard the supernatant, add 250mL of Buffer S1 to the precipitate to suspend the cells, then add 250mL of Buffer S2, gently and fully flip 4 to 6 times to fully lyse the bacteria (this step should not exceed 5min), then add 350mL of Buffer S3, gently and fully flip 6 to 8 times, and centrifuge at 12000rpm for 10min at room temperature. Pipette the supernatant into the preparation tube, centrifuge at 12000rpm for 1min, and discard the filtrate; add 500ml of Buffer W1, centrifuge at 12000rpm for 1min at room temperature, and discard the filtrate; add 600ml of Buffer w2, centrifuge at 12000rpm for 1min at room temperature, discard the filtrate, and repeat this step once; centrifuge at 12000rpm for 2min at room temperature, open the cover of the preparation tube, and place it at room temperature for 2 to 5min. Place the preparation tube in a 1.5 mL centrifuge tube, add 40 mL of preheated (50-65°C) ultrapure water, place at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min, use a nucleic acid micrometer to measure the plasmid concentration and purity, and store at -20°C for later use.

[0068] Competent cell preparation:

[0069] (1) Preparation of chemical transformation competent cells

[0070] Take the streaked plate, pick a single colony from it, inoculate it into 10mL LB liquid medium, and culture it at 37℃, 180rpm overnight. Then take the overnight culture solution and transfer (1% inoculation amount) to 50mL LB liquid medium, and culture it at 37℃, 180rpm until OD6000.4-0.6. Transfer the bacterial solution to a 50ml sterile centrifuge tube in a clean bench, centrifuge it at 4℃, 5500rpm for 8min, and discard the supernatant in the clean bench. Then add an appropriate amount of pre-cooled sterile CaCl2 solution (0.1mol / L), carefully and gently blow the bacteria on the tube wall to suspend it, immediately put it on ice for 30min, then centrifuge it at 4℃, 5500rpm for 5min to collect the bacteria, and discard the supernatant in the clean bench. According to the amount of bacteria, add an appropriate amount of pre-cooled sterile CaCl2 glycerol solution (0.1 mol / L, 15% glycerol) to resuspend the cells, and dispense 100 μL per tube on ice. Use immediately or store at -80°C for later use.

[0071] (2) Preparation of competent cells by high-voltage electroporation

[0072] Take the streaked plate. Pick a single colony (containing the pCas plasmid) from it, inoculate it into 10mL of LB medium, add 10μL of Kan and 100μL of arabinose, and culture overnight at 30℃, 180rpm. Transfer the overnight culture to 10mL of LB medium, add 10uL of Kan and 100μL of arabinose, and culture at 30℃, 180rpm to OD6000.8~1.0. Transfer the bacterial solution to a 2ml sterile centrifuge tube, centrifuge at 4℃, 5500rpm for 2min, and discard the supernatant in the clean bench. Then add pre-cooled sterile water, gently blow the bacteria on the tube wall to suspend it, centrifuge at 4℃, 5500rpm for 2min, discard the supernatant, and repeat this step twice. Add an appropriate amount of pre-cooled 10% sterile glycerol solution to resuspend the cells, centrifuge at 4℃, 5500rpm for 2min, and discard the supernatant in the clean bench. According to the amount of bacteria, add an appropriate amount of 10% sterile glycerol solution to resuspend the cells, dispense 100 μL per tube on ice, and store at -80°C for later use.

[0073] Plasmid transformation:

[0074] (1) Chemical conversion method

[0075] Place competent cells on ice, and after natural thawing, add 3-4 μL of plasmid, mix gently, and place on ice for 30 minutes. Then, take the mixture after ice bath, heat shock in a 42°C water bath for 90 seconds, and immediately place on ice for 2-5 minutes. Add 700 μL LB medium and culture in a shaker at 37°C, 180 rpm for 45-60 minutes. Take an appropriate amount of culture and spread it on an LB plate (resistance is the same as plasmid resistance), place the plate in a 37°C incubator, and invert and culture overnight.

[0076] (2) High-voltage electroporation method for competent transformation

[0077] Prepare electroporation competent cells with pCas plasmid strains. Take an electroporation competent cell, add 2mL of pTarget-X-dg (knockout vector) or 2ml of pTarget-Y (knockout expression vector) in a clean bench, mix gently, and place on ice for 1min; transfer the mixture to a pre-cooled 2mm electroporation cup and place on ice for 45s. Use a paper towel to dry the water mist on the outside of the electroporation cup, put it into the electroporator and use Eco2 for electroporation (this step needs to be completed quickly). Add 600μL of pre-cooled LB liquid culture medium to the groove of the electroporation cup in the clean bench, tilt the electroporation cup, absorb all the bacterial liquid from the mouth of the electroporation cup, and transfer it to a 2mL sterile EP tube (this step needs to be completed quickly). Resuscitate at 30℃, 180rpm for more than 2.5h, then take 200μL and apply it to LB solid culture medium (SD+Kan resistance), and culture overnight at 30℃.

[0078] Example 1: Construction of strain DPAY1-1 using metabolic engineering

[0079] Using strain DPAY1 as the base strain, minCD, an inhibitor of cell Z-ring localization, was knocked out to change the division pattern of the strain, thereby increasing the production of D-pantothenic acid.

[0080] (1) Construction of minC and minD knockout vectors

[0081] Using the pTargetF vector as a template, primers P1k-minCD-F / R were used; according to the upstream and downstream sequences of the minCD gene of Escherichia coli W3110 published on NCBI, primers minCD-up-F / R and minCD-down-F / R were used, and the genome of the wild-type Escherichia coli strain W3110 was used as a template for amplification according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the DNA fragments were purified to obtain the corresponding DNA target fragments, which were reacted according to the one-step cloning system and further transformed into DH5α, spread on spectinomycin (SD) plates, and single colonies were picked for colony PCR verification using the pTarget universal primers Target-F / R. The clones were screened for sequencing to verify that the pTarget-minCD mutation vector capable of expressing the sgRNA targeting the target gene minCD was successfully constructed.

[0082] (3) Knockout of minC and minD genomes

[0083] The minCD gene in the genome of the DPAP1 strain was knocked out by the CRISPR-Cas9 system. The strain DPAY1 was made into a strain containing the pcas9 plasmid using the principle of chemical competence, and the pTarget-minCD vector was electroporated into the DPAY1 strain containing the pCas9 vector by high-voltage electroporation. The bacterial solution was then applied to a solid LB plate containing SD+Kan resistance and cultured overnight at 30°C for 24 hours. A single colony was picked as a template, and the knockout verification primer minCD-out-F / R was used to perform colony PCR verification to confirm the knockout of the minCD gene. The strain that passed this confirmation was cultured overnight at 30°C in an LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-minCD vector. The strain from which the pTarget-minCD vector had been removed was then cultured overnight at 37°C in an LB medium to remove the pCas vector. The constructed strain was recorded as Escherichia coli DPAY1-1. The construction process and principle of the CRISPR / Cas9 system can be found in the literature: Zhao, D., Yuan, S., Xiong, B. et al. Development of a fast and easy method for Escherichia coli genome editing with CRISPR / Cas9. Microb Cell Fact 15, 205 (2016).

[0084] Table 4 Primer sequences used in Example 1

[0085]

[0086]

[0087] Example 2: Construction of strain DPAY1-2 using metabolic engineering

[0088] (1) Construction of nlpD knockout vector

[0089] Using the pTargetF vector as a template, primers P1k-nlpD-F / R were used; according to the upstream and downstream sequences of the nlpD gene of Escherichia coli W3110 published on NCBI, primers nlpD-up-F / R and nlpD-down-F / R were used, and the genome of the wild-type Escherichia coli strain W3110 was used as a template for amplification according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the DNA fragments were purified to obtain the corresponding DNA target fragments, which were reacted according to the one-step cloning system and further transformed into DH5α, spread on spectinomycin (SD) plates, and single colonies were picked for colony PCR verification using the pTarget universal primers Target-F / R. The clones were screened for sequencing and verification, and the pTarget-nlpD mutation vector capable of expressing sgRNA targeting the target gene nlpD was successfully constructed.

[0090] (2) Knockout of nlpD in the genome:

[0091] The nlpD gene in the genome of the DPAY1 strain was knocked out by the CRISPR-Cas9 system. The DPAY1 strain was made into a strain containing the pcas9 plasmid using the chemical competence production principle, and the pTarget-nlpD vector was electroporated into the DPAY1 strain containing the pcas9 vector using the high-voltage electroporation method. The bacterial solution was then applied to a solid LB plate containing SD+Kan resistance and cultured overnight at 30°C for 24 hours. A single colony was picked as a template, and the knockout verification primer nlpD-out-F / R was used to perform colony PCR verification to confirm the knockout of the nlpD gene. The strain that passed this confirmation was cultured overnight at 30°C in an LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-nlpD vector. The strain from which the pTarget-nlpD vector had been removed was then cultured overnight at 37°C in an LB medium to remove the pCas vector. The constructed E. coli strain was recorded as DPAY1-2.

[0092] Table 5 Primer sequences used in Example 2

[0093]

[0094] Example 3: Construction of strain DPAY1-3 using metabolic process modification

[0095] (1) Construction of rstA knockout vector

[0096] Using the pTargetF vector as a template, primers P1k-rstA-F / R were used; according to the upstream and downstream sequences of the rstA gene of Escherichia coli W3110 published on NCBI, primers rstA-up-F / R and rstA-down-F / R were used, and the genome of the wild-type Escherichia coli strain W3110 was used as a template for amplification according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the DNA fragment was purified to obtain the corresponding DNA target fragment, which was reacted according to the one-step cloning system and further transformed into DH5α, spread on a spectinomycin (SD) plate, and a single colony was picked for colony PCR verification using the pTarget universal primer Target-F / R. The clones were screened for sequencing and verification, and the pTarget-rstA mutant vector capable of expressing sgRNA targeting the target gene rstA was successfully constructed.

[0097] (2) Knockout of rstA in the genome

[0098] The rstA gene in the genome of the DPAY1 strain was knocked out by the CRISPR-Cas9 system. The DPAY1 strain was made into a strain containing the pcas9 plasmid using the chemical competence production principle, and the pTarget-rstA vector was electroporated into the DPAY1 strain containing the pcas9 vector using high-voltage electroporation. The bacterial solution was then applied to a solid LB plate containing SD+Kan resistance and cultured overnight at 30°C for 24 hours. A single colony was picked as a template, and the knockout verification primer rstA-out-F / R was used to perform colony PCR verification to confirm the knockout of the rstA gene. The strain that passed this confirmation was cultured overnight at 30°C in an LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-rstA vector. The strain from which the pTarget-rstA vector had been removed was then cultured overnight at 37°C in an LB medium to remove the pCas vector. The constructed E. coli strain was recorded as DPAY1-3.

[0099] Table 6 Primer sequences used in Example 3

[0100] name Primer sequence (5'→3') p1k-rstA-F GTTGGTCAGACCTTGCAGGTGTTTTAGAGCTAGAAATAGC p1k-rstA-R ACCTGCAAGGTCTGACCAACACTAGTATTATACCTAGGAC rstA-up-F ATCAAACGGCAATCCTGGC rstA-up-R AAAAGCCTGGTTCCGCCGATTTATCCCCCAGGAAAAATTG rstA-down-F ATCGGCGGAACCAGGCTT rstA-down-R TGCGTATGTTGAGAAGCGG p2k-rstA-F TCCGCTTCTCAACATACGCACTGCAGAAGCTTAGATCTAT p2k-rstA-R CGCCAGGATTGCCGTTTGATTCTAGAGAATTCAAAAAAAGCA rstA-out-F TCGCTTTGCCGATAGGTCA rstA-out-R GGTCCAGCTTATGGGACAA

[0101] Experimental Example 4: Construction of strain DPAY1-4 using metabolic engineering

[0102] (1) Construction of expression vector pTRC-99A-sulA plasmid

[0103] Using the empty plasmid pTRC-99A as a template, using primers pTRC-F / R to amplify according to the PCR amplification system, similarly using the Pseudomonas aeruginosa PAO1 genome as a template, using primers sulA-F / R to amplify according to the PCR amplification system, after agarose nucleic acid electrophoresis verification, the DNA fragments are purified to obtain the corresponding DNA target fragments. According to the first cloning system reaction, further transformed into DH5α, coated on kanamycin (Kan) plates, single colonies are picked and used for colony PCR verification using pTRC-99A universal primers 99A-F / R, and sequencing verification is performed to screen the successfully cloned pTRC-99A-sulA plasmid. Using primers Trc-F / R, the template is a plasmid for amplification according to the PCR amplification system. After agarose nucleic acid electrophoresis verification, the DNA fragments are purified to obtain the corresponding expression frame target fragments under the control of Trc.

[0104] (2) Insertion of sulA into the genome

[0105] The sulA was inserted into the site of the minCD gene in Example 1 by the CRISPR-Cas9 system. The strain DPAY1 was made into a strain containing the pcas9 plasmid using the chemical competence production principle, and the pTarget-minCD vector and the sulA fragment under the control of TRC were electroporated into the DPAY1 strain containing the pcas9 vector. The bacterial solution was then applied to a solid LB plate containing SD+Kan resistance and cultured overnight at 30°C for 24 hours. A single colony was picked as a template, and the knockout verification primer sulA-out-F / R was used to perform colony PCR verification to confirm the insertion of the sulA gene. The strain that passed this confirmation was cultured overnight at 30°C in an LB medium containing 50 mg / L kanamycin and 5 mM IPTG to remove the pTarget-minCD vector. The strain from which the pTarget-minCD vector had been removed was then cultured overnight at 37°C in an LB medium to remove the pCas vector. The constructed E. coli strain was recorded as DPAY1-4.

[0106] Table 7 Primer sequences used in Example 4

[0107] name Primer sequence (5'→3') sulA-F ATGCAGACCTCCCACTCG sulA-R TCAACCCAGACGAATATTCA minCD-sulA-F CTCTCCTGAGTAGGACAAATGTTATGGCATTACTCGATTTC minCD-sulA-R GCCGGATGATTAATTGTCAACCTGGCCTTACTCAATTAG

[0108] Experimental Example 5: Construction of strain DPAY1-5 using metabolic engineering

[0109] (1) Expression vector p fliC Construction of -99A-ftsQAZ plasmid

[0110] The empty plasmid pTRC-99A was used as a template and primers pTRC-F / R were used for PCR amplification. Similarly, the genome of Escherichia coli W3110 strain was used as a template and primers ftsQAZ-F / R were used for PCR amplification. The TRC promoter was replaced by pTRC-F / R using primers. fliC Promoter. After agarose nucleic acid electrophoresis verification, DNA fragment purification was performed to obtain the corresponding DNA target fragment. According to the first cloning system reaction, it was further transformed into DH5α, coated on kanamycin (Kan) plate, single colonies were picked and colony PCR was performed using pTRC-99A universal primer 99A-F / R, and sequencing was performed to verify the successful cloning of p fliC -99A-ftsQAZ plasmid. Primers Trc-F / R were used and the template was plasmid. The plasmid was amplified according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the DNA fragment was purified to obtain the corresponding p fliC The expression cassette is under the control of the target fragment.

[0111] (2) Construction of pseudogene yfcU knockout vector

[0112] Using the pTargetF vector as a template, primers P1k-yfcU-F / R were used; according to the upstream and downstream sequences of the yfcU gene of Escherichia coli W3110 published on NCBI, primers yfcU-up-F / R and yfcU-down-F / R were used, and the genome of the wild-type Escherichia coli strain W3110 was used as a template for amplification according to the PCR amplification system. After verification by agarose nucleic acid electrophoresis, the DNA fragment was purified to obtain the corresponding DNA target fragment, which was reacted according to the one-step cloning system and further transformed into DH5α, spread on a spectinomycin (SD) plate, and a single colony was picked for colony PCR verification using the pTarget universal primer Target-F / R. The clones were screened for sequencing and verification, and the pTarget-yfcU mutation vector capable of expressing the sgRNA targeting the target gene yfcU was successfully constructed.

[0113] (3) Insertion of ftsQAZ in the genome

[0114] The CRISPR-Cas9 system will be used to fliCThe ftsQAZ under the control of fliC was inserted into the site of the pseudogene yfcU gene. The strain DPAY1 was made into a strain containing the pcas9 plasmid using the principle of chemical competence, and the pTarget-yfcU vector and the ftsQAZ fragment under the control of fliC were electroporated into the DPAY1 strain containing the pcas9 vector. The bacterial solution was then applied to a solid LB plate containing SD+Kan resistance and cultured overnight at 30°C for 24 hours. A single colony was picked as a template, and the knockout verification primer yfcU-out-F / R was used to perform colony PCR verification to confirm the insertion of the ftsQAZ gene. The strain that passed this confirmation was cultured overnight at 30°C in LB medium containing 50 mg / L kanamycin and 5mM IPTG to remove the pTarget-yfcU vector. The strain from which the pTarget-yfcU vector had been removed was then cultured overnight at 37°C in LB medium to remove the pCas vector. The constructed E. coli strain was recorded as DPAY1-5.

[0115] Table 8 Primer sequences used in Example 5

[0116]

[0117]

[0118] Example 6: Fermentation Experiment Verification

[0119] The engineered bacterial strains in Examples 1 to 5 were tested in shake flask fermentation experiments to compare the ability of each genotype strain to produce D-pantothenic acid. The shake flask fermentation experiment and the D-pantothenic acid detection experiment were carried out according to the above specific implementation plan. The genotypes of the engineered strains in the above examples are shown in Table 9, and the results of the shake flask fermentation experiment are shown in Table 9. Figures 1 to 4 shown.

[0120] Table 9 Genotypes of engineering bacteria strains

[0121]

[0122] Combination Figures 1 to 5 The results of shake flask fermentation experiments and Figure 6-8Scanning electron micrographs show that by knocking out the minCD gene, the D-pantothenic acid production of the strain increased from 8.42 g / L to 8.74 g / L, while the OD600 decreased slightly from 19.26 to 18.07. The electron micrograph showed a length of 7.2 μm, which was longer than the normal length of 3-5 μm. This may be due to the inhibition of binary fission of the cells, resulting in a decrease in the OD of the strain. At the same time, relevant literature shows that the min system in E. coli consumes ATP, so knocking out minCD will reduce the consumption of ATP in the strain. By knocking out the amidase regulatory inhibitor nlpD involved in cell wall synthesis, the D-pantothenic acid production increased to 8.64 g / L, and the OD also decreased slightly. The electron microscope image showed that the length of the strain was generally short and varied. It was considered that the normal division of the strain was inhibited, resulting in errors in the division of the strain, which accelerated the division speed and more energy flowing to production. rstA has been proven in relevant literature that knocking out this gene will delay the replication of the strain DNA. From the fermentation results, it can be seen that the knockout The removal of rstA did not significantly increase the yield of D-pantothenic acid, but the OD dropped a lot, from 19.26 to 17.11. After 48 hours of shake flask fermentation, the residual sugar content in the shake flask was tested and it was found that the DPAY1-3 strain with rstA knocked out had more residual sugar. Considering that this gene may prolong the B phase of the strain, that is, the phase from cell birth to DNA replication, the strain will have a longer time for production and improve the sugar-acid conversion rate of the strain to 0.310; the formation of the Z ring of E. coli requires the consumption of GT P, and the gene sulA promotes the hydrolysis of GTP, thereby inhibiting the formation of the Z ring. The strain DPAY1-4 overexpressed sulA from Pseudomonas aeruginosa, and the D-pantothenic acid production increased from 8.74g / L to 8.88g / L. Its electron microscope image also showed that the strain was longer, reaching 9.4μm; the strain DPAY1-5 used the dynamic promoter fliC to control the expression of the gene ftsQAZ of the Z ring, and the strain D-pantothenic acid production increased from 8.42g / L to 8.65g / L, while the OD decreased slightly. The above shake flask fermentation results show that this patent can effectively increase the production of D-pantothenic acid by changing the cell division mode of the D-pantothenic acid production starting strain DPAY1, and has great application value.

[0123] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that: include: Change the cell morphology of chassis strains; The method for changing the cell morphology of the chassis strain comprises at least one of the following: (1) Knockout at least one of minCD, nlpD, and rstA in the genome; (2) overexpression of sulA from Pseudomonas aeruginosa; (3) Overexpression of ftsQAZ controlled by a dynamic promoter.

2. The method according to claim 1, characterized in that The method for changing the cell morphology of the chassis strain comprises: knocking out any one of minCD, nlpD, and rstA in the genome through the CRISPR-Cas9 system.

3. The method according to claim 1, characterized in that The method for changing the cell morphology of the chassis strain comprises: knocking out minCD in the genome through the CRISPR-Cas9 system, and inserting sulA under the control of a strong promoter into the minCD site.

4. The method according to claim 1, characterized in that The method for changing the cell morphology of the chassis strain comprises: knocking out yfcU in the genome through the CRISPR-Cas9 system, and inserting ftsQAZ under the control of a dynamic promoter into the yfcU site.

5. The method according to claim 4, characterized in that The dynamic promoter is PfliC.

6. The method according to any one of claims 1 to 5, characterized in that: The chassis bacteria are: E. coli 3110 derivatives; Trc-panCpanEpanBilvC / ilvG* / ΔavtA / ilvE* / coaA* / ΔilvA / Trc-lpd / Δglk / ΔptsG::galp-glk, denoted as DPAY1.

7. A genetically engineered bacterium with high production of D-pantothenic acid obtained by the method of any one of claims 1 to 6.

8. The genetically engineered bacterium for high production of D-pantothenic acid as claimed in claim 7, characterized in that: Any of the following: (1) DPAY1ΔminCD; (2) DPAY1ΔnlpD; (3) DPAY1ΔrstA; (4)DPAY1ΔminCD::sulA P.A ; (5)DPAY1ΔyfcU::PfliC-ftsQAZ.

9. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 7 in the preparation of D-pantothenic acid by microbial fermentation.

10. The use according to claim 9, characterized in that The application comprises: inoculating a genetically engineered bacterium with high D-pantothenic acid production into a fermentation medium, and adding β-alanine, VB1, VB 12 , culture at 25-35°C, 150-200rpm for 24-48h.

Images