Application of hsacirc0008581 as biomarker for esophageal cancer auxiliary diagnosis and / or esophageal cancer patient prognosis prediction

Abstract

The invention discloses an application of circular RNA (Ribonucleic Acid) hsacirc0008581 as a biomarker for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients. The circular RNA hsacirc0008581 is highly expressed in esophageal cancer tumor tissues, the highly expressed hsacirc0008581 can significantly promote the increase of malignant phenotypes such as invasion, migration, metastasis and the like of esophageal cancer cells, and meanwhile, the high expression level of the hsacirc0008581 is significantly related to the shorter total lifetime of esophageal cancer patients, that is, the hsacirc0008581 can be used as an independent risk prognosis prediction factor of the esophageal cancer patients. Therefore, the hsacirc0008581 can be used as a novel biomarker for effectively assisting in diagnosing the esophageal cancer and / or predicting the metastasis risk and / or the total lifetime of the esophageal cancer patient and a novel target for treating the esophageal cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and more specifically, relates to the application of circular RNA hsa_circ_0008581 as a biomarker for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients. Background Art

[0002] Esophageal cancer is divided into esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC) according to histological type. These two subtypes not only show different etiologies and pathogenesis, but also have obvious geographical differences. Overall, esophageal squamous cell carcinoma (ESCC) accounts for about 90% of esophageal cancer. Studies have shown that ESCC is related to environmental factors, including smoking, alcoholism, and gene mutations. Due to the lack of early specific symptoms, a large number of ESCC patients are diagnosed at the late stage or with distant metastasis, resulting in poor prognosis.

[0003] Clinically, imaging technology is the most commonly used to diagnose and predict the prognosis of esophageal cancer. Imaging technology refers to the technology that uses various imaging technologies to image the internal structures and organs of the human body, so as to understand the anatomical and physiological functions and pathological changes of the human body and achieve the purpose of diagnosis. Imaging technology includes ordinary X-ray imaging, ultrasound imaging, X-ray computed tomography (CT), magnetic resonance imaging (MRI), single photon emission tomography (sPECT) and positron emission tomography (PET). In esophageal cancer, the staging of esophageal cancer and the efficacy of radiotherapy and chemotherapy are mostly evaluated by X-ray barium meal angiography, esophagoscopy, computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography-computed tomography (PET-CT) and endoscopic ultrasound (EUS). Although medical imaging can provide doctors with non-invasive visual information about esophageal cancer patients, help doctors make accurate diagnoses and provide a basis for formulating treatment plans, and can also be used for surgical planning and guiding the surgical process, guiding doctors to perform precise surgical operations, it is difficult to avoid the damage caused by radiation. Systemic chemotherapy and radiotherapy are the main treatments for advanced esophageal cancer, but their efficacy has reached a bottleneck due to the multiple drug resistance mechanisms of the tumor. Despite the improvement of new tumor markers and advanced treatment strategies, such as targeted therapy and immunotherapy, the 5-year survival rate of esophageal squamous cell carcinoma remains poor. Even after surgical resection, patients often experience local recurrence or distant metastasis. ESCC patients are usually diagnosed with lymph node metastasis in the late stage, which leads to high mortality. Overall, the five-year treatment rate for patients with advanced esophageal cancer is usually less than 20%, and in some countries, this rate is as low as 5%. Therefore, finding new diagnostic markers and potential therapeutic targets, diagnosing esophageal cancer early, and elucidating the molecular basis of tumor occurrence and development are key steps in the treatment of esophageal cancer and help improve the survival time of patients with esophageal cancer.

[0004] In recent years, the role of circular RNA (circRNAs) in the occurrence and progression of tumors has attracted widespread attention from researchers. CircRNAs are a new type of non-coding RNAs (non-coding RNAs) with a covalently closed ring structure without a 5' cap and a 3' tail, which makes their structure more stable and highly resistant to nuclease exonucleases. However, when circRNAs were first discovered in viruses in 1976, only a few circRNAs were detected, and at that time they were considered to be byproducts of mis-splicing events without biological functions. It was not until the widespread application of high-throughput RNA sequencing (RNA-seq) and bioinformatics algorithms that the study of circRNAs made significant progress. Recent studies have confirmed that circRNAs play an important role in regulating transcription at the gene expression and post-transcriptional levels, modifying cell proliferation, differentiation and apoptosis, mediating cellular immune responses, and the occurrence, development, drug resistance and metastasis of various cancers (including ESCC). It is precisely because of the unique stability of circRNAs that they have a unique advantage as markers for tumor diagnosis and prognosis prediction.

[0005] Patent CN114457158A discloses the use of a circular RNA Hsa_circ_0006867 in the preparation, screening or treatment of esophageal squamous cell carcinoma drugs. The expression level of this circular RNA in esophageal squamous cell carcinoma tissue is significantly lower than that in adjacent tissues, and it plays a tumor suppressor role in esophageal squamous cell carcinoma, providing a new treatment method for the intervention or treatment of esophageal squamous cell carcinoma. Therefore, further systematic mining of circular RNAs that play a role in esophageal cancer is of great significance for further understanding the occurrence and development mechanism of esophageal cancer and exploring new molecular targets and therapeutic drugs for esophageal cancer treatment. Summary of the invention

[0006] The purpose of the present invention is to overcome the above-mentioned defects and shortcomings in the prior art and provide an application of circular RNA hsa_circ_0008581 in preparing products for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients.

[0007] The second object of the present invention is to provide a reagent for detecting the expression level of circular RNAhsa_circ_0008581 for use in preparing a product for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients.

[0008] The third object of the present invention is to provide a reagent for promoting overexpression of circular RNAhsa_circ_0008581 for use in preparing an esophageal cancer cell model or an animal model.

[0009] The fourth object of the present invention is to provide the use of circular RNA hsa_circ_0008581 as a therapeutic target in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer.

[0010] The fifth object of the present invention is to provide a preparation for inhibiting the expression of circular RNA hsa_circ_0008581 for use in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer.

[0011] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0012] The present invention found that circular RNA hsa_circ_0008581 is highly expressed in esophageal cancer tumor tissues. High expression of hsa_circ_0008581 in esophageal cancer tissues will significantly promote the increase of malignant phenotypes such as invasion, migration, and metastasis of esophageal cancer cells. At the same time, high expression of hsa_circ_0008581 is significantly correlated with a shorter overall survival (OS) of esophageal cancer patients, indicating that circular RNA hsa_circ_0008581 can be used as a new biomarker for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients and a new target for the treatment of esophageal cancer.

[0013] Therefore, the present invention first proposes the use of circular RNA hsa_circ_0008581 in the preparation of products for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients, and the nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.1.

[0014] Furthermore, circular RNA hsa_circ_0008581 can effectively assist in the diagnosis of esophageal cancer, predict the risk of esophageal cancer metastasis and prognosis in patients with esophageal cancer, and conduct timely therapeutic intervention, thereby improving the patient's overall survival and quality of life.

[0015] The present invention also proposes the use of a reagent for detecting the expression level of circular RNA hsa_circ_0008581 in the preparation of a product for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients, and the nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.1.

[0016] Furthermore, the reagent for detecting the expression level of circular RNA hsa_circ_0008581 is a real-time fluorescence quantitative PCR primer, and its nucleotide sequence is shown in SEQ ID No. 2 to 3.

[0017] Furthermore, the product is used to detect the expression level of circular RNA hsa_circ_0008581 in esophageal cancer cells to assist in the diagnosis of esophageal cancer and / or predict the metastasis risk and / or overall survival of esophageal cancer patients.

[0018] Furthermore, the product is a test kit, a chip or a test paper.

[0019] The present invention also provides the use of a reagent for promoting overexpression of circular RNA hsa_circ_0008581 in preparing an esophageal cancer cell model or an animal model, wherein the nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.1.

[0020] The present invention also provides the use of circular RNA hsa_circ_0008581 as a therapeutic target in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer, and the nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.1.

[0021] The present invention also provides the use of a preparation for inhibiting the expression of circular RNA hsa_circ_0008581 in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer, wherein the nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.1.

[0022] Furthermore, the preparation is a small interfering RNA of RNA hsa_circ_0008581.

[0023] Furthermore, the small interfering RNA is siRNA-1, and its nucleotide sequences are shown in SEQ ID No. 4-5.

[0024] Furthermore, the above-mentioned esophageal cancer is esophageal squamous cell carcinoma.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides an application of circular RNA hsa_circ_0008581 as a biomarker for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients. The circular RNA hsa_circ_0008581 is highly expressed in esophageal cancer tumor tissues. Highly expressed hsa_circ_0008581 significantly promotes the increase of malignant phenotypes such as invasion, migration, and metastasis of esophageal cancer cells. At the same time, high expression of hsa_circ_0008581 is significantly associated with a shorter overall survival of esophageal cancer patients, that is, hsa_circ_0008581 can be used as an independent risk prognostic factor for esophageal cancer patients. At the same time, the invasion and migration ability of esophageal cancer cells with low expression of hsa_circ_0008581 is significantly reduced. Therefore, hsa_circ_0008581 can be used as a new biomarker that effectively assists in the diagnosis of esophageal cancer and / or predicts the prognosis of esophageal cancer patients and a new target for the treatment of esophageal cancer. This diagnostic method can effectively avoid the hazards caused by radiation, has no specific requirements for the test population, and has low testing costs, which can effectively reduce patient testing costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The expression of hsa_circ_0008581 in cancer tissues and adjacent normal tissues in patients with esophageal squamous cell carcinoma.

[0028] Figure 2 Kaplan-Meier survival analysis was performed to analyze the correlation between hsa_circ_0008581 expression level and overall survival time (OS).

[0029] Figure 3 Relationship between the expression level of hsa_circ_0008581 and the invasion and migration ability in esophageal squamous cell carcinoma cell lines. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0031] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0032] Example 1 Detection and analysis of the expression level of hsa_circ_0008581

[0033] 1. Experimental samples:

[0034] Forty pairs of esophageal squamous cell carcinoma (ESCC) tissues and adjacent normal tissues were obtained from the Department of Thoracic Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen University. All patients signed informed consent. The clinical specimens used in the experiment were confirmed to be esophageal squamous cell carcinoma and normal tissues by the Department of Pathology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University. This study was approved by the Medical Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University.

[0035] 2. RNA Extraction

[0036] (1) Digest and centrifuge the esophageal squamous cell carcinoma cells with different treatments into EP tubes, and add 1 mL of Trizol Regent to lyse the cells.

[0037] (2) Then, 200 μL of chloroform was added and the mixture was allowed to stand at room temperature for 10 min. The mixture was then centrifuged at 4°C and 12,000 g / min for 10 min.

[0038] (3) The upper layer of liquid was transferred to a new EP tube and 500 μL of isopropanol was added. The tube was left at room temperature for 10 minutes and then centrifuged at 4°C and 12,000 g / min for 10 minutes.

[0039] (4) Aspirate and discard the upper liquid, retain the lower precipitate, add 1 mL of 75% anhydrous ethanol, continue to centrifuge at 4°C, 12,000 g / min for 5 min, and wash the precipitate.

[0040] (5) After absorbing the anhydrous ethanol, place the precipitate at room temperature for 5-10 minutes to dry.

[0041] (6) Add 20 μL of DEPC water to dissolve the RNA precipitate, and place the dissolved RNA into the instrument to measure the RNA concentration.

[0042] 3. Reverse transcription of RNA

[0043] (1) Using HiScript II Reverse Transcriptase reverse transcription product, configure the system:

[0044] 4×gDNA wiper Mix 4μL, template RNA 1μg, add RNase-free ddH2O to 16μL.

[0045] (2) Add 4 μL of 5×HiScript II qRT SuperMix II to the liquid in the previous step and mix by pipetting.

[0046] (3) Incubate at 50°C for 15 min and 85°C for 5 s before the reverse transcription is completed.

[0047] 4. Real-time fluorescence quantitative PCR

[0048] (1) Real-time fluorescence quantitative PCR primers

[0049] Primer 1:CAAAGGAGGAGTGCATGCTA(SEQ ID No.2)

[0050] Primer 2: CTACATGGCCTGGCTCTCTC (SEQ ID No.3)

[0051] (2) Prepare the premix according to the following ratio:

[0052] 2×Taq Pro Universal SYBR qPCR Master Mix 10.0μL, Primer 1 (10μM) 0.4μL, Primer 2 (10μM) 0.4μL, Template DNA / cDNA 0.1μg, add ddH2O to 20.0μL.

[0053] (3) Perform qPCR reaction at the following temperature:

[0054] Pre-denaturation: 5℃30s, cycle reaction: 95℃10s, 60℃30s, repeated 40 times.

[0055] The expression results of hsa_circ_0008581 are as follows Figure 1 As shown in the figure, the expression level of hsa_circ_0008581 in patients with esophageal squamous cell carcinoma was significantly higher than that in adjacent normal tissues.

[0056] 5. Kaplan-Meier survival analysis

[0057] Based on the median expression level of hsa_circ_0008581 obtained above, the 40 patients were divided into a high expression group (N=20) and a low expression group (N=20), and the prognosis of the patients was collected for survival analysis.

[0058] The results of Kaplan-Meier survival analysis are as follows Figure 2 As shown in the results, analysis of the correlation between hsa_circ_0008581 expression level and overall survival (OS) showed that high expression of hsa_circ_0008581 was significantly associated with shorter overall survival in patients with esophageal cancer.

[0059] The above results indicate that hsa_circ_0008581 can be used as a new biomarker for auxiliary diagnosis of esophageal cancer and / or prediction of prognosis (overall survival) of esophageal cancer patients.

[0060] Example 2 Construction of esophageal squamous cell carcinoma cell lines with overexpression and knockdown of hsa_circ_0008581

[0061] The hsa_circ_0008581 overexpression lentiviral vector was constructed by Guangzhou Aigene Biotechnology, and the effective titer of the lentiviral vector was >1.0×10 8 . One day in advance, the logarithmically growing esophageal squamous cell carcinoma cells TE1 were plated in a 6-well plate, and the lentiviral transfection operation was performed when the cell density reached about 50%-60%. The MOI value was calculated according to different esophageal squamous cell carcinoma cells, and the virus culture medium was used to dilute according to the proportion. The complete culture medium in the original 6-well plate was discarded, washed with sterile PBS 3 times, and the prepared virus dilution was added after the PBS was discarded and mixed thoroughly. After the 6-well plate was placed in the incubator and cultured for 24 hours, the culture medium containing the virus was discarded and replaced with ordinary complete DMEM culture medium for continued culture. After 48-72 hours of viral infection, the successfully constructed esophageal squamous cell carcinoma cells were screened using a culture medium containing puromycin. Complete DMEM culture medium containing 5μg / mL puromycin was added to the 6-well plate for screening to obtain an esophageal squamous cell carcinoma cell line overexpressing hsa_circ_0008581.

[0062] The siRNA expression vector of hsa_circ_0008581 was constructed by Guangzhou Aiki Biotechnology; siRNA-1: positive chain: UAGCUUUACGCCAUGCUUAAATT (SEQ ID NO.4); antisense chain: AUUGGCUUUAGCUAUUCGCUUTT (SEQ ID NO.5); siRNA was transfected with jetPRIMER transfection reagent according to its instructions, and transfected into esophageal squamous cell carcinoma cells (TE1) to obtain an esophageal squamous cell carcinoma cell line with hsa_circ_0008581 knockdown.

[0063] Example 3 Transwell experiment

[0064] 1. Add 500 μL serum-free culture medium to the large chamber of the 24-well transwell plate, and add 200 μL serum-free culture medium to the small chamber (the small chamber is covered with gel in advance), and place it in the incubator for hydration.

[0065] 2. Treat cells: Wash the TE1 esophageal squamous cell carcinoma cells with different treatments twice with PBS, digest the cells with trypsin, and terminate the digestion.

[0066] 3. Transfer the suspended cells to a 1.5 mL centrifuge tube, centrifuge at 1500 pm for 5 min, and wash twice with PBS.

[0067] 4. Count the cells, according to 1×10 per well 5 Transfer the cell suspension to a 1.5 mL centrifuge tube.

[0068] 5. Centrifuge, discard PBS, and resuspend the cells in 0.1% BSA serum-free culture medium.

[0069] 6. Aspirate and discard the serum-free culture medium in the large and small chambers of the 24-well plate, add 600 μL of complete culture medium to the large chamber, and add the cells resuspended in step 5 to the small chamber.

[0070] 7. Observe whether there are bubbles at the bottom of the chamber. If there are bubbles, adjust the chamber to remove them. Place in the incubator and continue to culture for 48 hours.

[0071] 8. After 48 hours, take out the 24-well plate, discard the culture medium in the large chamber and the small chamber, and carefully wash twice with PBS.

[0072] 9. Add 600uL 4% paraformaldehyde to the large chamber, clamp the small chamber into the large chamber, and fix for 20 minutes.

[0073] 10. After fixation, discard the fixative solution, wash twice with PBS, add 600μL crystal violet to the large chamber, clamp the small chamber into the large chamber, and stain for about 20 minutes.

[0074] 11. After 20 minutes, discard the crystal violet and wash away the remaining crystal violet with PBS.

[0075] 12. Carefully wipe off the cells in the chamber with a wet cotton ball, and after drying, take photos under a microscope.

[0076] 13. Use Image J software for counting.

[0077] The results are as follows Figure 3 As shown in A, the Transwell experiment showed that the tumor invasion and migration ability in the esophageal squamous cell carcinoma cell line overexpressing hsa_circ_0008581 was significantly enhanced compared with the control group; the tumor invasion and migration ability in the esophageal squamous cell carcinoma cell line knocking down hsa_circ_000858 was significantly reduced compared with the control group.

[0078] The above results indicate that hsa_circ_0008581 can be used as a new therapeutic target for esophageal squamous cell carcinoma, and the invasion and migration of esophageal squamous cell carcinoma cells can be inhibited by inhibiting the expression of hsa_circ_0008581 to achieve the therapeutic goal.

[0079] Example 4 Scratch test

[0080] 1. Marking: Use a marker to draw a vertical line on the bottom of an empty 6-well plate.

[0081] 2. The TE1 esophageal squamous cell carcinoma cells with different treatments in the logarithmic growth phase were plated into the above 6-well plate. The amount of esophageal squamous cell carcinoma cells was about 7×10 5The optimal cell confluence is 70-80% on the next day.

[0082] 3. The next day, transfection of the target molecule was performed according to the transfection procedure.

[0083] 4. About 48 hours after transfection, use a 10μL pipette tip to vertically scratch the plate, making sure the line is straight.

[0084] 5. After scratching, wash the cells 4 times with PBS to thoroughly wash away the scratched floating cells.

[0085] 6. After washing, add serum-free culture medium, take pictures, make corresponding marks, and then continue to culture.

[0086] 7. Take photos at the same scratch position at 0h and 48h. Use Image J software to calculate the scratch area after taking photos.

[0087] The results are as follows Figure 3 As shown in B, the scratch experiment showed that the tumor invasion and migration ability of the esophageal squamous cell carcinoma cell line TE1 overexpressing hsa_circ_0008581 was significantly enhanced compared with the control group; on the contrary, the tumor invasion and migration ability of the esophageal squamous cell carcinoma cell line TE1 with hsa_circ_0008581 knockdown was significantly weakened compared with the control group.

[0088] The above results indicate that hsa_circ_0008581 can be used as a new therapeutic target for esophageal squamous cell carcinoma, and the invasion and migration of esophageal squamous cell carcinoma cells can be inhibited by inhibiting the expression of hsa_circ_0008581 to achieve the therapeutic goal.

Claims

1. The use of circular RNA hsa_circ_0008581 in the preparation of a product for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients, characterized in that: The nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.

1.

2. Use of a reagent for detecting the expression level of circular RNA hsa_circ_0008581 in the preparation of a product for auxiliary diagnosis of esophageal cancer and / or prognosis prediction of esophageal cancer patients, characterized in that: The nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.

1.

3. The use according to claim 1 or 2, characterized in that: The product is used to detect the expression level of circular RNA hsa_circ_0008581 in esophageal cancer cells to assist in the diagnosis of esophageal cancer and / or predict the metastasis risk and / or overall survival of esophageal cancer patients.

4. The application according to claim 2, characterized in that: The reagent for detecting the expression level of circular RNA hsa_circ_0008581 is a real-time fluorescence quantitative PCR primer, and its nucleotide sequence is shown in SEQ ID No. 2 to 3.

5. The use according to claim 1 or 2, characterized in that: The product is a test kit, a chip or a test paper.

6. Use of an agent for promoting overexpression of circular RNA hsa_circ_0008581 in preparing an esophageal cancer cell model or an animal model, characterized in that: The nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.

1.

7. Use of circular RNA hsa_circ_0008581 as a therapeutic target in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer, characterized in that: The nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.

1.

8. Use of a preparation for inhibiting the expression of circular RNA hsa_circ_0008581 in the preparation or screening of drugs for preventing, alleviating and / or treating esophageal cancer, characterized in that: The nucleotide sequence of the circular RNA hsa_circ_0008581 is shown in SEQ ID No.

1.

9. The use according to claim 8, characterized in that: The preparation is a small interfering RNA of RNA hsa_circ_0008581, and the small interfering RNA is siRNA-1, and its nucleotide sequence is shown in SEQ ID No.4 to 5.

10. The use according to any one of claims 1 to 2 or 6 to 8, characterized in that: The esophageal cancer is esophageal squamous cell carcinoma.

Images