Method for improving meat quality of mutton sheep by using SNP molecular marker site of FASN gene

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a method for improving the meat quality of mutton sheep by using an SNP site of an FASN gene. The method for improving the meat quality of the mutton sheep by using the SNP locus of the FASN gene comprises the following steps: detecting whether g.50277076Cgt exists in the FASN gene in a genome of the mutton sheep to be detected or not; mutation of the T site: selecting a mutton sheep individual with the genotype of TT, and carrying out artificial insemination or native mating. The molecular marker is used as a reliable marker for the meat quality of the Mongolian sheep, and a technical system for detecting the genotype through DNA is established, so that the selection intensity and the breeding accuracy and efficiency are improved, and the meat quality of the Mongolian sheep is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for improving the quality of mutton meat by utilizing the FASN gene g.50277076C>T site. Background Art

[0002] Mongolian sheep, also known as Mongolian sheep, mainly comes from Inner Mongolia Autonomous Region. It is a coarse-wooled local breed of sheep with the most subspecies and the widest distribution in my country. Its meat is delicious, tender, light in mutton smell, and highly adaptable. Fatty acids are an important factor affecting the quality, nutritional value and flavor of mutton, and will affect the fat saturation, storage stability and flavor of mutton.

[0003] Fatty acid synthase (FASN) is a fatty acid synthase gene that plays an important role in the process of lipogenesis. It is also an essential metabolic enzyme and multifunctional enzyme in the process of fatty acid synthesis. Its main function is to catalyze the synthesis of palmitate into long-chain saturated fatty acids from acetyl-CoA and malonyl-CoA in the presence of NADPH. In some cancer cell lines, this protein has been found to be fused to estrogen receptor-α (ER-alpha), in which the N-terminus of Fas is fused in-frame with the C-terminus of ER-α.

[0004] Single nucleotide polymorphism (SNP) markers refer to DNA sequence polymorphisms caused by changes in a single nucleotide. They are widely used because of their large number, high density, and high genetic stability. These genetic markers are associated with growth traits to achieve selective breeding at the DNA level, effectively avoiding human influence and improving the accuracy of selective breeding. They can also identify individuals with excellent traits at an early stage, screen out excellent backup parents, shorten the breeding cycle, and greatly speed up the breeding process. Summary of the invention

[0005] The purpose of the present invention is to provide an application of SNP molecular markers using FASN gene.

[0006] The purpose of the present invention is to provide a method for improving the quality of mutton meat by utilizing the SNP molecular marker of the FASN gene.

[0007] The present invention detects whether there is a C→T mutation at position 50277076 of the non-coding region of the FASN gene in the Mongolian sheep genome, determines the genotype of the Mongolian sheep individual at the site, performs single nucleotide polymorphism detection on the FASN gene g.50277076C>T, compares the polymorphism of the FASN gene g.50277076C>T in Mongolian sheep breeds, and determines that g.50277076C>T is a molecular marker associated with the meat quality of Mongolian sheep.

[0008] The g.50277076C>T locus of FASN gene was correlated with the contents of SFA, C18:1n9c, C20:3n3 and PUFA in the muscle of Mongolian sheep. The C17:0 level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.01), and the SFA level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.05). The C18:1n9c level of TT genotype sheep was significantly higher than that of CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels of TT genotype sheep were significantly higher than those of CT and CC genotype sheep (P<0.05).

[0009] C12:0 is a saturated fatty acid and an important component of lamb. It helps provide energy and may support muscle growth and cell function. However, consuming too much C12:0 fatty acid may lead to an increase in body fat content. C18:1 is an unsaturated fatty acid and an important component of lamb, which can be used as energy storage and delivery. SFA is a total saturated fatty acid that mainly provides energy and is an important component of lamb. Excessive intake of SFA will affect the body's blood fat levels. Therefore, controlling the intake of C12:0, C18:1 and SFA is essential for maintaining human health.

[0010] In specific breeding applications, for example, in the selection of breeding sheep, ram individuals carrying the TT genotype of the g.50277076C>T locus should be selected as much as possible.

[0011] According to a specific embodiment of the present invention, the SNP molecular marker of the FASN gene is used to improve the quality of Mongolian sheep meat, and the SNP molecular marker includes g.50277076C>T.

[0012] According to a specific embodiment of the present invention, the SNP molecular marker of the FASN gene is used to improve the quality of Mongolian sheep meat, wherein:

[0013] The nucleotide sequence of the specific primer for the g.50277076C>T molecular marker is as follows:

[0014] SEQ ID NO.1:

[0015] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0016] SEQ ID NO.2:

[0017] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0018] SEQ ID NO.3:

[0019] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0020] The present invention also provides the use of specific primers of SNP molecular markers of FASN gene in improving the quality of mutton meat, wherein the SNP molecular markers include g.50277076C>T;

[0021] The nucleotide sequence of the specific primer for the g.50277076C>T molecular marker is as follows:

[0022] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0023] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0024] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0025] According to the specific primers of the SNP molecular marker of the FASN gene of the specific embodiment of the present invention, the meat quality of the mutton is improved. The mutton is Mongolian sheep; the meat quality is to increase the content of beneficial saturated fatty acids and unsaturated fatty acids. The improvement of the mutton quality is specifically manifested in: the C17:0 level of the TT genotype sheep at the g.50277076C>T site is significantly lower than that of the CT and CC genotype sheep (P<0.01), and the SFA level of the TT genotype sheep is significantly lower than that of the CT and CC genotype sheep (P<0.05); the C18:1n9c level of the TT genotype sheep is significantly higher than that of the CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels of the TT genotype sheep are significantly higher than those of the CT and CC genotype sheep (P<0.05), thereby balancing the intake of the above four fatty acids by the consumer and maintaining the blood lipid level of the human body. Maintaining a moderate intake of fatty acids can ensure the tenderness and taste of mutton while avoiding some adverse effects on human health. Regulating the content of SFA, C18:1n9c, C20:3n3 and PUFA can improve the taste and texture of mutton, making it more tender and juicy, and help improve the nutritional value of meat products.

[0026] The present invention also provides a method for improving the quality of mutton, the method comprising the following steps:

[0027] S1. Extracting genomic DNA from the sheep to be tested;

[0028] S2, using the sheep genomic DNA extracted in step S1 as a template, performing PCR amplification with specific primers to obtain an amplified product, wherein:

[0029] The specific primer sequences of the g.50277076C>T molecular marker are as follows:

[0030] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0031] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0032] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0033] S3. Detect whether there is a C>T mutation in the 50275859th nucleotide of the non-coding region of the FASN gene in the genomic DNA of the tested mutton sheep:

[0034] If the nucleotide at position 50277076 in the non-coding region of the FASN gene is C, the genotype of the homozygous individual is CC; if the nucleotide at position 50277076 is T, the genotype of the homozygous individual is TT; the genotype of the heterozygous individual is CT.

[0035] Select mutton sheep carrying the FASN gene g.50277076C>T locus genotype of TT type for artificial insemination or natural cross.

[0036] According to the method for improving the meat quality of mutton in a specific embodiment of the present invention, in step S2, matrix-assisted laser desorption ionization time-of-flight mass spectrometry is used to perform genotyping on the 50277076th nucleotide of chromosome 11 of the FASN gene of the mutton sheep to be tested, and its base type is determined.

[0037] According to the method for improving the quality of mutton meat in a specific embodiment of the present invention, in step S2, the reaction procedure of the PCR method is: the PCR amplification reaction conditions are: 94°C for 120 seconds, 94°C for 20 seconds, 47.1°C for 30 seconds, 72°C for 60 seconds, 45 cycles, and the final extension condition is 72°C for 180 seconds, and cycled at 4°C;

[0038] The SAP digestion reaction conditions were: 37°C for 40 min, 85°C for 50 min, and cycled at 4°C;

[0039] The PCR extension reaction conditions were: 94°C for 30 seconds, 94°C for 5 seconds, 52°C for 5 seconds, and 80°C for 5 seconds, and finally 72°C for 180 seconds, and cycled at 4°C.

[0040] According to a method for improving the quality of mutton meat by using SNP molecular markers of FASN gene in a specific embodiment of the invention, in step S1, the reaction system of the PCR method is a 384-well PCR plate + 38% reagent loss. Specifically, the PCR amplification reaction system is: the PCR mixture system consists of 927.5 μL HPLC grade water, 331.25 μL 10×PCR Buffer (15 mM MgCl 2 ), 172.25 μL MgCl 2 (25mM), 53μL dNTPs (25mM), and 530μL primer mix (0.5mM).

[0041] The SAP digestion reaction system included 810.9 μL of HO 2 O, 90.1 μL alkaline phosphatase buffer (SAP buffer) and 159 μL SAP (1.7 U / μL).

[0042] The PCR extension reaction system consisted of 400.2 μL of HO 2 O, 106 μL of 10×iPLEX Buffer plus, 106 μL of iPLEX terminator, 426.1 μL of primer mix (0.6-1.3 μM) and 21.7 μL of iPlex enzyme.

[0043] According to the method for improving the meat quality of mutton in a specific embodiment of the present invention, the mutton sheep is Mongolian sheep.

[0044] The present invention also provides a kit for detecting mutton quality, the kit comprising:

[0045] The specific primer sequences of the g.50277076C>T molecular marker are as follows:

[0046] F:ACGTTGGATGTCAGAGTGACCGAAGTACG;

[0047] R:ACGTTGGATGCAACTTCCGTTCCGTGCTC;

[0048] E:CAAGGACGCCCGTTCCGTTTCCAC.

[0049] Note: F: upstream primer; R: downstream primer; E: extension primer.

[0050] Specifically, the genomic DNA of Mongolian sheep extracted in step S1 is used as a template, PCR amplification is performed using upstream and downstream primers, and then a single base extension reaction is performed using an extension primer. Finally, the sample is purified and spotted and then subjected to mass spectrometry detection.

[0051] According to the method for improving the quality of mutton meat by using SNP molecular markers of FASN gene in a specific embodiment of the invention, the factors affecting the quality of mutton meat include 15 saturated fatty acids and 12 unsaturated fatty acids, specifically including butyric acid (C4:0), caproic acid (C6:0), capric acid (C10:0), undecanoic acid (C11:0), lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), heptadecanoic acid (C17:0), stearic acid (C18:0), heneicosanoic acid (C21:0), behenic acid (C22:0), tricosanoic acid (C23:0), tetracosanoic acid (C24:0), meat Myristoleic acid (C14:1), cis-10-heptadecenoic acid (C17:1), elaidic acid (C18:1n9t), oleic acid (C18:1n9c), cis-11-eicosenoic acid (C20:1n9), erucic acid (C22:1n9), linoleic acid (C18:2n6c), alpha-linolenic acid (C18:3n3), cis-8,8,11,14-eicosatrienoic acid (C20:3n6), arachidonic acid (C20:4n6), cis-5,8,11,14,17-eicosapentaenoic acid (C20:5n3), cis-4,7,10,13,16,19-docosahexaenoic acid (C22:6n3) and saturated fatty acids (Saturated fatty acids) fatty acids, SFA), monounsaturated fatty acids (Medium chain fatty acids, MUFA), polyunsaturated fatty acids (Polyunsaturated fatty acid, PUFA), unsaturated fatty acids (Unsaturated fatty acid, UFA), MUFA / SFA, PUFA / SFA, UFA / SFA, short chain fatty acids (Short chain fatty acid, SCFA), medium chain fatty acids (Medium chain fatty acids, MCFA), long chain fatty acids (Long chain fatty acids, MCFA), N6 series polyunsaturated fatty acids (n6-PUFA), N3 series polyunsaturated fatty acids (n3-PUFA), n-6 / n-3, essential fatty acids (EFA).

[0052] Among them, the g.50277076C>T site of FASN gene was related to the contents of SFA, C18:1n9c, C20:3n3 and PUFA in the muscle of Mongolian sheep. The C17:0 level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.01), and the SFA level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.05). The C18:1n9c level of TT genotype sheep was significantly higher than that of CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels of TT genotype sheep were significantly higher than those of CT and CC genotype sheep (P<0.05).

[0053] The present invention utilizes the above molecular markers as reliable markers for improving the meat quality of Mongolian sheep, thereby increasing the selection intensity as well as the accuracy and efficiency of breeding, and confirms the genetic effect of the g.50277076C>T site in the FASN gene on improving the meat quality of Mongolian sheep.

[0054] Beneficial effects of the present invention:

[0055] The present invention uses FASN gene as a candidate gene in breeding markers, adopts MassARRAY technology to perform genotyping on FASN gene, compares the polymorphism of FASN gene in Mongolian sheep, confirms the genetic effect of g.50277076C>T site in FASN gene on improving the meat quality of Mongolian sheep, and then selects individual mutton sheep carrying FASN gene g.50277076C>T site genotype as TT genotype for artificial insemination or natural cross breeding, so as to improve the meat quality of their offspring mutton sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0057] Figure 1 This is the MassARRAY typing scatter plot of the g.50277076C>T site in the NC_040262.1 gene sequence of Mongolian sheep FASN. DETAILED DESCRIPTION

[0058] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. Example 1 Acquisition of SNP detection fragments of Mongolian sheep FASN gene and establishment of polymorphic site detection method

[0059] 1. MassARRAY genotyping test

[0060] (1) Extraction and quality inspection of Mongolian sheep genomic DNA

[0061] All Mongolian sheep were castrated male lambs at 6 months of age born in 2020. Promega's MagaZorb@DNAMini-Prep Kit (blood genome extraction kit) was used, and the usage method was referred to the MagaZorb@technical manual.

[0062] ① Thaw the sample, add 350 μl of blood sample and 20 μl of proteinase K into a 2 ml centrifuge tube and mix well.

[0063] ② Add 200 μl of Lysis Buffer solution to the above centrifuge tube and shake to mix.

[0064] ③ Heat the centrifuge tube in a solid bath for 10 minutes, inverting and mixing until the liquid becomes clear and transparent.

[0065] ④Take out the centrifuge tube, add 500μl Binding Buffer solution, and vortex to mix thoroughly.

[0066] ⑤ Add 20 μl of MagaZorb@Reagent solution to the centrifuge tube, vortex to mix thoroughly, and let stand for 15 seconds.

[0067] ⑥ Place the centrifuge tube on the adsorption rack and turn it upside down several times until the liquid becomes clear and the magnetic beads are adsorbed on the wall of the centrifuge tube.

[0068] ⑦ Remove the supernatant and retain the magnetic beads, add Wash Buffer solution, and mix by inverting.

[0069] ⑧Repeat steps ⑥ and ⑦ twice, discard the supernatant and keep the magnetic beads, open the centrifuge tube cover and let it stand at room temperature for 1-2 minutes to allow the water to evaporate.

[0070] ⑨ Remove the centrifuge tube from the adsorption rack, add 50μl Elution Buffer solution, shake and mix well, and let it stand.

[0071] ⑩ Place the centrifuge tube on the adsorption rack, turn it upside down to allow the magnetic beads to adsorb to the wall of the centrifuge tube, aspirate the supernatant and transfer it to a new centrifuge tube, and detect the sample concentration and OD value.

[0072] The OD260 / OD280 of the extracted DNA solution should be between 1.7-2.0.

[0073] (2) PCR amplification:

[0074] Primers were designed based on the genomic sequence of the Mongolian sheep FASN gene (GenBank ID: NC_040262.1) to amplify the fragment of the polymorphic site. The primers are as follows:

[0075] Amplify the fragment sequence of the g.50277076C>T site

[0076] F:5'-ACGTTGGATGTCAGAGTGACCGAAGTACG-3';

[0077] R:5'-ACGTTGGATGCAACTTCCGTTCCGTGCTC-3';

[0078] E:5'-CAAGGACGCCCGTTCCGTTTCCAC-3'.

[0079] Note: F: upstream primer; R: downstream primer; E: extension primer

[0080] PCR amplification was performed in Mongolian sheep genomic DNA using the above primers. The PCR amplification reaction system and conditions are shown in Table 1, the SAP digestion system and conditions are shown in Table 2, and the extension reaction system and conditions are shown in Table 3. (The well in this experiment is the number of combinations of multiplex PCR).

[0081] Table 1 PCR amplification reaction system and conditions

[0082]

[0083] Table 2 SAP digestion system and conditions

[0084]

[0085] Table 3 Extension reaction system and conditions

[0086]

[0087]

[0088] (3) The reaction product (9 μL in total) was diluted 3 times with deionized water and desalted using resin for 20 minutes. The sample was then spotted on a 384-well SpectroCHIP (Sequenom) chip and allowed to crystallize naturally. The sample was then loaded onto a MALDI-TOF mass spectrometer ( Analyzer 4, Agena Biosciences) was used to detect and collect data.

[0089] The results are as follows Figure 1 As shown (example), the yellow triangle represents a Mongolian sheep individual with TT genotype (1 individual), the green square represents a Mongolian sheep individual with CT genotype (2 individuals), and the blue triangle represents a Mongolian sheep individual with CC genotype (249 individuals).

[0090] From the results (example), we can see that there are three genotypes at the FASN gene g.50277076C>T site. Specifically, the genotypes of g.50277076C>T are TT genotype (1), CT genotype (2), and CC genotype (249).

[0091] Example 2 Detection of polymorphic distribution of molecular markers in Mongolian sheep populations

[0092] The present invention uses the method shown in Example 1 to detect the polymorphism of the g.50277076C>T site of the FASN gene in the Mongolian mutton sheep breed population, and the detection results are shown in Table 4.

[0093] Table 4 Distribution of dominant allele frequency and allele frequency of FASN gene g.50277076C>T locus in Mongolian sheep population

[0094]

[0095] From the results in Table 4, we can see that there are two genotypes in the g.50277076C>T locus in most areas of mutton sheep populations, the CC genotype of the g.50277076C>T locus has a higher proportion, and the TT genotype has a lower proportion. The dominant allele of the g.50277076C>T locus in mutton sheep populations is C.

[0096] Example 3g.50277076C>T molecular marker and its association analysis with fatty acids and fatty acid combinations of Mongolian sheep and its application

[0097] In order to determine whether the g.50277076C>T site is correlated with the difference in fatty acid content in the longissimus dorsi muscle of Mongolian sheep, the method established in Example 1 was used for polymorphism detection, and SPSS19.0 software was used to analyze the correlation between the two genotypes of the g.50277076C>T site and the fatty acid content in the longissimus dorsi muscle of Mongolian sheep meat.

[0098] Steps for extracting fatty acids:

[0099] (1) Tissue collection: Cut and weigh 1 gram of Mongolian sheep muscle tissue, clamp it with tweezers into a sterilized and dried glass homogenizer tube, add a small amount of double distilled water (less than 1 mL) and grind it manually until it is homogenized. Pour the liquid in the homogenizer tube into a 10 mL centrifuge tube, wash the homogenizer tube with deionized water, and put it into the centrifuge tube together. Try to minimize the loss of the sample during the transfer process, then add 1.5 mL of chloroform-methanol solution, the ratio of the two is 2:1, mix well and let it stand.

[0100] (2) Centrifuge the tube at 4°C, 4000 rpm for 5 minutes, aspirate the chloroform layer into a pre-weighed 10 mL centrifuge tube, add 1.5 mL of chloroform-methanol solution into the centrifuge tube again, mix thoroughly, and centrifuge at 4°C, 4000 rpm for 5 minutes. Aspirate the upper layer solution obtained by centrifugation into a new centrifuge tube, which is the fat extract.

[0101] (3) Place the 10 mL centrifuge tube under the nitrogen blowdown instrument and blow until there is no liquid. At this time, weigh the 10 mL centrifuge tube on an electronic balance.

[0102] (4) Add 1 mL of n-hexane solution to the centrifuge tube and shake it up and down for 30 seconds until the material on the tube wall is fully dissolved. Then add 1 mL of n-hexane to dissolve it and let it stand.

[0103] (5) Methylation of the sample: Add 1 mL of n-hexane to dissolve, then place in a water bath at 70°C for 5 minutes, add 3 mL of boron trifluoride methanol solution to cause methylation, and place in a water bath at 70°C for 2 minutes to accelerate the methylation of fat. Then place under a nitrogen blower, blow dry, pipette 1 mL of n-hexane to make it volume, then add a small amount of anhydrous copper sulfate particles to absorb moisture to prevent damage to the gas chromatograph. Transfer the upper phase to a GC vial and analyze the methyl ester.

[0104] The mathematical model used is: ijklm =μ+G i +A j +F k +S l +S m +e ijklm ;

[0105] Among them, Y ijklm is the observed value of the trait, μ is the average value of the trait, G i is the genotype effect, A j is the fixed effect caused by age, F k is the pasture environmental effect, S l is the gender effect, S m is the family effect, eijklm is a random error.

[0106] The association analysis between the two genotypes of the g.50277076C>T locus and fatty acid content was conducted in the Mongolian sheep population. The statistical analysis results are shown in Table 5:

[0107] Table 5 Association analysis between the g.50277076C>T locus of FASN gene and carcass traits of Mongolian sheep

[0108]

[0109] Note: Values ​​are expressed as mean ± standard deviation; values ​​with different superscripts in the same column are significantly different when P < 0.05 (a, b), P < 0.01 (A, B).

[0110] It can be seen from Table 5 that in the Mongolian sheep population, there are three genotypes of CC, CT and TT at the g.50277076C>T locus.

[0111] For g.50277076C>T, the C17:0 level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.01), and the SFA level of TT genotype sheep was significantly lower than that of CT and CC genotype sheep (P<0.05). The C18:1n9c level of TT genotype sheep was significantly higher than that of CT and CC genotype sheep (P<0.01), and the C20:3n3 and PUFA levels of TT genotype sheep were significantly higher than those of CT and CC genotype sheep (P<0.05).

[0112] Therefore, it can be concluded that the dominant genotype of the FASN gene g.50277076C>T site in the meat sheep population is TT.

[0113] According to the above breeding experimental plan, when implementing molecular marker-assisted breeding aimed at improving the meat quality and meat production performance of Mongolian sheep, g.50277076C>T on the FASN gene of reserve rams can be detected, and meat sheep individuals carrying the TT genotype of the FASN gene g.50277076C>T locus can be preferentially selected. Artificial insemination or inbreeding can be used to improve the meat quality of Mongolian sheep offspring.

[0114] The present invention provides a method for improving the meat quality of mutton sheep offspring, and the specific method is as follows:

[0115] S1. Detect whether there is a C>T mutation in the 50275859th nucleotide of the non-coding region of the FASN gene in the genomic DNA of the tested mutton sheep:

[0116] Determine the genotype of Mongolian sheep individuals at this site, realize the single nucleotide polymorphism detection of the FASN gene g.50277076C>T site, and compare the polymorphism of the FASN gene g.50277076C>T site in Mongolian sheep breeds;

[0117] If the 50275859th nucleotide in the non-coding region of the FASN gene is C, the genotype of the homozygous is CC; if the 50275859th nucleotide is T, the genotype of the homozygous is TT; the genotype of the heterozygous is GC.

[0118] S2. Select individual mutton sheep carrying the FASN gene g.50277076C>T locus genotype of TT type for artificial insemination or natural mating.

[0119] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Application of SNP molecular markers of FASN gene in improving the quality of mutton, characterized in that: The SNP molecular markers include g.50277076C>T.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the specific primer for the g.50277076C>T molecular marker is as follows: SEQ ID NO.1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO.2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC.

3. The application of specific primers of SNP molecular markers of FASN gene in improving the quality of mutton, characterized in that: The SNP molecular markers include g.50277076C>T; The nucleotide sequence of the specific primer for the g.50277076C>T molecular marker is as follows: SEQ ID NO.1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO.2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC.

4. The use according to claim 3, characterized in that: The mutton sheep are Mongolian sheep; the meat quality is the content of unsaturated fatty acids and beneficial fatty acids.

5. A method for improving the quality of mutton, characterized in that: The method comprises the following steps: S1. Extracting genomic DNA from the sheep to be tested; S2, using the sheep genomic DNA extracted in step S1 as a template, performing PCR amplification with specific primers to obtain an amplified product, wherein: The specific primer sequences of the g.50277076C>T molecular marker are as follows: SEQ ID NO.1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO.2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO.3:CAAGGACCGCCCGTTCCGTTTCCAC; S3. Detect whether there is a C>T mutation in the 50275859th nucleotide of the non-coding region of the FASN gene in the genomic DNA of the tested mutton sheep: If the nucleotide at position 50277076 in the non-coding region of the FASN gene is C, the genotype of the homozygote is CC; if the nucleotide at position 50275859 is T, the genotype of the homozygote is TT; the genotype of the heterozygote is CT; Select mutton sheep carrying the FASN gene g.50277076C>T locus genotype of TT type for artificial insemination or natural cross.

6. The method for improving the quality of mutton according to claim 5, characterized in that: In step S2, matrix-assisted laser desorption ionization time-of-flight mass spectrometry is used to perform genotyping on the 50277076th nucleotide of chromosome 11 of the FASN gene of the mutton sheep to be tested, and the base type of the 50277076th nucleotide is determined.

7. The method for improving the quality of mutton according to claim 5, characterized in that: In step S2, the reaction procedure of the PCR method is as follows: the PCR amplification reaction conditions are: 94°C for 120 seconds, 94°C for 20 seconds, 47.1°C for 30 seconds, 72°C for 60 seconds, 45 cycles, and the final extension condition is 72°C for 180 seconds, and cycles at 4°C; The SAP digestion reaction conditions were: 37°C for 40 min, 85°C for 50 min, and cycled at 4°C; The PCR extension reaction conditions were: 94°C for 30 seconds, 94°C for 5 seconds, 52°C for 5 seconds, and 80°C for 5 seconds, and finally 72°C for 180 seconds, and cycled at 4°C.

8. The method for improving the quality of mutton according to claim 5, characterized in that: In step S2, the PCR amplification reaction system includes 927.5 μL HPLC-grade water, 331.25 μL 10×PCR Buffer, 172.25 μL MgCl2, 53 μL dNTPs and 530 μL primer mix; The SAP digestion reaction system included 810.9 μL of H O, 90.1 μL of alkaline phosphatase buffer, and 159 μL of SAP; The PCR extension reaction system included 400.2 μL of H2O, 106 μL of 10×iPLEX Buffer plus, 106 μL of iPLEX terminator, 426.1 μL of primer mix and 21.7 μL of iPlex enzyme.

9. The method for improving the quality of mutton according to any one of claims 5 to 8, characterized in that: The mutton sheep are Mongolian sheep.

10. A kit for detecting the quality of mutton, characterized in that: The kit comprises: g.50277076C>T molecular marker specific primer sequence: SEQ ID NO.1: ACGTTGGATGTCAGAGTGACCGAAGTACG; SEQ ID NO.2: ACGTTGGATGCAACTTCCGTTCCGTGCTC; SEQ ID NO. 3: CAAGGACGCCCGTTCCGTTTCCAC.

Images