Alkaline xylanase mutants

Abstract

The present application relates to the field of genetic engineering and protein modification technology, and particularly relates to a novel basic xylanase mutant. The present application is based on wild-type xylanase H1, and provides a mutant containing at least one mutation site of Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, D192E. The tolerance of the mutant to high temperature and alkaline environment is significantly improved, which is beneficial to its wide application in the field of papermaking.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a basic xylanase mutant. BACKGROUND

[0002] The papermaking industry has been a heavily polluting industry. In recent years, with the increasing emphasis on environmental protection and the strengthening of pollution control in China, the requirements for pulping and papermaking processes are becoming higher and higher. Whether in the improvement of production process or the addition of papermaking additives, the development is towards the direction of green environmental protection. Enzymes are increasingly widely used in the pulp and paper industry. They are used in various stages of the process, such as cooking, bleaching, beating, deinking of waste paper, and control of adhesives. The application of enzymes in pulp bleaching is a hot topic in the application of enzymes in papermaking in recent years. The addition of enzymes in the bleaching process can reduce the amount of chemical bleaching agent, improve the whiteness of bleached pulp, reduce the content of ion waste in bleaching waste liquid, and improve the recycling rate of white water. Enzyme preparations commonly used in pulp bleaching include xylanase and laccase.

[0003] Xylanase in a broad sense refers to a complex enzyme system capable of degrading a large amount of hemicellulose xylan existing in nature, especially in plant fibers, including β-1, 4-endoxylanase, β-xylosidase, α-L-arabinosidase, etc. Xylanase in a narrow sense mainly refers to β-1, 4-endoxylanase. β-1, 4-endoxylanase mainly acts on the β-1, 4-glycosidic bond in xylan molecules, thereby cutting the β-1, 4-glycosidic bond to degrade xylan into small molecular oligosaccharides and xylobiose, as well as a small amount of xylose and arabinose. β-xylosidase and α-L-arabinosidase mainly degrade oligosaccharides into monosaccharides, thereby completely degrading xylan into monosaccharides.

[0004] Xylanase has a wide source. Animals, plants and microorganisms in nature can produce xylanase. Microorganisms are the most widely used source of xylanase. At present, the screening and research of xylanase are mostly started from microorganisms, mainly some bacteria and fungi. Studies have shown that xylanase secreted by bacteria is both acidic and alkaline, while xylanase secreted by fungi is only alkaline. Therefore, the strains can be selected according to the actual application requirements of xylanase. At present, the production of xylanase is mainly realized by fermentation of bacteria and fungi.

[0005] Xylanase has been widely used in pulp and paper industry, and the most common application is as a bleaching aid in the bleaching section of pulp and paper process. Many studies have found that xylanase pretreatment can improve the bleaching performance of pulp and increase the brightness of the bleached pulp. Garg et al. used xylanase from Bacillus stearothermophilus SDX to treat pulp at 60℃ for 120 min, and found that the brightness of the treated pulp increased by 4.75%. In addition, many pulp mills at home and abroad found that the application of xylanase before the bleaching section can reduce the cost of chemical pulp bleaching and reduce the bleaching load by about 5%~20% to achieve the required brightness.

[0006] However, due to the high temperature and alkaline environment in the actual production process of pulp bleaching, general xylanase is difficult to survive in such an environment and is difficult to play a role, therefore, it is necessary to develop xylanase with temperature and alkali resistance. The present application prepares xylanase with temperature and alkali resistance by means of protein engineering, which can be widely used in papermaking industry. SUMMARY

[0007] The purpose of the present application is to provide a novel alkaline xylanase mutant. The heat resistance of the mutant is significantly improved, which is beneficial to its wide application in the field of papermaking.

[0008] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0009] The present application relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity to SEQ ID NO: 1, and comprising a substitution of an amino acid at at least one position selected from the group consisting of 24, 38, 40, 41, 56, 57, 59, 61, 75, 80, 103, 107, 114, 129, 132, 135, 143, 144, 149, 151, 154, 157, 160, 165, 166, 167, 177, 192, compared to SEQ ID NO: 1.

[0010] In some embodiments of the present application, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity to SEQ ID NO: 1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity to SEQ ID NO: 1.

[0012] In some embodiments of the present application, the mutant comprises substitution of at least one amino acid in the following group: Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, D192E.

[0013] The present application also relates to a DNA molecule encoding the above-mentioned xylanase mutant.

[0014] The present application also relates to a recombinant expression vector comprising the above-mentioned DNA molecule.

[0015] The present application also relates to a host cell comprising the above-mentioned recombinant expression vector.

[0016] The above-mentioned plasmid is transformed into a host cell, and the heat resistance and alkali resistance of the recombinantly expressed xylanase mutant are significantly improved.

[0017] In some embodiments of the present application, the host cell is Pichia pastoris (P. pastoris). Pichia pastoris ).

[0018] In some embodiments of the present application, the host cell is Trichoderma reesei (T. reesei). Trichoderma reesei .

[0019] The present application also provides application of the above-mentioned xylanase mutant in the field of papermaking.

[0020] The application provides a mutant containing at least one mutation site of Q24P, S38V / K / W / H / T / I, G40M / R / K / F / H, D41P, N56L / I / P / K, A57E / D / Y, A59K / R / I / M / H, H61F / Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R / M, D135M, N143D, K144R, T149L, Q151N / Y, C154N, D157E, A160E, N165D, V166I, N167S / W, T177V, D192E based on wild-type xylanase H1. Compared with the wild-type xylanase H1, the relative enzyme activity of the single-point mutant provided by the application is generally increased by 12.2%-71.4% under the condition of 75 DEG C. The relative enzyme activity of the mutant containing S38T, S38W, D41P and T177V is all more than 80% under the condition of 75 DEG C, which is much higher than that of the wild-type xylanase H1, and an unexpected technical effect is achieved.

[0021] After being treated under the condition of pH 9.0-11.0 for 2h, the enzyme activity residual rate of the wild-type xylanase H1 and the single-point mutant is generally higher than 91%, and almost no enzyme activity loss is caused.

[0022] After being treated under the condition of pH 12.0 for 2h, the enzyme activity residual rate of the wild-type xylanase H1 is only 45.06%, while the enzyme activity residual rate of the single-point mutant of xylanase is as high as 61.51-93.29%, especially the enzyme activity residual rate of the mutant containing S38T, S38W, D41P and T177V is as high as 90.6%, 92.33%, 93.11% and 93.29% respectively. Therefore, the single-point mutant provided by the application has a significantly improved tolerance to alkaline environment, and an unexpected technical effect is achieved.

[0023] In summary, the xylanase mutant provided by the application has a significantly improved tolerance to high temperature and alkaline environment, and is thus beneficial to the wide application of xylanase in the field of papermaking. DETAILED DESCRIPTION

[0024] The application discloses a xylanase mutant, a preparation method and application thereof, a DNA molecule, a vector and a host cell for coding the xylanase mutant, and those skilled in the art can refer to the content of the application, and appropriately improve the process parameters. The method and application of the application have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described in the application without departing from the content, spirit and scope of the application, so as to realize and apply the technology of the application.

[0025] The present application uses the conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods described in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental protocols and reagents in the field on the basis of the technical solutions described in the present application, without being limited by the limitations of the specific embodiments of the present application. For example, the present application can use the following experimental materials and reagents:

[0026] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, G418 were purchased from Invitrogen Company.

[0027] Enzymes and kits: PCR enzymes and ligase were purchased from Takara Company, restriction endonucleases were purchased from Fermentas Company, plasmid extraction kit and gel purification and recovery kit were purchased from Omega Company, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeisi Biological Technology Co., Ltd.

[0028] Culture medium formula:

[0029] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0030] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0031] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0032] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0033] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0034] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0035] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0036] Upper culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0037] The lower culture medium plate contains: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, and 1.5% agar.

[0038] The present invention will be further illustrated below with reference to the embodiments:

[0039] Example 1 Construction of recombinant plasmid

[0040] The source of Paecilomyces ( Paecilomyces. sp The xylanase gene (GeneBank ACS26244.1) of *Pichia pastoris* was optimized based on codon bias, with the addition of 6 bases GAATTC (EcoRI cleavage site) before the start codon ATG and GCGGCCGC (Not I cleavage site) after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. This xylanase was named H1, with its amino acid sequence SEQ ID NO: 1 and encoding nucleotide sequence SEQ ID NO: 2.

[0041] The xylanase gene was digested with restriction endonucleases EcoRI and Not I (Fermentas); simultaneously, the plasmid pPIC9K was digested with the same restriction endonucleases. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α *E. coli* (Invitrogen) and selected using ampicillin. To ensure accuracy, several clones were sequenced.

[0042] The plasmid was purified from the correctly sequenced E. coli clone using the Plasmid Mini-Preparation Kit (Omega) to obtain one recombinant plasmid, which was named pPIC9K-H1.

[0043] Example 2: Screening of high-temperature and alkali-resistant mutants

[0044] In order to further improve the tolerance of xylanase H1 to high temperature and alkaline conditions, the applicant analyzes the protein structure. The protein is a GH11 family xylanase, and the structure is a beta-jelly roll structure. The protein surface and the active center of the protein are exposed to the outside environment. Therefore, it is believed that changes in the external environment, especially high temperature or strong acid-base environment, can directly affect the stability of the surface structure of the enzyme and the stability of the active center of the enzyme. Therefore, in order to improve the tolerance of the enzyme in the environment, the rigidity of the whole protein should be improved to stabilize the overall structure of the enzyme. Without destroying the secondary structure of the protein and the active center, the gene is further mutated.

[0045] 1.1 Design PCR primers H1-F1 and H1-R1:

[0046] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (underlined is the restriction endonuclease EcoRI recognition site);

[0047] H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (underlined is the restriction endonuclease NotI recognition site).

[0048] Using the H1 gene (SEQ ID NO: 1) as a template, the above primers, and the GeneMorph II random mutation PCR kit (Bomeisi), PCR amplification was performed. The PCR product was recovered by gel, and EcoRI and NotI were used for enzyme treatment. After being connected with the pET21a vector treated with the same enzyme, it was transformed into Escherichia coli BL21 (DE3) and coated on LB+Amp plates. After being cultured at 37°C, the transformants were picked out one by one with a toothpick and added to 150ul of LB+Amp medium containing 0.1mM IPTG in each well. After being cultured at 37°C and 220rpm for about 6h, the supernatant was discarded after centrifugation, and the bacterial cells were resuspended with buffer. After repeated freeze-thawing, the E. coli cell lysate containing xylanase was obtained.

[0049] Three lysates were taken out and treated as follows: the first and second lysates were diluted with a buffer at pH 8.0, and the third lysate was treated with a preheated buffer at pH 10.0 for 2h at 37°C and then diluted with a buffer; 30ul of the treated lysates were placed in three new 96-well plates, and 30ul of the substrate prepared with the corresponding buffer was added to each well; after being reacted at 50°C for 30min, the first and third treated lysates were reacted at 75°C for 30min, and the reducing sugar was determined by the DNS method. The enzyme activity levels of different mutants were calculated.

[0050] The experimental results show that different mutants have different activity. Some mutants have higher enzyme activity under high temperature reaction conditions and strong alkali treatment conditions, some mutants even make the tolerance become worse; in addition, some mutants can improve the tolerance of xylanase, but after mutation, the enzymatic properties have changed significantly, which does not meet the requirements. Finally, the applicant screened and obtained the mutation sites which can significantly improve the tolerance of xylanase and will not significantly affect the enzyme activity and original enzymatic properties: Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, A57E, A57D, A57Y, A59K, A59R, A59I, A59M, A59H, H61F, H61Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143D, K144R, T149L, Q151N, Q151Y, C154N, D157E, A160E, N165D, V166I, N167S, N167W, T177V, D192E.

[0051] Based on the wild-type xylanase H1, the application provides mutants containing the above single mutation sites respectively.

[0052] Referring to the amino acid sequence of the mutant, the coding nucleotide sequence of the xylanase mutant is obtained respectively.

[0053] Example 3 Expression of xylanase in Pichia pastoris

[0054] 3.1 Construction of expression vector

[0055] According to the codon bias of Pichia pastoris, the gene sequences of xylanase H1 and its mutants are optimized, synthesized by Shanghai Jeery Bioengineering Co., Ltd., and EcoRI and NotI two enzyme digestion sites are added at the 5' and 3' ends of the synthesized sequence respectively.

[0056] According to the method described in Example 1, the synthetic xylanase H1 and its mutant gene sequences were respectively digested with EcoRI and NotI, then connected with the same enzyme cut pPIC-9K vector at 16℃ overnight, and transformed into E. coli DH5a, coated on LB+Amp plate, 37℃ inverted culture, after the appearance of the transformants, colony PCR (reaction system: template for picking single clone, rTaq DNA polymerase 0.5ul, 10x Buffer 2.0μL, dNTPs(2.5mM) 2.0μL, 5'AOX primer(10mM):0.5μL, 3'AOX primer:0.5μL, ddH2O 14.5μL, reaction program: 95℃ pre-denaturation 5min, 30 cycles: 94℃ 30sec, 55℃ 30sec, 72℃ 2min, 72℃ 10min). Verify positive clones, and obtain the correct recombinant expression plasmid after sequencing verification.

[0057] 3.2 Construction of Pichia pastoris engineering strain

[0058] 3.2.1 Preparation of yeast competent cells

[0059] The Pichia pastoris GS115 strain was activated on YPD plate, and after 30℃ culture for 48 h, the activated GS115 single colony was inoculated in 6 mL YPD liquid medium, 30℃, 220 rpm, cultured for about 12 h, then the bacterial liquid was transferred to a flask containing 30 mL YPD liquid medium, 30℃, 220 rpm, cultured for about 5 h, and the bacterial density was detected by ultraviolet spectrophotometer. When the OD600 value was in the range of 1.1-1.3, 4℃, 9000 rpm centrifugation for 2 min, 4 mL bacterial cells were collected into sterile EP tubes, the supernatant was discarded, and the residual supernatant was absorbed with sterile filter paper. Then the bacterial cells were resuspended with 1 mL pre-cooled sterile water, 4℃, 9000 rpm centrifugation for 2 min, the supernatant was discarded, and the bacterial cells were resuspended with 1 mL pre-cooled sterile water. Then the bacterial cells were resuspended with 1 mL pre-cooled sterile water, 4℃, 9000 rpm centrifugation for 2 min, the supernatant was discarded, and the bacterial cells were resuspended with 100-150 μl pre-cooled sorbitol (1 mol / L).

[0060] 3.2.2 Transformation and screening

[0061] The recombinant expression plasmid obtained in 3.1 was linearized with Sac I, and the linearized fragment was purified and recovered by electroporation method. The recombinant Pichia pastoris strain was obtained by transforming Pichia pastoris GS115 on MD plate, and then the multi-copy transformants were screened on YPD plate containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0062] The obtained transformants were respectively inoculated into BMGY medium and cultured at 30°C, 250 rpm for 1 d, then transferred into BMMY medium and cultured at 30°C, 250 rpm; 0.5% methanol was added every day for 4 d of induction; and the bacteria were removed by centrifugation at 9000 rpm for 10 min to obtain the fermentation supernatant containing xylanase H1 and xylanase mutant, respectively.

[0063] (1) Definition of xylanase enzyme activity unit

[0064] The enzyme amount required for degrading and releasing 1 μmol of reducing sugar from a xylan solution with a concentration of 5 mg / ml per minute under the condition of 50°C and pH 8.0 is defined as one enzyme activity unit, which is expressed by U.

[0065] (2) Xylanase enzyme activity determination method

[0066] 10.0 ml of xylan solution was taken and equilibrated at 50°C for 20 min.

[0067] 10.0 ml of the enzyme solution diluted appropriately was taken and equilibrated at 50°C for 5 min.

[0068] Blank sample determination: 2.00 ml of the enzyme solution diluted appropriately (which had been equilibrated at 50°C) was taken and added to a graduated test tube, 5 ml of DNS reagent was added, and electromagnetic shaking was performed for 3 s. Then, 2.0 ml of xylan solution was added, equilibrated at 50°C for 30 min, and heated in a boiling water bath for 5 min. After cooling to room temperature with tap water, water was added to make the volume 25 ml, and electromagnetic shaking was performed for 3 s to 5 s. The standard blank sample was used as a blank control, and the absorbance A at 540 nm was determined. B .

[0069] Sample determination: 2.00 ml of the enzyme solution diluted appropriately (which had been equilibrated at 50°C) was taken and added to a graduated test tube, 2.0 ml of xylan solution (which had been equilibrated at 50°C) was added, electromagnetic shaking was performed for 3 s, and accurate incubation at 50°C was performed for 30 min. 5.0 ml of DNS reagent was added to terminate the enzymatic reaction. The mixture was heated in a boiling water bath for 5 min, cooled to room temperature with tap water, water was added to make the volume 25 ml, and electromagnetic shaking was performed for 3 s. The standard blank sample was used as a blank control, and the absorbance A at 540 nm was determined. E .

[0070]

[0071] In the formula:

[0072] X D The activity of xylanase in the sample diluent is U / ml.

[0073] A E Absorbance of enzyme reaction solution

[0074] A B Absorbance of enzyme blank

[0075] K - slope of standard curve

[0076] C O Intercept of standard curve

[0077] M - molar mass of xylose M (C5XYN110O5) = 150.2 g / mol

[0078] t - enzymatic reaction time, min

[0079] 1000 - conversion factor, 1 mmol = 1000 pmol

[0080] X D The value should be between 0.04 and 0.10 U / ml. If it is not in this range, the dilution of the enzyme solution should be reselected and the analysis determination should be performed again.

[0081] X = X D ·D f (2)

[0082] X - activity of xylanase in sample, U / ml

[0083] Df - dilution factor of sample

[0084] (3) Determination results

[0085] According to the above method, the enzyme activity detection results show that the enzyme activity of the recombinant Pichia pastoris strain fermentation supernatant of the recombinant expressed xylanase H1 and its mutants obtained by the above method is 310-550 U / mL.

[0086] Example 4 Expression of xylanase in Trichoderma reesei

[0087] First, according to the codon bias of Trichoderma, the gene sequences of xylanase H1 and its mutants were optimized respectively. The optimized gene sequences were synthesized by Shanghai Jeery Bioengineering Co., Ltd., and KpnI and MluI enzyme digestion sites were added at the 5' and 3' ends of the synthesized sequences respectively.

[0088] 4.1 Construction of expression vector

[0089] The synthesized xylanase gene fragment and the pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas), respectively. The digestion products were purified using a gel purification kit, and the xylanase gene and pSC1G vector digestion products were ligated using T4 DNA ligase (Fermentas) and transformed into E. coli Trans5α (Transgen). Selection was performed using ampicillin, and the clones were sequenced (Invitrogen) for verification. After successful sequencing, recombinant plasmids containing the xylanase gene were obtained.

[0090] 4.2 Construction of recombinant Trichoderma reesei strains

[0091] (1) Preparation of protoplasts

[0092] Take the host fungus Trichoderma reesei ( Trichoderma reesei UE spore suspension was inoculated onto PDA plates and cultured at 30℃ for 6 days. After abundant sporulation, colonies of about 1cm×1cm were cut and placed in liquid medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine) and cultured at 30℃ with shaking at 220 rpm for 14~16 h.

[0093] Mycelia were collected by filtration through sterile gauze and washed once with sterile water. The mycelia were placed in an Erlenmeyer flask containing 20 mL of 10 mg / mL lysin solution (Sigma L1412) and incubated at 30 °C and 90 rpm for 1-2 h. The progress of protoplast transformation was detected by microscopic observation.

[0094] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to resuspend the bacterial cells, centrifuge at 3000 rpm, 4℃ for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to resuspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).

[0095] (2) Transformation of expression carriers

[0096] The following operations are all carried out on ice, 10 μg of the above constructed recombinant plasmid is added into 7 mL sterile centrifuge tube containing 200 μL protoplast solution, then 50 μL 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) is added, the tube bottom is flicked to mix, and it is placed on ice for 20 min; 2 mL 25% PEG is added, and after mixing, it is placed at room temperature for 5 min; 4 mL 1.2 M sorbitol is added, and after mixing, it is poured into the upper medium which is melted and kept at 55°C; after mixing, it is spread on the prepared lower medium plate, and it is cultured at 30°C for 5-7 d until the transformants grow, the grown transformants are picked to the lower medium plate for re-screening, and the strain with smooth colony edge is the positive transformant.

[0097] According to the above method, the applicant respectively constructs the recombinant Trichoderma reesei engineering strain expressing xylanase H1 and its mutant.

[0098] (3) Fermentation verification and enzyme activity determination

[0099] The above constructed Trichoderma reesei engineering strain is inoculated into PDA solid plate, and it is inverted and cultured in a 30°C constant temperature incubator for 6-7 days; after the spores are abundant, two pieces of mycelium block with a diameter of 1 cm are respectively inoculated into 250 mL flask containing 50 mL fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn syrup, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements), and it is cultured at 30°C for 48 hours, and then it is cultured at 25°C for 48 hours. The fermentation broth is centrifuged, and the fermentation supernatant containing xylanase H1 and its mutant is obtained.

[0100] According to the above method, the enzyme activity is detected, and the results show that the enzyme activity of the fermentation supernatant of the above constructed recombinant Trichoderma reesei strain expressing xylanase H1 and its mutant is 300-500 U / mL.

[0101] Example 5 Heat resistance analysis of xylanase mutant

[0102] The above recombinant strain fermentation supernatant is diluted 10 times with 0.1 M sodium phosphate dibasic-0.05 M citric acid buffer, and the diluted xylanase enzyme activity is determined at 50°C and 75°C respectively. The relative enzyme activity at 75°C is calculated based on the enzyme activity of the fermentation supernatant at 50°C as 100%. The specific results are shown in Table 1.

[0103] Relative enzyme activity (%) = sample enzyme activity at 75°C / sample enzyme activity at 50°C x 100%.

[0104] Table 1 Relative enzyme activity levels of xylanase H1 and its mutants at 75℃

[0105] Xylanase and single point mutants thereof 75°C / 50°C relative enzyme activity (%) Wild type H1 49% Q24P 56% S38T 84% N56I 68% G40M 56% G40R 58% G40K 55% G40F 59% G40H 60% S38V 69% S38K 68% S38W 82% S38H 68% S38T 62% S38I 69% D41P 84% N56L 59% N56I 68% N56P 59% N56K 60% A57E 61% A57D 59% A57Y 68% A59K 64% A59R 62% A59I 72% A59M 71% A59H 59% H61F 56% H61Y 67% A75S 67% T80M 65% T103I 57% T107E 67% T114Y 58% Q132M 59% Q132R 55% D135M 72% N143D 64% K144R 60% T149L 55% Q151N 62% Q151Y 69% C154N 56% D157E 56% A160E 68% N165D 64% N167S 58% N167W 58% T177V 81%

[0106] As can be seen from the data in Table 1, the relative enzyme activity of the single-point mutants provided by the present application at 75℃ is generally increased by 12.2%-71.4% compared with the wild-type xylanase H1. Among them, the relative enzyme activity of the mutants containing S38T, S38W, D41P, and T177V single points at 75℃ is all more than 80%, which is much higher than that of the wild-type xylanase H1. Therefore, the heat resistance of the single-point mutants provided by the present application is significantly improved, and unexpected technical effects are achieved.

[0107] Example 6 Analysis of the tolerance of xylanase mutants to alkaline environment

[0108] The fermentation supernatant of the above recombinant strain was diluted to 50U / ml with deionized water; 1ml of the supernatant was added into 9ml of the corresponding buffer solution (pH 9.0, 10.0, 11.0, 12.0) which had been preheated for 10min, and treated at 37℃ for 2h; 5ml of the supplement was quickly added after the reaction, and then diluted with buffer solution to measure the residual enzyme activity. The enzyme activity of the untreated fermentation supernatant was taken as 100%, and the residual rate of enzyme activity was calculated.

[0109] Enzyme activity residual rate (%) = enzyme activity of the treated sample / enzyme activity of the untreated sample × 100%.

[0110] The results show that after treatment at pH 9.0-11.0 for 2h, the enzyme activity residual rate of the wild-type xylanase H1 and its single-point mutants is generally higher than 91%, and there is almost no loss of enzyme activity.

[0111] After treatment at pH 12.0 for 2h, the enzyme activity residual rate of the wild-type xylanase H1 is only 45.06%, while the enzyme activity residual rate of the xylanase single-point mutants is as high as 61.51-93.29%, especially the mutants containing S38T, S38W, D41P, and T177V single points, the enzyme activity residual rates are as high as 90.6%, 92.33%, 93.11%, and 93.29%, respectively. Therefore, the tolerance of the single-point mutants provided by the present application to alkaline environment is significantly improved, and unexpected technical effects are achieved.

[0112] To sum up, the mutation sites Q24P, S38V, S38K, S38W, S38H, S38T, S38I, G40M, G40R, G40K, G40F, G40H, D41P, N56L, N56I, N56P, N56K, A57E, A57D, A57Y, A59K, A59R, A59I, A59M, A59H, H61F, H61Y, A75S, T80M, T103I, T107E, T114Y, D129L, Q132R, Q132M, D135M, N143D, K144R, T149L, Q151N, Q151Y, C154N, D157E, A160E, N165D, V166I, N167S, N167W, T177V, D192E screened by the application can significantly improve the tolerance of xylanase H1 to high temperature and alkaline environment, thereby facilitating the wide application of xylanase H1 in the papermaking industry.

Claims

1. A xylanase mutant, characterized in that, The mutant is that the 41th amino acid of xylanase with amino acid sequence of SEQ ID NO: 1 is changed from Asp to Pro.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid of claim 3.

5. The host cell of claim 4, wherein The host cell is Pichia pastoris Pichia pastoris ).

6. The host cell of claim 4, wherein The host cell is Trichoderma reesei Trichoderma reesei ).

7. Use of the xylanase mutant of claim 1 in the field of papermaking.

Images