Application of circular RNA circAASS in the preparation of products for diagnosis and / or treatment of acute kidney injury

Abstract

The present invention provides an application of circular RNA circAASS in preparing a product for diagnosing and / or treating acute kidney injury, belonging to the field of biomedicine technology. The present invention studies and finds that the expression of circAASS is significantly reduced in the renal cortex tissue of mice in three AKI models (IRI-AKI, CP-AKI and SAKI), indicating that the reduced expression of circular RNA circAASS may promote the occurrence and development of AKI; restoring the expression of circAASS effectively reduces the ROS generation of damaged TEC, inhibits TEC apoptosis and pro-inflammatory response; the circular RNA circAASS provided by the present invention is expected to provide a new strategy for preventing and treating AKI.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of circular RNA circAASS in preparing products for diagnosing and / or treating acute kidney injury. Background Art

[0002] Acute kidney injury (AKI) is a clinical syndrome caused by a variety of causes and characterized by a sharp decline in renal function (Ronco C, Bellomo R, Kellum JA. Acute kidney injury. Lancet (London, England) 2019, 394(10212): 1949-1964.). Ischemia / reperfusion injury (IRI), nephrotoxic drugs, and sepsis are common causes of clinical AKI. At present, clinical treatment of AKI is mainly symptomatic, and there is no specific treatment method. Therefore, there is an urgent need to develop targeted therapeutic drugs and methods. Further revealing the pathogenesis of AKI and designing potential new targets to reduce kidney damage will help improve the prognosis of AKI patients and generate huge social and economic benefits.

[0003] Regarding the pathogenesis of AKI, many scholars at home and abroad have actively explored this. Since tubular epithelial cells (TECs) are the most severely affected cell type in AKI, the role of TEC damage in AKI has received widespread attention and extensive research. TEC apoptosis and proinflammatory response are key factors driving the development of AKI. Targeting TEC apoptosis and proinflammatory response can alleviate AKI damage (Ma T, Li H, Liu H, Peng Y, Lin T, Deng Z, et al. Neat1 promotes acute kidney injury to chronic kidney disease by facilitating tubular epithelial cells apoptosis via sequestering miR-129-5p. Molecular therapy: the journal of the American Society of Gene Therapy 2022, 30 (10): 3313-3332.). In the process of TEC damage, mitochondrial quality control (MQC) imbalance plays an important role. TECs are the cells with the richest mitochondrial content in the body besides cardiomyocytes. They regulate the body's water and salt metabolism and kidney function through the ATP produced by mitochondria (Tang C, Cai J, Yin XM, Weinberg JM, Venkatachalam MA, Dong Z. Mitochondrial quality control in kidney injury and repair. Nature reviews Nephrology 2021, 17(5): 299-318.).MQC is a key mechanism for mitochondria to maintain normal cell physiological activities, mainly including mitochondrial biogenesis, mitochondrial dynamics (fusion and fission), mitochondrial autophagy, etc. (Ng MYW, Wai T, Simonsen A. Quality control of the mitochondrion. Developmental cell 2021, 56(7): 881-905.; Zhan M, Brooks C, Liu F, Sun L, Dong Z. Mitochondrial dynamics: regulatory mechanisms and emerging role in renal pathophysiology. Kidney international 2013, 83(4): 568-581.; Rossmann MP, Dubois SM, Agarwal S, Zon LI. Mitochondrial function in development and disease. Disease models & mechanisms 2021, 14(6).).

[0004] MQC imbalance refers to the decreased expression of mitochondrial biogenesis-related proteins, abnormal mitochondrial dynamics, and mitochondrial autophagy disorders, which lead to excessive production of mitochondrial reactive oxygen species (ROS), reduced ATP production, changes in membrane potential and mitochondrial membrane permeability, activation of mitochondria-dependent apoptotic pathways, various metabolic and oxidative phosphorylation abnormalities, etc., causing cell apoptosis and pro-inflammatory responses (Reichardt C, Brandt S, BernhardtA, Krause A, Lindquist JA, Weinert S, et al. DNA-binding protein-A promotes skidney ischemia / reperfusion injury and participates in mitochondrial function. Kidney international 2024.). Researchers have found that in the AKI state, mitochondrial autophagy function in TEC is insufficient, damaged mitochondria accumulate, and a large number of oxidative stress products are produced, which promote the occurrence and development of AKI. Increasing the level of mitochondrial autophagy helps to improve AKI and protect kidney function (Deng Z, He M, Hu H, Zhang W, Zhang Y, Ge Y, et al. Melatonin attenuates sepsis-induced acute kidney injury by promoting mitophagy through SIRT3-mediated TFAMdeacetylation. Autophagy 2024, 20(1): 151-165.; Deng Z, Sun M, Wu J, Fang H, Cai S, An S, et al. SIRT1 attenuates sepsis-induced acute kidney injury via Beclin1 deacetylation-mediated autophagy activation. Cell death&disease 2021, 12(2): 217.; Sun M, Li J, Mao L, Wu J, Deng Z, He M, et al. p53 DeacetylationAlleviates Sepsis-Induced Acute KidneyInjury by Promoting Autophagy. Frontiers in immunology 2021,12:685523.).

[0005] Circular RNA (circRNA) is a class of circular endogenous RNA with a covalent structure, which is mainly produced by precursor mRNA (pre-mRNA) through variable splicing processing (Liu CX, Chen LL. Circular RNAs: Characterization, cellular roles, and applications. Cell 2022, 185(12): 2016-2034.). The expression of circRNAs in the renal cortex tissue of mice changes in different AKI models caused by IRI, cisplatin and sepsis, and their differential circRNA expression profiles are not the same (Wang P, Huang Z, Peng Y, Li H, Lin T, Zhao Y, et al. Circular RNA circBNC2 inhibits epithelial cell G2-M arresttoprevent fibrotic maladaptive repair. Nature communications 2022, 13(1): 6502.; Li CM, Li M, Ye ZC, Huang JY, Li Y, Yao ZY, et al. Circular RNA expression profilesin cisplatin-induced acute kidney injury in mice. Epigenomics 2019, 11(10): 1191-1207.; Ma T, Wu J, Chen Z. Regulatory networks of circRNA-centred ceRNAs insepsis-induced acute kidney injury. Epigenetics 2023,18(1):2278960.); However, there is no clear conclusion on whether there is a correlation between the expression difference of circRNA and MQC imbalance, whether there is a correlation between the expression difference of circRNA and the occurrence and development of AKI, and whether circRNA can provide a new strategy for the prevention and treatment of AKI. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide the use of circular RNA circAASS in the preparation of products for diagnosing and / or treating acute kidney injury. The present invention found that the expression of circAASS was significantly reduced in the renal cortical tissue of mice in three AKI models (IRI-AKI, CP-AKI and SAKI), indicating that the reduced expression of circular RNA circAASS may promote the occurrence and development of AKI; restoring the expression of circAASS effectively reduces the ROS generation of damaged TEC, inhibits TEC apoptosis and pro-inflammatory response; the circular RNA circAASS provided by the present invention is expected to provide a new strategy for the prevention and treatment of AKI.

[0007] The present invention provides the use of circular RNA circAASS as a molecular marker in the preparation of a kit for diagnosing acute kidney injury, wherein the nucleotide sequence of the circular RNA circAASS is shown as SEQ ID No.1 or SEQ ID No.2.

[0008] SEQ ID No. 1 shows the mouse sequence of circAASS, which is as follows:

[0009]

[0010] SEQ ID No. 2 shows the human sequence of circAASS, which is as follows:

[0011]

[0012] Preferably, the kit comprises a reagent for detecting the expression level of the circular RNA circAASS; the expression level of the circular RNA circAASS is detected, and when the expression level of the circular RNA circAASS is significantly lower than a normal level, it is determined to be acute kidney injury.

[0013] The present invention provides use of circular RNA circAASS in preparing a drug for preventing and / or treating acute kidney injury, wherein the nucleotide sequence of the RNA circAASS is shown as SEQ ID No.1 or SEQ ID No.2.

[0014] Preferably, the biological material overexpressing the circular RNA circAASS is used to prepare the drug.

[0015] The present invention provides use of a biological material overexpressing the circular RNA circAASS in preparing a drug for preventing and / or treating acute kidney injury. The biological material comprises a recombinant vector overexpressing the circular RNA circAASS.

[0016] Preferably, the recombinant vector overexpressing circular RNA circAASS is an adeno-associated virus vector.

[0017] Preferably, the recombinant vector for overexpressing circular RNA circAASS uses pK5ssAAV-ciR as the initial vector, and inserts the circAASS nucleotide sequence shown in SEQ ID No. 1 or SEQ ID No. 2 between the restriction sites of the initial vector. In the present invention, the initial vector pK5ssAAV-ciR is purchased from Guangzhou Jisai Biotechnology Co., Ltd.

[0018] The present invention also provides the use of circular RNA circAASS in the preparation of reagents or drugs for regulating mitochondrial homeostasis, wherein the circular RNA circAASS increases mitochondrial autophagy in renal tubular epithelial cells and promotes mitochondrial biogenesis.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present study found that the expression of circAASS in the renal cortex tissue of mice with three AKI models (IRI-AKI, CP-AKI and SAKI) was significantly reduced, suggesting that the reduced expression of circAASS may promote the occurrence and development of AKI; the expression of circAASS is associated with acute kidney injury, and the expression of circAASS is detected to determine whether it is acute kidney injury; further, the present study found that restoring the expression of circAASS effectively reduces the generation of ROS in damaged TECs, inhibits TEC apoptosis and pro-inflammatory response. The results of molecular mechanism studies suggest that circAASS, on the one hand, improves TEC mitochondrial autophagy by upregulating the mRNA expression of PINK1 molecules, and on the other hand, promotes mitochondrial biogenesis by promoting the stability of PGC-1α protein, thereby improving MQC imbalance.

[0021] In summary, the present invention identified circAASS as a key upstream signaling molecule that causes apoptosis and proinflammatory responses in TEC under AKI conditions, and explored its molecular mechanism for MQC imbalance in TEC, which is expected to provide a new strategy for the prevention and treatment of AKI. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The expression of circAASS in TEC was significantly reduced under AKI state; A. Heat map results showed cluster analysis of differentially expressed circRNAs in renal cortex tissue of mice with sepsis induced acute kidney injury (SAKI); B. Heat map results showed cluster analysis of differentially expressed circRNAs in renal cortex tissue of mice with ischemia / reperfusion injury-induced AKI (I / R-AKI); C. Heat map results showed cluster analysis of differentially expressed circRNAs in renal cortex tissue of mice with cisplatin-induced AKI (CP-AKI); D. Venn diagram results showed that circAASS and circLRRK2 had common differential changes in the three AKI models; E. Sanger sequencing detected the head-tail junction region sequence of human and mouse circAASS; F. RT-PCR detected the expression of circAASS in renal cortex tissue of mice with three AKI models; G. RNA fluorescence in situ hybridization results showed the expression level and localization of circAASS in TEC; ***, P<0.001.

[0023] Figure 2circAASS inhibits apoptosis and pro-inflammatory responses of damaged TEC; AB. Knockdown of circAASS promotes apoptosis of TEC under H / R treatment. CD. Overexpression of circAASS inhibits apoptosis and pro-inflammatory responses of TEC under H / R treatment. E. Knockdown of circAASS promotes the pro-inflammatory response of TEC under H / R treatment. F. Overexpression of circAASS inhibits the pro-inflammatory response of TEC under H / R treatment. **, P<0.01. ***, P<0.001.

[0024] Figure 3 circAASS alleviates mitochondrial dysfunction in damaged TEC; AB.JC-1 test results showed that knockdown of circAASS increased the mitochondrial membrane permeability of TEC under H / R treatment; CD.JC-1 test results showed that overexpression of circAASS reduced the mitochondrial membrane permeability of TEC under H / R treatment; E. Flow ROS detection showed that knockdown of circAASS increased ROS generation in TEC under H / R treatment; F. Flow ROS detection showed that overexpression of circAASS reduced ROS generation in TEC under H / R treatment.

[0025] Figure 4 circAASS alleviates renal injury in AKI mice and protects renal function; among them, AB.PAS test showed that circAASS alleviates renal injury in Cisplatin-AKI mice; CD.PAS test showed that circAASS alleviates renal injury in CLP-AKI mice; EF.PAS test showed that circAASS alleviates renal injury in IRI-AKI mice; G. Blood creatinine test showed that circAASS reduced the blood creatinine level of Cisplatin-AKI mice; H. Blood creatinine test showed that circAASS reduced the blood creatinine level of CLP-AKI mice; I. Blood creatinine test showed that circAASS reduced the blood creatinine level of IRI-AKI mice. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0027] Example 1

[0028] Preparation of mouse model

[0029] (1) Preparation of AKI mouse model

[0030] Ischemia-reperfusion AKI (I / R-AKI) model was established: 8-week-old C57BL / 6 male mice (purchased from Beijing Sibeifu Biotechnology Co., Ltd.) were used. After intraperitoneal injection of 1% sodium pentobarbital, the mice were placed in a prone position on a constant temperature heating pad (37-38°C). A surgical incision was made 1 cm on both sides of the posterior midline to expose the bilateral kidneys and renal hilum. The tissues and blood vessels around the bilateral kidneys were bluntly separated. The renal arteries and renal veins at the renal hilum were simply freed and exposed. After the bilateral renal pedicles were clamped with micro artery clamps, the kidneys changed from blood red to black purple. After 35 minutes, the bilateral artery clamps were released, and the kidneys on both sides changed from black purple to red within 1 minute, indicating that the renal ischemia-reperfusion model was successfully established. The mice were then transferred to a constant temperature heating table to maintain the body temperature of the mice at around 37.5°C. 0.5 ml of normal saline was dripped into the abdominal cavity of the mice, and the muscles, subcutaneous fascia and skin were sutured in sequence. The sham group mice underwent the same operations as the model group except that the bilateral renal pedicles were not clamped.

[0031] (2) Establishment of cisplatin-AKI (CP-AKI) model

[0032] C57BL / 6 male mice aged 6-8 weeks were used. After the mice were adaptively fed for one week, a single dose of 30 mg / kg body weight of cisplatin was intraperitoneally injected into the mice. The mice in the control group were intraperitoneally injected with an equal amount of normal saline.

[0033] (3) Establishment of sepsis AKI (SAKI) model

[0034] Eight-week-old male C57BL / 6 mice were used and anesthetized by intraperitoneal injection of 2% sodium pentobarbital. The cecum below the ileocecal valve was ligated with 4-0 silk ligature. A 20-gauge needle was then used to puncture two locations in the cecum, and the feces were gently squeezed out. The internal organs were then returned to the abdomen and the incision was closed. Mice in the sham group (Sham group) underwent the same surgical procedure, but the cecum was not ligated or punctured. All mice were subcutaneously injected with 50 mL / kg of normal saline for fluid resuscitation after surgery.

[0035] Serum creatinine detection: After collecting blood from mice by the cardiac blood sampling method, the blood was coagulated and centrifuged to collect the supernatant, and the creatinine determination kit (C011-2-1, Nanjing Jiancheng Bioengineering Institute) was used for detection.

[0036] Acute tubular injury score: Mouse kidney sections were stained with PAS and scored according to the severity of tubular injury: 0, no tubular injury; 1, <25% tubular injury; 2, 25-50% tubular injury; 3, >50% tubular injury.

[0037] Example 2

[0038] Analysis and screening of differentially expressed circRNAs in three AKI mouse models

[0039] AKI caused by different pathogenic factors has the same pathological basis, namely, TEC damage, apoptosis, pro-inflammatory response, etc. If universal circRNAs that regulate TEC damage and repair can be found, it will help to discover effective targets for the prevention and treatment of AKI, thereby formulating new strategies for the prevention and treatment of AKI. Therefore, three high-throughput detection datasets of circRNAs in the renal cortex tissues of AKI model mice were jointly analyzed: GSE179506 (a dataset collected by self-sequencing); BioProject ID PRJNA806364 (existing dataset) and GSE220782 (existing dataset), which are derived from high-throughput detection of circRNAs in the renal cortex tissues of three AKI model mice. After comparing the gene name of the precursor mRNA from which the circRNA is derived and the length of the circRNA, it was found that circAASS and circLRRK2 were candidate circRNAs with common dysregulated expression in the three datasets (preliminary experimental results). Figure 1 ), suggesting that both may play an important role in the occurrence of AKI. Considering the clinical translation potential of subsequent studies, we focused on analyzing the conservation of the human and mouse sequences of the two molecules. In the circBase database, we searched for the human homologous circRNA sequences of circAASS and circLRRK2. The results showed that the circAASS sequence was highly conserved between humans and mice, and the sequence length was similar (preliminary experimental results Figure 1 ). Therefore, circAASS was targeted as a candidate molecule for further study. By designing circRNA-specific reverse primers, the linker region sequence of circAASS was detected in HK2 cells and mTECs, respectively, proving that circAASS is indeed a circular RNA that is connected end to end and exists in a circular manner. Further experimental results showed that the expression of circAASS was significantly downregulated in the renal cortex tissue of the three AKI mouse models (preliminary experimental results Figure 1 RNA in situ hybridization results showed that circAASS was expressed in both the cytoplasm and nucleus of TEC, and its expression was significantly downregulated in TEC treated with hypoxia / reoxygenation (H / R), cisplatin, and lipopolysaccharide (LPS) (preliminary experimental results Figure 1 ).

[0040] Example 3

[0041] Identification and analysis of circAASS

[0042] 1) qRT-PCR method: M-MLV First-Strand Synthesis System Reverse Transcription Kit (Invitrogen) and SYBR PremixEx Taq II qPCR Kit (Takara) were used for total RNA (total RNA from mouse kidney cortex tissue or HK2 cell line or mTEC cell line) reverse transcription and quantitative PCR, respectively. Oligo dT primers and random primers can be used for reverse transcription to identify whether the target RNA has a polyA tail; fluorescent quantitative PCR uses circular RNA-specific back primers. Sanger sequencing was assisted by Suzhou Hongxun Biotechnology Co., Ltd.

[0043] Back primer sequence for human circAASS:

[0044] F: CGGGGATCCTGATGTGTTCC (SEQ ID NO.3)

[0045] R: GTGAAGACCCTTGGAGAGGC (SEQ ID NO.4)

[0046] Back primer sequence for mouse circAASS:

[0047] F: TGACAATTTGCCAGCACAGC (SEQ ID NO.5)

[0048] R: TCTGGAGAGGCAGGCTCTAA (SEQ ID NO.6)

[0049] 2) Genomic DNA (gDNA) from cells and tissues: gDNA from human renal proximal tubule HK2 cells was extracted according to the procedures of a gDNA extraction kit (Invitrogen).

[0050] 3) Northern blot method: A digoxigenin-labeled circRNA-specific probe (Generay) was designed based on the sequence of the head-tail junction of circular RNA, and the samples were detected using the Northern blot DIG Luminescent Kit (Roche).

[0051] Probe sequence for detecting mouse circAASS:

[0052] TCAAATGTGGTAGCATTTCTTCA(SEQ ID NO.7)

[0053] Probe sequence for detecting human circAASS:

[0054] CACCTGGTGACATTTCTTCAACA(SEQ ID NO.8)

[0055] 4) FISH method: Use circRNA-specific probes and FITC-conjugated anti-digoxigenin antibody to detect probe signals (Roche). Laser confocal fluorescence microscopy was used to detect the subcellular localization of circRNA.

[0056] 5) Nuclear and cytoplasmic RNA isolation: using PARIS TM Kit (Thermo) was used to separate the cell nucleus and cytoplasm, and then Trizol reagent was used to extract circRNA.

[0057] 6) RNase R (Geneseed) treatment of total RNA of samples: 1 unit of RNase R was added to 10 μg of total RNA, treated at 37°C for 10 min, and then treated at 85°C for 30 s to inactivate the RNase. Subsequently, the total RNA was reverse transcribed and fluorescent quantitative PCR was used to detect the expression of circAASS, AassmRNA and Aass pre-mRNA.

[0058] 7) The cells (renal tubular epithelial cell lines: proximal tubule cell line HK2 from human and mTEC cell line from mouse) were treated with 300 μM Actinomycin D (Sigma) for 4 h, 8 h, 12 h, and 24 h, and the expression levels of linear mRNA and circRNA at the corresponding time points were detected by qRT-PCR.

[0059] 8) Isolation of nuclear and cytoplasmic RNA: The Paris kit of Thermo Company was used to isolate and purify nuclear and cytoplasmic RNA, and the total RNA was extracted with Trizol reagent. The expression levels of circRNA in the cytoplasm and nucleus were detected by qRT-PCR to determine the expression location of circRNA.

[0060] Test results such as Figure 1 As shown in E, F and G, Figure 1 E: Sequence alignment analysis showed that the circAASS sequences of humans and mice were highly conserved (87%). Combined Sanger sequencing analysis results showed that reverse splicing sequences were detected in total RNA derived from human and mouse renal tubular epithelial cell lines.

[0061] Figure 1 F: circAASS expression in the renal cortex was decreased in three AKI models in mice, namely, sepsis-associated AKI model (SAKI), ischemia-reperfusion injury AKI model (I / R-AKI), and cisplatin-induced AKI model (CP-AKI).

[0062] Figure 1G: Fluorescence in situ hybridization results showed that circAASS was highly expressed in the cytoplasm and nucleus of normal HK2 cells, while its expression was decreased in HK2 cells treated with hypoxia / reoxygenation (H / R), cisplatin, and LPS.

[0063] Example 4

[0064] 1) Regulatory effect of circAASS expression intervention on apoptosis and pro-inflammatory response of TEC cells treated with normal, H / R (H / R corresponds to I / R-AKI model), cisplatin (corresponding to CP-AKI model) and LPS (corresponding to SAKI model) mRNA sequencing (Wuhan Kangce Technology Co., Ltd.) was performed on the knockdown circAASS and control group HK2 to analyze the differentially expressed genes, and GeneOntology was used to further analyze the biological functions enriched in the differentially expressed genes.

[0065] Knockdown of circAASS was achieved by transfecting circAASS small interfering RNA.

[0066] The sequence of the small interfering RNA targeting mouse circAASS is as follows:

[0067] TGTGGTAGCATTTCTTCAA(SEQ ID NO.9)

[0068] The small interfering RNA sequences targeting human circAASS are as follows:

[0069] ACCTGGTGACATTTCTTCA(SEQ ID NO.10)

[0070] 2) After knocking down or overexpressing circAASS, the expression of pro-inflammatory response genes (MCP-1, TNF-α, IL-1β) in TECs treated with control group, H / R (hypoxia for 24 h / reoxygenation for 12 h), cisplatin (20 μM), or LPS (10 μg / mL) was detected.

[0071] 3) After knockdown or overexpression of circAASS, flow cytometry was used to detect cell apoptosis: the proportion of cell apoptosis was detected by flow cytometry after staining using an apoptosis detection kit (Lianke Bio).

[0072] Effect of in vivo intervention of circAASS expression on TEC injury in AKI mice

[0073] 1) Adeno-associated virus (AAV) vectors for knockdown and overexpression of circAASS were constructed and AAV virus serotype 9 (AAV9) venom was packaged (commissioned by Shanghai Gene Gene Technology Co., Ltd.). The following AAVs were packaged: AAV9-circAASS Knockdown (AAV-circAASS KD) and AAV9-circAASS Overexpression (AAV-circAASSOE) and AAV9-emptyvector.

[0074] In order to observe the in vivo function of circAASS, the AKI model was prepared by injecting AAV virus 14 days in advance, and the mouse kidney tissue and serum were collected for subsequent testing 24h (I / R-AKI and SAKI) or 72h (CP-AKI) after modeling.

[0075] Detection of TEC pro-inflammatory response and cell apoptosis: a. Western blot was used to detect the expression of pro-inflammatory and pro-apoptotic proteins in fresh mouse kidney tissue; b. TUNEL staining kit (Promega) was used to detect the proportion of TECs apoptosis in mouse kidney paraffin sections.

[0076] Immunohistochemistry was used to detect the expression of pro-inflammatory and pro-apoptotic proteins in TEC of mouse kidney paraffin sections.

[0077] PAS staining was used to evaluate the acute tubular injury score of mouse kidneys using the same method as above.

[0078] Serum creatinine test: the method is the same as before.

[0079] The results are as follows Figure 2 As shown: AB, knockdown of circAASS promotes apoptosis of TEC under H / R treatment. CD. Overexpression of circAASS inhibits apoptosis and pro-inflammatory response of TEC under H / R treatment. E. Knockdown of circAASS promotes the pro-inflammatory response of TEC under H / R treatment. F. Overexpression of circAASS inhibits the pro-inflammatory response of TEC under H / R treatment.

[0080] like Figure 4 As shown: Overexpression of circAASS in mice alleviated renal damage in Cisplatin-AKI, CLP-AKI and IRI-AKI mice, reduced blood creatinine levels, and protected renal function.

[0081] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the expression of circular RNA circAASS in the preparation of a kit for diagnosing acute kidney injury, characterized in that: The nucleotide sequence of the circular RNA circAASS is shown as SEQ ID No.1 or SEQ ID No.

2.

2. The use according to claim 1, characterized in that: The expression level of the circular RNA circAASS is detected, and when the expression level of the circular RNA circAASS is significantly lower than the normal level, it is determined to be acute kidney injury.

3. The use of circular RNA circAASS in the preparation of a drug for treating acute kidney injury, characterized in that: The nucleotide sequence of the RNAcircAASS is shown as SEQ ID No.1 or SEQ ID No.

2.

4. Use of a biomaterial overexpressing circular RNA circAASS in the preparation of a drug for treating acute kidney injury, characterized in that: The biological material includes a recombinant vector for overexpressing circular RNA circAASS.

5. The use according to claim 4, characterized in that: The circular RNA circAASS overexpression recombinant vector is an adeno-associated virus vector.

6. The use according to claim 5, characterized in that: The recombinant vector for overexpressing circular RNA circAASS uses pK5ssAAV-ciR as an initial vector, and inserts a circAASS nucleotide sequence as shown in SEQ ID No. 1 or SEQ ID No. 2 between the restriction sites of the initial vector.

Images