Genetically engineered bacterium for synthesizing N-acetylglucosamine as well as preparation method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine and a preparation method and application thereof.The genetically engineered bacterium takes escherichia coli as an initial bacterium, genes related to N-acetylglucosamine catabolism are knocked out on a genome of the initial bacterium, genes related to N-acetylglucosamine metabolism synthesis are overexpressed, and the genetically engineered bacterium is obtained. Therefore, the production level of the N-acetylglucosamine is improved; wherein the related gene for catabolism of N-acetylglucosamine comprises any one or a combination of at least two of nagB, nagA, manX, nagE, nagK or ptsG, and the related gene for metabolic synthesis of N-acetylglucosamine comprises any one or a combination of at least two of glmS, gna1, glnA, yqaB, icaC, galP or glk.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a genetically engineered bacterium for synthesizing N-acetylglucosamine, a preparation method and application thereof, and in particular to the construction and application of a genetically engineered probiotic Escherichia coli bacterium for efficiently producing N-acetylglucosamine. Background Art

[0002] N-acetylglucosamine (GlcNAc) is an acetylated derivative of glucosamine (GlcN). It is the basic unit of many functional polysaccharides in organisms (such as hyaluronic acid, chondroitin sulfate, etc.). It is widely present in bacteria, yeast, filamentous fungi, plants and animals, and plays a key role in the life activities of organisms. GlcNAc plays an important role in the repair and health care of bone and joints and the treatment of osteoarthritis. In addition, GlcNAc can enhance the immune function of the human body, can be used as a food additive, antioxidant and sweetener for diabetic patients, and can also promote the metabolic synthesis of hyaluronic acid in the human body, and play a role in improving the skin's moisture. Therefore, GlcNAc is widely used in the fields of medicine, food and cosmetics.

[0003] At present, the industrial production methods of GlcNAc mainly include acid hydrolysis, enzyme hydrolysis and microbial fermentation. Both the acid hydrolysis and enzyme hydrolysis methods use chitosan extracted from shrimp and crab shells as raw materials, and then obtain GlcNAc through acid hydrolysis or enzyme hydrolysis. However, there are many problems with both the acid hydrolysis and enzyme hydrolysis methods, such as the limited source of chitosan raw materials and the fact that GlcNAc produced from chitosan extracted from shrimp and crabs is prone to allergic reactions; in addition, a large amount of strong acid and strong alkali is used during the acid hydrolysis process, causing serious environmental pollution; and although the enzyme hydrolysis method has mild reaction conditions, it has the problems of expensive enzymes, long enzyme hydrolysis time and low production efficiency; therefore, both the acid hydrolysis and enzyme hydrolysis methods are not suitable for future green industrial production.

[0004] In recent years, with the rapid development of synthetic biology technology, an industrial system for biosynthesis of GlcNAc has been established. However, the current industrial fermentation production of GlcNAc mainly uses Escherichia coli as the host bacteria. However, E. coli, as a prokaryotic expression host, will produce a type of bacterial endotoxin with a cytotoxic lipopolysaccharide (LPS) structure during the fermentation process. Bacterial endotoxins have a small molecular weight and strong stability to heat and chemical reagents. Currently, ion exchange, adsorption, ultrafiltration and surfactants are mainly used to remove endotoxins from samples. However, the above methods still have problems such as low efficiency, poor specificity, toxic reagents used in the process, difficulty in removal and purification, and high cost. The above problems seriously restrict the widespread application of E. coli as a host bacteria in industrial production.

[0005] Therefore, finding an endotoxin-free Escherichia coli as a host bacterium will greatly simplify the purification process of the target product during industrial production and greatly improve the safety of the target product. Summary of the invention

[0006] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a genetically engineered bacterium for synthesizing N-acetylglucosamine, and a preparation method and application thereof. The present invention overcomes the shortcomings of the existing production process of GlcNAc using E. coli as a host, which produces bacterial endotoxin (LPS), constructs a probiotic Escherichia coli genetically engineered bacterium with high GlcNAc production using probiotic Escherichia coli Nissle 1917 (EcN) as a host bacterium, and genetically modifies it to achieve efficient fermentation synthesis of GlcNAc, while solving the safety problem of the product, and providing a basis for realizing its industrial large-scale safe production of GlcNAc.

[0007] The present invention uses the probiotic Escherichia coli Nissle 1917 as a host bacterium, which does not contain pathogenic factors such as enterotoxins, hemolytic toxins and cytotoxins, and has no safety risks to the host.

[0008] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine, wherein the genetically engineered bacterium uses Escherichia coli as an initial bacterium, knocks out the deaminase gene nagB and the deacetylase gene nagA in the genome of the initial bacterium, and overexpresses the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1.

[0010] In a second aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine, wherein the genetically engineered bacterium uses Escherichia coli as an initial bacterium, and the deaminase gene nagB and the deacetylase gene nagA are knocked out in the genome of the initial bacterium, and one or more of the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK or the glucose transmembrane transporter gene ptsG are further knocked out, and the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

[0011] Preferably, when the engineered bacteria knocks out the glucose transmembrane transporter gene ptsG, while overexpressing the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1, the galactose co-transporter gene galP and the glucose kinase gene glk are overexpressed.

[0012] In a third aspect, the present invention provides a genetically engineered bacterium for synthesizing N-acetylglucosamine, wherein the genetically engineered bacterium uses Escherichia coli as an initial bacterium, and knocks out the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, and the acetylglucosamine kinase gene nagK in the genome of the initial bacterium, overexpresses the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1, and further overexpresses one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, and the acetylglucosamine transporter gene icaC.

[0013] Preferably, the Escherichia coli is selected from BL21 (DE3) or Nissle1917 engineered bacteria integrated with a T7 RNA polymerase expression cassette.

[0014] Preferably, the transformation method of the Nissle 1917 engineered bacteria integrating the T7 RNA polymerase expression frame is optimized and transformed according to the method described in patent CN202310516515.6.

[0015] Preferably, the genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2.

[0016] Preferably, the T7 RNA polymerase (T7RNAP) expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence (Gene ID: 1261050) located downstream of the RBS downstream spacer sequence, and its 5' end is shown in SEQ ID NO.19, and the modified and optimized T7RNAP expression cassette sequence is shown in SEQ ID NO.83.

[0017] Preferably, the overexpression is to integrate one or more of the genes glmS, gna1, glnA, yqaB, icaC, galP or glk into an exogenous plasmid and introduce it into the engineered bacteria for expression.

[0018] Preferably, the exogenous plasmid is selected from any one of pETDuet, pCOLADuet, pRSFDuet or pCDFDuet, or a combination of at least two thereof.

[0019] Preferably, the knockout is gene knockout or silencing using a CRISPR gene editing method or a homologous recombination method, thereby downregulating or removing the function of the relevant gene.

[0020] Preferably, the glucosamine synthase gene glmS is derived from: Escherichia coli K-12MG1655, Bacillus subtilis, Corynebacterium glutamate; more preferably, it is derived from Escherichia coli K-12MG1655.

[0021] Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is gna1 derived from Saccharomyces cerevisiae and Caenorhabditis elegans after Escherichia coli codon optimization; more preferably, the glucosamine acetylase gene gna1 is the gna1 gene derived from Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.7.

[0022] Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12MG1655, wherein the nucleotide sequence of the galP is shown in SEQ ID NO.14, the nucleotide sequence of the glk is shown in SEQ ID NO.15, the nucleotide sequence of the glnA is shown in SEQ ID NO.16, and the nucleotide sequence of the yqaB is shown in SEQ ID NO.17; the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of the icaC is shown in SEQ ID NO.18.

[0023] In a fourth aspect, the present invention provides use of the genetically engineered bacteria for synthesizing N-acetylglucosamine according to any one of the first aspect, the second aspect or the third aspect in the production of N-acetylglucosamine and / or glucosamine.

[0024] In a fifth aspect, the present invention provides a method for preparing a genetically engineered bacterium for synthesizing N-acetylglucosamine according to any one of the first aspect, the second aspect or the third aspect, the preparation method comprising:

[0025] (1) Knock out genes related to N-acetylglucosamine decomposition metabolism in the initial bacterial genome, including: deaminase gene nagB and deacetylase gene nagA;

[0026] (2) constructing a recombinant plasmid that overexpresses genes related to N-acetylglucosamine metabolism and synthesis, and transducing the recombinant plasmid into the initial strain, wherein the genes related to N-acetylglucosamine metabolism and synthesis include: glucosamine synthase gene glmS, glucosamine acetylase gene gna1;

[0027] The initial strain is Escherichia coli BL21 (DE3) or Nissle1917 engineered bacteria integrated with a T7 RNA polymerase expression frame.

[0028] Preferably, the transformation method of the Nissle 1917 engineered bacteria integrating the T7 RNA polymerase expression frame is optimized and transformed according to the method described in patent CN202310516515.6.

[0029] Preferably, in step (1), the genes related to N-acetylglucosamine catabolism further include: one or more of: mannose phosphate transporter gene manX, acetylglucosamine transporter gene nagE, acetylglucosamine kinase gene nagK or glucose transmembrane transporter gene ptsG.

[0030] Preferably, in step (1), when the engineered bacteria knocks out the glucose transmembrane transporter gene ptsG, while overexpressing the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1, the galactose co-transporter gene galP and the glucose kinase gene glk are overexpressed.

[0031] Preferably, in step (2), the N-acetylglucosamine metabolism and synthesis-related genes further include: one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB or the acetylglucosamine transport gene icaC.

[0032] Preferably, in step (1), the knockout is gene knockout / silencing using a CRISPR gene editing method or a homologous recombination method, thereby downregulating or removing the function of the relevant gene.

[0033] In the present invention, the nucleotide sequence of the gene related to N-acetylglucosamine decomposition metabolism is as follows:

[0034] The nucleotide sequence of the deaminase gene nagB is shown in SEQ ID NO.1.

[0035] The nucleotide sequence of the deacetylase gene nagA is shown in SEQ ID NO.2.

[0036] The nucleotide sequence of the mannose phosphate transporter gene manX is shown in SEQ ID NO.10.

[0037] The nucleotide sequence of the acetylglucosamine transporter gene nagE is shown in SEQ ID NO.11.

[0038] The nucleotide sequence of the acetyl glucosamine kinase gene nagK is shown in SEQ ID NO.12.

[0039] The nucleotide sequence of the glucose transmembrane transporter gene ptsG is shown in SEQ ID NO.13.

[0040] In the present invention, in step (1), the nucleotide sequence of the sgRNA targeting the deaminase gene nagB is shown in SEQ ID NO.22.

[0041] In step (1), the nucleotide sequence of the sgRNA targeting the deacetylase gene nagA is shown in SEQ ID NO.23.

[0042] In step (1), the nucleotide sequence of the sgRNA targeting the mannose phosphate transporter gene manX is shown in SEQ ID NO.24.

[0043] In step (1), the nucleotide sequence of the sgRNA targeting the acetylglucosamine transporter gene nagE is shown in SEQ ID NO.25.

[0044] In step (1), the nucleotide sequence of the sgRNA targeting the acetyl glucosamine kinase gene nagK is shown in SEQ ID NO.26.

[0045] In step (1), the nucleotide sequence of the sgRNA targeting the glucose transmembrane transporter gene ptsG is shown in SEQ ID NO.27.

[0046] Preferably, in step (2), when constructing a recombinant plasmid that overexpresses genes related to N-acetylglucosamine metabolism and synthesis, the plasmid is selected from any one of pETDuet, pCOLADuet, pRSFDuet or pCDFDuet, or a combination of at least two of them.

[0047] Preferably, in step (2), the glucosamine synthase gene glmS is derived from any one of Escherichia coli K-12MG1655, Bacillus subtilis or Corynebacterium glutamate.

[0048] In the present invention, the nucleotide sequence of EcglmS derived from Escherichia coli K-12MG1655 is shown in SEQ ID NO.3.

[0049] In the present invention, the nucleotide sequence of BsglmS derived from Bacillus subtilis is shown as SEQ ID NO.5.

[0050] In the present invention, the nucleotide sequence of CgglmS derived from Corynebacterium glutamicum is shown as SEQ ID NO.6.

[0051] Preferably, the glucosamine synthase gene glmS is derived from Escherichia coli K-12MG1655, and the nucleotide sequence is shown in SEQ ID NO.3.

[0052] Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is gna1 derived from Saccharomyces cerevisiae after being codon-optimized by Escherichia coli, and the nucleotide sequence is shown in SEQ ID NO.4, or the glucosamine acetylase gene gna1 is gna1 derived from Caenorhabditis elegans after being codon-optimized by Escherichia coli, and the nucleotide sequence is shown in SEQ ID NO.9;

[0053] Preferably, the glucosamine acetylase gene gna1 is a gna1 gene derived from Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.7.

[0054] Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12MG1655, wherein the nucleotide sequence of the galP is shown in SEQ ID NO.14, the nucleotide sequence of the glk is shown in SEQ ID NO.15, the nucleotide sequence of the glnA is shown in SEQ ID NO.16, and the nucleotide sequence of the yqaB is shown in SEQ ID NO.17;

[0055] Preferably, the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of the icaC is shown in SEQ ID NO.18.

[0056] Preferably, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE and the acetylglucosamine kinase gene nagK are knocked out in the initial bacteria, and the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

[0057] Preferably, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE and the acetylglucosamine kinase gene nagK are knocked out in the initial bacteria, the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, and one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB or the acetylglucosamine transporter gene icaC are further overexpressed.

[0058] Preferably, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK, and the glucose transmembrane transporter gene ptsG are knocked out in the initial bacteria, and the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, while the galactose co-transporter gene galP and the glucose kinase gene glk are overexpressed.

[0059] Preferably, the genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression cassette comprises: inserting the T7 RNA polymerase expression cassette into the attB site of the Nissle 1917 genome, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2;

[0060] Among them, the T7 RNA polymerase (T7RNAP) expression frame includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence and a T7RNA polymerase sequence located downstream of the RBS downstream spacer sequence, and its 5' end is shown in SEQ ID NO.19. The modified and optimized T7RNAP expression frame sequence is shown in SEQ ID NO.83.

[0061] In the present invention, the knockout method is selected from the CRISPR-Cas9 gene editing method or the homologous recombination method.

[0062] In the present invention, when the T7 RNA polymerase expression cassette is inserted into the attB site of the Nissle 1917 genome, the nucleotide sequence of the sgRNA targeting the attB site is shown in SEQ ID NO.81.

[0063] In the present invention, the CRISPR-Cas9 gene editing method is used to knock out the endA gene, and the nucleotide sequence of the sgRNA targeting the endA gene is shown in SEQ ID NO.20.

[0064] In the present invention, the ompT gene is knocked out by using the CRISPR-Cas9 gene editing method, and the nucleotide sequence of the sgRNA targeting the ompT gene is shown in SEQ ID NO.21.

[0065] In the present invention, the CRISPR-Cas9 gene editing method is used to knock out the cryptic plasmid pMUT1, and the nucleotide sequence of the sgRNA targeting pMUT1 is shown in SEQ ID NO.79.

[0066] In the present invention, the CRISPR-Cas9 gene editing method is used to knock out the cryptic plasmid pMUT2, and the nucleotide sequence of the sgRNA targeting pMUT2 is shown in SEQ ID NO.80.

[0067] As a preferred implementation mode of the probiotic Escherichia coli engineered bacteria of the present invention, the specific construction method of the engineered bacteria is: using CRISPR / Cas9 gene editing technology, respectively designing sgRNAs for nagB, nagA, manX, nagE, nagK and ptsG to knock them out; constructing a recombinant plasmid containing multiple genes such as the glucosamine synthase gene glmS, the glucosamine acetylase gene gna1, the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, the acetylglucosamine transport gene icaC, the galactose co-transporter gene galP and the glucose kinase gene glk.

[0068] The overexpression described in the present invention is to express multiple copies of a gene on a plasmid.

[0069] The plasmid of the present invention is selected from pETDuet, pCOLADuet, pRSFDuet or pCDFDuet.

[0070] The hosts of the present invention are BL21 (DE3) and EcNcΔattB (lacUV5-T7) ΔendAΔompT (named as TCBJ117), preferably TCBJ117.

[0071] The present invention provides a method for producing GlcNAc, wherein glucose is used as a carbon source and the genetically engineered bacteria are used to ferment and produce GlcNAc.

[0072] Specifically, the fermentation includes: the recombinant E. coli is cultured in 2 mL of LB medium containing corresponding antibiotics at 37°C and 220 rpm overnight for about 15 hours. 1 mL of overnight cultured seed solution is transferred into 50 mL of LB medium containing corresponding antibiotics, glucose with a final concentration of 40 g / L is added, and cultured at 30°C and 250 rpm on a shaker for about 6 hours (the bacterial solution OD 600 About 0.8). Add IPTG with a final concentration of 0.1 mM, and continue to induce fermentation for 48-72 hours at 25°C and a shaking speed of 250 rpm. After the fermentation is completed, the fermentation supernatant is collected by centrifugation, boiled at 100°C for 10 minutes, centrifuged again, and the supernatant is diluted 10 times with sterile water. The sample is filtered through a 0.22 μm filter membrane and the content of GlcNAc and GlcN is detected by liquid chromatography using the external standard method.

[0073] Compared with the prior art, the present invention has the following beneficial effects:

[0074] The present invention uses probiotic Escherichia coli TCBJ117 as a host bacterium, and constructs a synthetic GlcNAc metabolic engineering bacterial strain by overexpressing glucosamine synthetase gene glmS, glucosamine acetylase gene gna1, glutamine synthetase gene glnA, fructose-1-phosphate phosphatase gene yqaB, and acetylglucosamine transport gene icaC; knocking out deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter encoding gene manX, acetylglucosamine transporter encoding gene nagE, and acetylglucosamine kinase nagK. The metabolic engineering bacteria of the present invention are used for shake flask fermentation verification, and the results show that when glucose is used as a substrate, the yields of GlcNAc and GlcN reach 17.73 g / L and 2.62 g / L, respectively. The metabolic engineering bacteria constructed by the present invention achieve the purpose of safely and efficiently synthesizing GlcNAc. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 These are the sequencing results after knocking out the nagB and nagA gene sites in the probiotic E. coli TCBJ117 genome and the E. coli BL21 (DE3) genome.

[0076] Figure 2 This is the sequencing result after the manX, nagE, nagK and ptsG gene sites of the probiotic Escherichia coli TCBJ117ΔnagBΔnagA genome were knocked out.

[0077] Figure 3 HPLC-MS chart of GlcNAc, wherein (a) represents the HPLC result of GlcNAc standard; (b) represents the HPLC result of GlcNAc sample; (c) represents the MS result of GlcNAc sample. DETAILED DESCRIPTION

[0078] To more clearly describe the technical solution of the present invention, the technical solution of the present invention is further described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention. These are only partial embodiments of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, without departing from the essence and scope of the present invention, various changes or modifications to the material composition and dosage in these embodiments also belong to the protection scope of the present invention.

[0079] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0080] Example 1

[0081] Preparation of Escherichia coli EcNcΔattB (lacUV5-T7) ΔendAΔompT (this method is also described in CN202310516515.6)

[0082] 1.1 In the original strain probiotic Escherichia coli Nissle1917 (E.coli Nissle1917), based on CRISPR / Cas9 gene editing technology, the Cas9 fragment was connected with the NcoI enzyme / XhoI enzyme double enzyme fragment of the pKD46 plasmid using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm, catalog number E086) to construct the pKD-Cas9 plasmid, and the pKD-Cas9 plasmid was transformed into E.coli Nissle1917 cells, and positive clones were screened and named EcN-Cas9.

[0083] 1.2 While preparing EcN-Cas9, sgRNAs of the cryptic plasmids pMTU1 and pMTU2 were designed and prepared respectively, and transferred into EcN-Cas9 to knock out the cryptic plasmids, thereby constructing an Escherichia coli strain with the cryptic plasmid removed, named EcNc.

[0084] Among them: sgRNA-pMTU1: agttaccggataaggcgcagcgg; (SEQ ID NO.79)

[0085] sgRNA-pMTU2:gtttggcgcagaacctcggacgg. (SEQ ID NO.80)

[0086] 1.3 The optimized T7RNAP expression cassette was inserted into the genome of Nissle 1917 bacteria, and the insertion site of the expression cassette was the attB site on the genome.

[0087] The optimized T7RNAP expression cassette (abbreviated as "lacUV5-T7") includes a promoter sequence, an operator sequence, an RBS sequence, an intervening sequence, and a T7RNA polymerase (Gene ID: 1261050) sequence located downstream of the RBS downstream intervening sequence. The 5' end of the T7RNAP expression cassette sequence is shown in SEQ ID NO.19, wherein the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the intervening sequence is "GGCCACTACTAGAG" (RBS upstream intervening sequence) and "TACTAG" (RBS downstream intervening sequence), "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the T7RNA polymerase (Gene ID: 1261050) coding gene, and ATG is the start codon.

[0088] tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAAGAGGA GAAA TACTAG ATGAACACGATTAACATCGCTAAGAAC (SEQ ID NO. 19). The complete optimized T7RNAP expression cassette sequence is shown in SEQ ID NO. 83.

[0089] Refer to step 1.1 to construct EcNc-Cas9, then co-transfect the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains the T7 RNAP fragment (i.e., the T7 RNAP expression frame) and homology arms of about 300 bp upstream and downstream of the attB site) into EcNc-Cas9 cells, and use the CRISPR / Cas9 system to integrate the T7 RNAP fragment into the attB site of the EcNc strain to obtain the strain EcNcΔattB (lacUV5-T7), referred to as EcNc-T7.

[0090] Among them, the sgRNA nucleotide sequence targeting the attB site is shown in SEQ ID NO.81.

[0091] sgRNA-attB:ctaacttgagcgaaacgggaagg. (SEQ ID NO.81)

[0092] The nucleotide fragment of the Donor fragment is shown in SEQ ID NO.82:

[0093] 1.4 Based on CRISPR / Cas9 gene editing technology, the endA and ompT genes in the probiotic Escherichia coli EcNc-T7 strain were knocked out to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0094] The sgRNAs of the genes endA and ompT were designed respectively, and the nucleotide sequence of the sgRNA of endA is shown in SEQ ID NO. 20; the nucleotide sequence of the sgRNA of ompT is shown in SEQ ID NO. 21. The CRISPR / Cas9 knockout system was transformed into the target strain EcNc-T7, that is, the target gene was knocked out in EcNc-T7, and EcNcΔattB(lacUV5-T7)ΔendAΔompT was obtained, which was named "TCBJ117".

[0095] sgRNA-endA:tttttctcaagcgaaagccgcgg (SEQ ID NO. 20);

[0096] sgRNA-ompT:tactcctgacaacataaatgcgg (SEQ ID NO. 21).

[0097] In addition to using CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used to knock out related genes and plasmids, and the final strain obtained is consistent with TCBJ117.

[0098] Example 2

[0099] Knockout of nagB and nagA genes in Escherichia coli TCBJ117 and BL21(DE3)

[0100] Using CRISPR / Cas9 gene editing technology, sgRNAs targeting genes nagB (shown in SEQ ID NO.1) and nagA (shown in SEQ ID NO.2) were designed, and the sgRNAs and Donor sequences were cloned into the gene editing vector Donor plasmid.

[0101] The nucleotide sequences of the sgRNA targeting the deaminase genes nagB and nagA are shown in SEQ ID NOs. 22-23. The nucleotide sequences of the Donor sequences for knocking out nagB and nagA are shown in SEQ ID NOs. 28-29.

[0102] sgRNA-nagB: (SEQ ID NO. 22): 5'ctgactaccgctgaacaggtcgg 3'.

[0103] sgRNA-nagA: (SEQ ID NO. 23): 5'catcagcgataacaaccgcgtgg 3'.

[0104] The specific experimental process includes the following steps:

[0105] (1) Prepare electroporation competent cells of TCBJ117 and BL21(DE3) strains.

[0106] (2) The pUC-Cas9 plasmid was transformed into TCBJ117 and BL21 (DE3) cells, and the bacterial solution was spread on kanamycin-resistant plates and cultured at a constant temperature of 30°C.

[0107] (3) The next day, single clones were picked for PCR verification, and positive clones were used to prepare electrocompetent cells, which were named TCBJ117-Cas9 and BL21(DE3)-Cas9, respectively.

[0108] (4) pUC-sgRNA-nagB was transformed into TCBJ117-Cas9 and BL21(DE3)-Cas9 cells, and the bacterial solution was spread on Kan+Spec resistance plates and cultured at a constant temperature of 30°C.

[0109] (5) The next day, a single clone was picked and expanded for culture. The target gene fragment was amplified using primers nagB-F and nagB-R, and identified by agarose gel electrophoresis and sequencing.

[0110] nagB-F: 5'agacgccggttcgttaaatgcaat 3'; (SEQ ID NO. 34)

[0111] nagB-R: 5'gctgcaaattgtactgccgatgttct 3'. (SEQ ID NO.35)

[0112] (6) The same strategy as above was used to knock out the nagA gene in combination with its sgRNA sequence.

[0113] (7) Using the positive clone as a template, primers nagA-F and nagA-R were used to amplify the upstream and downstream sequences of the nagA gene at the gene knockout site. The correct band was recovered from agarose gel and sequenced to verify that the knockout fragment sequence was consistent with the Donor fragment.

[0114] nagA-F: 5'acgcctggttcggatgttt; (SEQ ID NO.36)

[0115] nagA-R: 5'cgacggtcatattgcatttaacgaacc 3'. (SEQ ID NO.37)

[0116] The sequencing results of nagB and nagA knockout in TCBJ117 and BL21(DE3) strains are shown in Figure 1 As shown, (a) and (b) represent the sequencing results of PCR products of nagB and nagA genes of TCBJ117, respectively, and (c) and (d) represent the sequencing results of PCR products of nagB and nagA genes of BL21(DE3), respectively.

[0117] Sequencing verification showed that the sequence of the knockout fragment was consistent with the Donor designed fragment, and the nagB and nagA genes of the TCBJ117 and BL21(DE3) strains were successfully knocked out, and the recombinant bacteria TCBJ117ΔnagB, TCBJ117ΔnagBΔnagA, BL21(DE3)ΔnagB, and BL21(DE3)ΔnagBΔnagA were obtained, respectively.

[0118] (8) Plasmid construction: The genome of Escherichia coli K-12MG1655 was used as a template and the gene fragment of EcglmS (shown in SEQ ID NO. 3) was cloned using primers EcglmS-F and EcglmS-R. Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to artificially synthesize the gna1 gene from Saccharomyces cerevisiae after codon optimization in Escherichia coli and named Scgna1. opt (shown in SEQ ID NO.4), using primer Scgna1 opt -F and Scgna1 opt -R amplification of Scgna1 opt Gene, gel electrophoresis and gel excision to recover DNA fragments. opt The gene fragment was connected to the vector pETDuet by homologous recombination to construct the expression plasmid pET-EcglmS-Scgna1 opt .

[0119] EcglmS-F: 5'gtataagaaggagatatacatatgtgtggaattgttggcgcgatcgcg 3'; (SEQ ID NO. 38)

[0120] EcglmS-R: 5'cagcggtttctttaccagactcgagttatcaaccgtaaccgattttg 3'. (SEQ ID NO.39)

[0121] Scgna1 opt-F: 5'ctttaagaaggagatataccatgggcatgagtctgccggacggtttttac 3'; (SEQ ID NO.40)

[0122] Scgna1 opt -R: 5'cgcgccgagctcgaattcggatccttatttgcggatctgcatttc 3'. (SEQ IDNO.41)

[0123] (9) Construction of strain: The recombinant plasmid constructed in step (8) above is transferred into the strain constructed in step (7) to obtain an engineered strain for producing GlcNAc.

[0124] (10) Synthesis of GlcNAc by shake flask fermentation: The engineered strain for producing GlcNAc obtained in step (9) was inoculated into 2 mL of LB medium containing the corresponding antibiotics, and the culture was carried out overnight at 37° C. and 220 rpm to obtain a seed solution; 1 mL of the overnight cultured seed solution was inoculated into 50 mL of LB medium containing the corresponding antibiotics, and glucose with a final concentration of 20 g / L was added, and the culture was carried out at 30° C. and a shaker speed of 250 rpm for about 6 hours (the bacterial solution OD 600 About 0.8). IPTG was added at a final concentration of 0.1 mM, and the fermentation was continued for 48 hours at 25°C and a shaking speed of 250 rpm. After the fermentation was completed, the fermentation supernatant was collected by centrifugation, boiled at 100°C for 10 minutes, centrifuged again, and the supernatant was diluted 10 times with sterile water. The sample was filtered through a 0.22 μm filter membrane, and the content of GlcNAc and GlcN was detected by liquid chromatography using an external standard method.

[0125] The results of GlcNAc and GlcN production of the engineered strains are shown in Table 1. The strain TCBJ117ΔnagBΔnagA / pET-EcglmS-Scgna1 opt The yield of GlcNAc and GlcN reached 1.97 g / L and 0.67 g / L respectively after 48 hours of fermentation.

[0126] With BL21(DE3)ΔnagBΔnagA / pET-EcglmS-Scgna1 opt Compared with TCBJ117ΔnagBΔnagA / pET-EcglmS-Scgna1 opt The yield was increased by 1.68 times, so the strain TCBJ117ΔnagBΔnagA / pET–EcglmS-Scgna1 was subsequently selected. opt Make further transformation.

[0127] Table 1

[0128]

[0129] Example 3

[0130] Construction of the GlcNAc biosynthetic pathway

[0131] (1) Screening of different expression vectors:

[0132] Plasmid pET-EcglmS-Scgna1 opt As a template, the primer Scgna1 in Example 2 was used. opt -F and EcglmS-R cloned EcglmS-Scgna1 opt The gene fragment was connected to the vector pCOLADuet or pRSFDuet or pCDFDuet by homologous recombination to construct a series of expression plasmids, including: pCOLA-EcglmS-Scgna1 opt 、pRSF-EcglmS-Scgna1 opt , pCDF-EcglmS-Scgna1 opt .

[0133] The constructed recombinant plasmid was transformed into the strain TCBJ117ΔnagBΔnagA constructed in Example 2 to obtain an engineered strain producing GlcNAc. The shake flask fermentation process was the same as step (10) in Example 2.

[0134] The results of GlcNAc and GlcN production of the engineered strains are shown in Table 2. TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 opt The yield was the highest. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 2.77 g / L and 0.93 g / L, respectively.

[0135] Table 2

[0136] Group Chassis Cell Plasmids GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pET-EcglmS-Scgna1 opt ]]> 1.88 0.61 2 TCBJ117ΔnagBΔnagA <![CDATA[pCOLA-EcglmS-Scgna1 opt ]]> 1.43 0.72 3 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt ]]> 2.77 0.93 4 TCBJ117ΔnagBΔnagA <![CDATA[pCDF-EcglmS-Scgna1 opt ]]> 1.94 0.67

[0137] (2) Screening of glmS genes from different sources:

[0138] The genome of Bacillus subtilis was used as a template and the primers BsglmS-F and BsglmS-R were used to clone the gene fragment of BsglmS (shown in SEQ ID NO.5).

[0139] BsglmS-F: 5'gtataagaaggagatatacatatgtgtggaatcgtaggttatatcg 3'; (SEQ ID NO. 42)

[0140] BsglmS-R: 5'cagcggtttctttaccagactcgagttatccacagtaacactcttcgc 3'. (SEQ ID NO.43)

[0141] Using the genome of Corynebacterium glutamicum as a template, the gene fragment of CgglmS (shown in SEQ ID NO.6) was cloned using primers CgglmS-F and CgglmS-R.

[0142] CgglmS-F: 5'gtataagaaggagatatacatatgtgtggaattgttggatatattggc 3'; (SEQ ID NO. 44)

[0143] CgglmS-R: 5'cagcggtttctttaccagactcgagttattcgacggtgacagactttgc 3'. (SEQ ID NO.45)

[0144] Gel electrophoresis and gel excision to recover DNA fragments. The recovered BsglmS and CgglmS gene fragments are replaced by homologous recombination with the plasmid pRSF-EcglmS-Scgna1 constructed in step (1). opt A series of expression plasmids were constructed by using the EcglmS gene in the scgna1 gene, including: pRSF-BsglmS-Scgna1 opt and pRSF-CgglmS-Scgna1 opt .

[0145] The recombinant plasmid was transformed into strain TCBJ117ΔnagBΔnagA to obtain an engineered strain producing GlcNAc. The shake flask fermentation process was the same as step (10) in Example 2.

[0146] The results of GlcNAc and GlcN production of the engineered strains are shown in Table 3. TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 opt The yield of GlcNAc and GlcN reached 2.83 g / L and 0.95 g / L respectively after 48 hours of fermentation.

[0147] Table 3

[0148] Group Chassis Cell Plasmids GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt ]]> 2.83 0.95 2 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-BsglmS-Scgna1 opt ]]> 2.12 0.61 3 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-CgglmS-Scgna1 opt ]]> 1.87 0.68

[0149] (3) Screening of gna1 genes from different sources: Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to artificially synthesize gna1 genes from Saccharomyces cerevisiae and Caenorhabditis elegans, which were named Scgna1 (shown in SEQ ID NO.7) and Cegna1 (shown in SEQ ID NO.8), respectively. The Scgna1 gene fragment was amplified using primers Scgna1-F and Scgna1-R; the Cegna1 gene fragment was amplified using primers Cegna1-F and Cegna1-R; and the Escherichia coli codon-optimized Cegna1 was artificially synthesized and named Cegna1 opt (shown in SEQ ID NO.9). opt -F and Cegna1 opt -R cloned Cegna1 opt of gene fragments.

[0150] Scgna1-F: 5'ctttaagaaggagatataccatgagcttacccgatggattttatataag 3; (SEQ ID NO. 46)

[0151] Scgna1-R: 5'cgcgccgagctcgaattcggatccctattttctaatttgcatttccac 3'. (SEQ ID NO.47)

[0152] Cegna1-F: 5'ctttaagaaggagatataccatgtctcacatttttgatgcgtct 3'; (SEQ ID NO. 48)

[0153] Cegna1-R: 5'cgcgccgagctcgaattcggatccttagaagcgctgagtcataaaat 3'. (SEQ IDNO.49)

[0154] Cegna1 opt -F: 5'ctttaagaaggagatataccatgagccacatttttgacgcgagc 3'; (SEQ IDNO.50)

[0155] Cegna1 opt -R: 5'cgcgccgagctcgaattcggatccttaaaaacgctgggtcatgaagttg 3'. (SEQ ID NO.51)

[0156] Gel electrophoresis and gel excision to recover DNA fragments. The recovered gene fragments were replaced by homologous recombination vector pRSF-EcglmS-Scgna1 opt Scgna1 opt Gene fragments were used to construct a series of expression plasmids, including: pRSF-EcglmS-Scgna1, pRSF-EcglmS-Cegna1, pRSF-EcglmS-Cegna1 opt The recombinant plasmid constructed above was transferred into the strain TCBJ117ΔnagBΔnagA constructed in Example 2 to obtain an engineered strain producing GlcNAc.

[0157] The fermentation process was the same as step (10) in Example 2. As shown in Table 4, TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 had the highest yield, and after 48 hours of fermentation, the yields of GlcNAc and GlcN reached 4.58 g / L and 1.34 g / L, respectively.

[0158] After screening of vectors, glmS and gna1 genes, the strain TCBJ117ΔnagBΔnagA / pRSF-EcglmS-Scgna1 with the highest GlcNAc production was obtained.

[0159] Table 4

[0160] Group Chassis Cell Plasmids GlcNAc production GlcN production 1 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Scgna1 opt ]]> 2.79 0.93 2 TCBJ117ΔnagBΔnagA pRSF-EcglmS-Scgna1 4.58 1.34 3 TCBJ117ΔnagBΔnagA pRSF-EcglmS-Cegna1 1.32 0.75 4 TCBJ117ΔnagBΔnagA <![CDATA[pRSF-EcglmS-Cegna1 opt ]]> 0.91 0.77

[0161] Example 4

[0162] Knockout of manX, nagE, nagK and ptsG genes in probiotic Escherichia coli TCBJ117ΔnagBΔnagA

[0163] Using CRISPR / Cas9 gene editing technology, sgRNAs targeting genes manX (shown in SEQ ID NO.10), nagE (shown in SEQ ID NO.11), nagK (shown in SEQ ID NO.12) and ptsG (shown in SEQ ID NO.13) were designed respectively, and the sgRNA and Donor sequence were cloned into the gene editing vector Donor plasmid.

[0164] The nucleotide sequences of sgRNA targeting manX, nagE, nagK, and ptsG are shown in SEQ ID NOs. 24 to 27, respectively. The nucleotide sequences of Donor sequences for knocking out manX, nagE, nagK, and ptsG are shown in SEQ ID NOs. 30 to 33.

[0165] sgRNA-manX: (SEQ ID NO.24): 5'ttaggcgagcaggaaaacgtcgg 3'

[0166] sgRNA-nagE: (SEQ ID NO.25): 5'cgatggcgaagattaatgcgagg 3'

[0167] sgRNA-nagK: (SEQ ID NO.26): 5'gcgcttggcgtgtttgatagcgg 3'

[0168] sgRNA-ptsG: (SEQ ID NO.27): 5'gatgccataggcaacaactgcgg 3'

[0169] The specific experimental process includes the following steps:

[0170] (1) Prepare the electroporation competent cell of strain TCBJ117ΔnagBΔnagA.

[0171] (2) The pUC-Cas9 plasmid was transformed into TCBJ117ΔnagBΔnagA cells, and the bacterial solution was spread on kanamycin-resistant plates and cultured at a constant temperature of 30°C.

[0172] (3) The next day, a single clone was picked for PCR verification, and the positive clone was used to prepare electrocompetent cells and named TCBJ117ΔnagBΔnagA-Cas9.

[0173] (4) pUC-sgRNA-manX was transferred into TCBJ117ΔnagBΔnagA-Cas9 cells, and the bacterial solution was spread on Kan+Spec resistance plates and cultured at a constant temperature of 30°C.

[0174] (5) The next day, a single clone was picked and expanded for culture, and the target gene fragment was amplified using primers manX-F and manX-F, and then identified by agarose gel electrophoresis and sequencing.

[0175] manX-F: 5'ctttgcaaacgaatgtgacaagga 3'; (SEQ ID NO.52)

[0176] manX-R: 5'ttggctttcagtgctttcacgc 3'. (SEQ ID NO.53)

[0177] (6) The same strategy as above was used to knock out the nagE, nagK, and ptsG genes by combining their sgRNA sequences.

[0178] (7) Using the positive clones as templates, primers nagE-F and nagE-R; nagK-F and nagK-R; ptsG-F and ptsG-R were used to PCR amplify the upstream and downstream sequences of the gene knockout sites nagE, nagK, and ptsG, respectively. The correct bands were recovered from agarose gel and sequenced to verify that the knockout fragment sequence was consistent with the donor fragment.

[0179] nagE-F: 5'cgtttaatttgcgatacgaattaaa 3'; (SEQ ID NO. 54)

[0180] nagE-R: 5'tagcgtgctgtaccggcg 3'. (SEQ ID NO.55)

[0181] nagK-F: 5'gttatcggcgtggtggtttcact 3'; (SEQ ID NO.56)

[0182] nagK-R: 5'ggcagacgcatatggccaaact 3'. (SEQ ID NO.57)

[0183] ptsG-F: 5'cccccttgccacgcgt 3'; (SEQ ID NO.58)

[0184] ptsG-R: 5'gtaagcagcccactgagagaaggt 3'. (SEQ ID NO.59)

[0185] The sequencing results of the knockout of manX, nagE, nagK and ptsG genes in strain TCBJ117ΔnagBΔnagA are as follows Figure 2 As shown, (a), (b), (c) and (d) represent the sequencing results of PCR products of manX, nagE, nagK and ptsG genes, respectively. After sequencing verification, the knockout fragment sequence was consistent with the Donor designed fragment. The manX, nagE, nagK and ptsG genes of strain TCBJ117ΔnagBΔnagA were successfully knocked out, and a series of strains were obtained, including:

[0186] TCBJ117ΔnagBΔnagAΔmanX;

[0187] TCBJ117ΔnagBΔnagAΔmanXΔnagE;

[0188] TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK;

[0189] TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG.

[0190] (8) Construction of recombinant plasmid: Using the genome of Escherichia coli K-12MG1655 as a template, the gene fragments of galP (shown in SEQ ID NO.14) and glk (shown in SEQ ID NO.15) were cloned using primers galP-F and galP-R, glk-F and glk-R, respectively; gel electrophoresis and gel excision were performed to recover DNA fragments. The recovered galP gene fragment and the EcglmS recovered in step (8) of Example 2 were connected to the vector pRSFDuet by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-galP; the recovered glk gene fragment and the Scgna1 gene fragment recovered in step (3) of Example 3 were connected to the vector pCDFDuet by homologous recombination to obtain the recombinant plasmid pCDF-glk-Scgna1.

[0191] galP-F: 5'ctttaagaaggagatataccatgggcatgcctgacgctaaaaaacaggggc 3'; (SEQ ID NO. 60)

[0192] galP-R: 5'cgcgccgagctcgaattcggatccttaatcgtgagcgcctatttcgcgcag 3'. (SEQ ID NO.61)

[0193] glk-F: 5'gtataagaaggagatatacatatgacaaagtatgcattagtcggtgatg 3'; (SEQ IDNO.62)

[0194] glk-R: 5'cagcggtttctttaccagactcgagttacagaatgtgacctaaggtctggcg 3'. (SEQ ID NO.63)

[0195] (10) Construction of strains: The best recombinant plasmid pRSF-EcglmS-Scgna1 screened in Example 3 was transferred into a series of strains constructed in step (7) to obtain a series of engineered strains for producing GlcNAc; wherein the ptsG gene was knocked out in the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG. In order to compensate for the glucose transport function, the galP and glk genes needed to be overexpressed. Therefore, the recombinant plasmid pR SF-EcglmS-galP and pCDF-glk-Scgna1 replaced pRSF-EcglmS-Scgna1 and were simultaneously transformed into the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG to obtain the strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagKΔptsG / pRSF-EcglmS-galP / pCDF-glk-Scgna1.

[0196] (11) Synthesis of GlcNAc by shake flask fermentation: The fermentation process was the same as step (10) in Example 2. The fermentation results are shown in Table 5. The strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-Scgna1 had the highest yield. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 8.22 g / L and 1.94 g / L, respectively. Knocking out the genes manX, nagE, and nagK increased the yield of GlcNAc by 1.84 times; knocking out ΔptsG did not further increase the yields of GlcNAc and GlcN.

[0197] Table 5

[0198]

[0199] Example 5

[0200] Enhancement of the GlcNAc biosynthetic pathway

[0201] (1) Obtaining glnA, yqaB and icaC gene fragments and constructing recombinant plasmids: Using pRSF-EcglmS-Scgna1 as a template, the Scgna1-(glnA) gene fragment was cloned using the primers Scgna1-F and Scgna1-R (glnA) in Example 3; the Scgna1-(yqaB) gene fragment was cloned using the primers Scgna1-F and Scgna1-R (icaC); the Scgna1-(icaC) gene fragment was cloned using the primers Scgna1-F and Scgna1-R (icaC); using the genome of Escherichia coli K-12MG1655 as a template, the glnA gene fragment (shown in SEQ ID NO. 16) was cloned using the primers glnA-F and glnA-R; the yqaB gene fragment (shown in SEQ ID NO. 16) was cloned using the primers yqaB-F and yqaB-R. The gene fragment of icaC (shown in SEQ ID NO.17) was cloned using the genome of Bacillus subtilis 168 as a template using primers icaC-F and icaC-R, and the DNA fragment was recovered by gel electrophoresis and gel excision. Recombinant plasmid pRSF-EcglmS-Scgna1 opt The linearized pRSF-EcglmS was obtained by digestion with NcoI and BamHI, and the DNA fragment was recovered by gel electrophoresis and gel excision.

[0202] Scgna1-R(glnA): 5'tcagcggacatggtatatctccttctattttctaatttgcatttccacg3'). (SEQ ID NO.64)

[0203] Scgna1-R(yqaB): 5'cgctcgtacatggtatatctccttctattttctaatttgcatttccacg3'. (SEQ ID NO.65)

[0204] Scgna1-R(icaC): 5'taatttgcatggtatatctccttctattttctaatttgcatttccacg 3'. (SEQ ID NO.66)

[0205] glnA-F: 5'tagaaaatagaaggagatataccatgtccgctgaacacgtactga 3'; (SEQ IDNO.67)

[0206] glnA-R: 5'cgcgccgagctcgaattcggatccttagacgctgtagtacagctcaaa 3'. (SEQ IDNO.68)

[0207] yqaB-F: 5'tagaaaatagaaggagatataccatgtacgagcgttatgcaggtttaat 3'; (SEQ IDNO.69)

[0208] yqaB-R: 5'cgcgccgagctcgaattcggatcctcacagcaagcgaacatccacggcg 3'. (SEQ IDNO.70)

[0209] icaC-F: 5'tagaaaatagaaggagatataccatgcaaattaaagaaatttttatgatc 3'; (SEQ ID NO.71)

[0210] icaC-R: 5'cgcgccgagctcgaattcggatcctcaccctgcgtgatcacgcacttcg 3'. (SEQ IDNO.72)

[0211] The recovered Scgna1-(glnA) and glnA were connected to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-glnA; the recovered Scgna1-(yqaB) and yqaB were connected to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-yqaB; the recovered Scgna1-(icaC) and icaC were connected to the linearized plasmid pRSF-EcglmS by homologous recombination to obtain the recombinant plasmid pRSF-EcglmS-Scgna1-icaC.

[0212] (2) Construction of a double plasmid overexpressing five genes: PCR amplification was performed using primers glnA-F2 and glnA-R2 to obtain the glnA gene fragment; the recovered glnA was ligated to the linearized plasmid pRSF-EcglmS in step (1) by homologous recombination to obtain pRSF-EcglmS-glnA.

[0213] glnA-F2: 5'ctttaagaaggagatataccatgggcatgtccgctgaacacgtactgacgatgc 3'; (SEQ ID NO.73)

[0214] glnA-R2: 5'cgcgccgagctcgaattcggatccttagacgctgtagtacagctcaaactc 3'. (SEQ ID NO.74)

[0215] Using plasmid pRSF-EcglmS-Scgna1-icaC as template, the Scgna1-icaC gene fragment was amplified using primers Scgna1-F and icaC-R in step (1); pCDF-EcglmS-Scgna1 was digested with NcoI and BamHI. opt , and obtain the linearized fragment pCDF-EcglmS. The recovered Scgna1-icaC gene fragment was connected to the linearized fragment pCDF-EcglmS by homologous recombination to obtain the recombinant plasmid pCDF-EcglmS-Scgna1-icaC.

[0216] Using pRSF-EglmS-Scgna1-yqaB as a template, the yqaB-2 gene fragment was cloned using primers yqaB-F2 and yqaB-R2; using pCDF-EglmS-Scgna1-icaC as a template, pCDF-Scgna1-icaC-F and pCDF-Scgna1-icaC-R as primers, the linearized pCDF-Scgna1-icaC fragment was obtained, and the recovered yqaB-2 was connected to the linearized plasmid pCDF-Scgna1-icaC by homologous recombination to obtain the recombinant plasmid pCDF-yqaB-Scgna1-icaC.

[0217] yqaB-F2: 5'aagtataagaaggagatatacatatgtacgagcgttatgcaggtt 3'; (SEQ IDNO.75)

[0218] yqaB-R2: 5'ggtttctttaccagactcgagtcacagcaagcgaacatccacg 3'. (SEQ IDNO.76)

[0219] pCDF-Scgna1-icaC-F: 5'atgtatatctccttcttatacttaactaatatactaa 3'; (SEQ ID NO.77)

[0220] pCDF-Scgna1-icaC-R: 5'gtggatgttcgcttgctgtgactcgagtctggtaaagaaacc 3'. (SEQ ID NO.78)

[0221] (3) Construction of strains: The recombinant plasmids constructed in steps (1) and (2) were transferred into the competent cells of the probiotic Escherichia coli TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK constructed in Example 4 to obtain a series of engineered strains for producing GlcNAc, as shown in Table 6.

[0222] (4) Synthesis of GlcNAc by shake flask fermentation: The fermentation process was the same as step (10) in Example 2. The fermentation results are shown in Table 6. The strain TCBJ117ΔnagBΔnagAΔmanXΔnagEΔnagK / pRSF-EcglmS-glnA / pCDF-Scgna1-yqaB-icaC had the highest yield. After 48 hours of fermentation, the yields of GlcNAc and GlcN reached 17.73 g / L and 2.62 g / L, respectively.

[0223] Table 6

[0224]

[0225] Example 6

[0226] Qualitative Detection Method of GlcNAc

[0227] The GlcNAc-containing fermentation liquid obtained in the embodiment of the present invention was centrifuged at 10000 rpm for 1 minute to obtain a fermentation liquid supernatant; the fermentation liquid supernatant was diluted 200 times and then filtered through a 0.22 μm aqueous filter membrane. The diluted fermentation supernatant was used as a sample to be tested and subjected to HPLC-MS detection.

[0228] HPLC detection conditions: Chromatographic column: Eclipse Plus C18 RRHD 1.8 μm 2.1×50 mm; Mobile phase: Pump A is to obtain H2O+0.1% formic acid, pump B is methanol; Elution gradient is as shown in Table 7 (liquid phase elution conditions of GlcNAc); Column temperature 30°C.

[0229] Table 7

[0230] Time (minutes) A％ B％ Flow rate mL / min Pressure limit bar 0 40 60 0.3 600 1 40 60 0.3 600 4.5 2 98 0.3 600 7 2 98 0.3 600 7.1 40 60 0.3 600 10 40 60 0.3 600

[0231] MS detection conditions: ionization mode: electrospray positive ion mode; detection mode: Product Ion; nebulizer gas pressure: 40psi; ion spray voltage: 4000V; dryer temperature: 350℃; drying gas flow rate: 8L / min. Qualitative ion pairs, fragmentation voltage and collision energy are shown in Table 8:

[0232] Table 8

[0233]

[0234] The HPLC-MS results of GlcNAc standards and samples are attached. Figure 3 The elution time of the GlcNAc standard was 13.024 minutes, and the elution time of the product peak in the GlcNAc sample was consistent with that of the GlcNAc standard; and the MS results of the sample mainly produced m / z 222.1, 204.1, 168.1 and 138.0, of which 222.1 was the parent ion peak (M+1), and m / z 204.1, 168.1 and 138.0 were daughter ion peaks, which were consistent with the MS results of GlcNAc reported in the literature, proving that the product of the present invention is indeed GlcNAc.

[0235] In summary, the present invention provides a probiotic Escherichia coli engineered strain for efficiently synthesizing N-acetylglucosamine and a construction method thereof. During the construction process, the engineered strain can knock out five genes in the glucosamine synthesis process on the genome of the original strain TCBJ117: deaminase gene nagB, deacetylase gene nagA, mannose phosphate transporter encoding gene manX, acetylglucosamine transporter encoding gene nagE and acetylglucosamine kinase nagK; and strengthen overexpression of glucosamine synthase gene glmS, glucosamine acetylase gene gna1, glutamine synthetase gene glnA, fructose-1-phosphate phosphatase gene yqaB and acetylglucosamine transporter gene icaC to obtain the engineered strain.

[0236] The scheme of the present invention can promote the synthesis of N-acetylglucosamine, and at the same time block the transport of the product N-acetylglucosamine from the extracellular to the intracellular, thereby increasing the yield of N-acetylglucosamine in the fermentation broth. The present invention uses the Escherichia coli probiotic Nissle1917 as a host to carry out the biosynthesis of N-acetylglucosamine, laying a foundation for the industrialized safe production of N-acetylglucosamine.

[0237] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention are within the protection scope and disclosure scope of the present invention.

Claims

1. A genetically engineered bacterium for synthesizing N-acetylglucosamine, It is characterized in that The genetically engineered bacteria use Escherichia coli as the initial bacteria, knock out the deaminase gene nagB and the deacetylase gene nagA in the genome of the initial bacteria, and over-express the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1.

2. A genetically engineered bacterium that synthesizes N-acetylglucosamine, It is characterized in that The genetically engineered bacteria uses Escherichia coli as the initial bacteria, knocks out the deaminase gene nagB and the deacetylase gene nagA in the genome of the initial bacteria, further knocks out one or more of the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK or the glucose transmembrane transporter gene ptsG, and overexpresses the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1.

3. The genetically engineered bacteria according to claim 2, It is characterized in that When the engineered bacteria knock out the glucose transmembrane transporter gene ptsG, the galactose co-transporter gene galP and the glucose kinase gene glk are overexpressed while the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed.

4. A genetically engineered bacterium for synthesizing N-acetylglucosamine, It is characterized in that The genetically engineered bacteria uses Escherichia coli as the initial bacteria, knocks out the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, and the acetylglucosamine kinase gene nagK in the genome of the initial bacteria, overexpresses the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1, and further overexpresses one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB, and the acetylglucosamine transporter gene icaC.

5. The genetically engineered bacteria for synthesizing N-acetylglucosamine according to any one of claims 1 to 4, It is characterized in that The Escherichia coli is selected from BL21 (DE3) or Nissle 1917 engineered bacteria integrated with a T7 RNA polymerase expression cassette; Preferably, the genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression cassette comprises: inserting the T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2; Preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, the 5' end of which is shown in SEQ ID NO.19, and the T7 RNA polymerase expression cassette sequence is shown in SEQ ID NO.

83.

6. The genetically engineered bacteria for synthesizing N-acetylglucosamine according to any one of claims 1 to 5, It is characterized in that The overexpression is to integrate one or more of the genes glmS, gna1, glnA, yqaB, icaC, galP or glk into an exogenous plasmid and introduce it into the engineered bacteria for expression; Preferably, the exogenous plasmid is selected from any one of pETDuet, pCOLADuet, pRSFDuet or pCDFDuet, or a combination of at least two thereof; Preferably, the knockout is gene knockout or silencing using a CRISPR gene editing method or a homologous recombination method, thereby downregulating or removing the function of the relevant gene; Preferably, the glucosamine synthase gene glmS is derived from: Escherichia coli K-12MG1655, Bacillus subtilis, Corynebacterium glutamate; more preferably, it is derived from Escherichia coli K-12MG1655; Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is gna1 derived from Saccharomyces cerevisiae and Caenorhabditis elegans after Escherichia coli codon optimization; More preferably, the glucosamine acetylase gene gna1 is the gna1 gene derived from Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.7; Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12MG1655, wherein the nucleotide sequence of the galP is shown in SEQ ID NO.14, the nucleotide sequence of the glk is shown in SEQ ID NO.15, the nucleotide sequence of the glnA is shown in SEQ ID NO.16, and the nucleotide sequence of the yqaB is shown in SEQ ID NO.17; the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of the icaC is shown in SEQ ID NO.

18.

7. Use of the genetically engineered bacteria for synthesizing N-acetylglucosamine according to any one of claims 1 to 6 in the production of N-acetylglucosamine and / or glucosamine.

8. A method for preparing a genetically engineered bacterium for synthesizing N-acetylglucosamine according to any one of claims 1 to 6, It is characterized in that The preparation method comprises: (1) Knock out genes related to N-acetylglucosamine catabolism in the initial bacterial genome, including: deaminase gene nagB and deacetylase gene nagA; (2) constructing a recombinant plasmid that overexpresses genes related to N-acetylglucosamine metabolism and synthesis, and transducing the recombinant plasmid into the initial strain, wherein the genes related to N-acetylglucosamine metabolism and synthesis include: glucosamine synthase gene glmS, glucosamine acetylase gene gna1; The initial strain is Escherichia coli BL21 (DE3) or Nissle1917 engineered bacteria integrated with a T7 RNA polymerase expression frame.

9. The preparation method according to claim 8, It is characterized in that In step (1), the genes related to N-acetylglucosamine decomposition metabolism also include: one or more of: mannose phosphate transporter gene manX, acetylglucosamine transporter gene nagE, acetylglucosamine kinase gene nagK, and glucose transmembrane transporter gene ptsG; Preferably, in step (1), when the engineered bacteria knock out the glucose transmembrane transporter gene ptsG, while overexpressing the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1, the galactose co-transporter gene galP and the glucokinase gene glk are overexpressed; Preferably, in step (2), the N-acetylglucosamine metabolism and synthesis-related genes further include: one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB or the acetylglucosamine transport gene icaC; Preferably, in step (1), the knockout is gene knockout / silencing using a CRISPR gene editing method or a homologous recombination method, thereby downregulating or removing the function of the relevant gene; Preferably, in step (2), when constructing a recombinant plasmid that overexpresses genes related to N-acetylglucosamine metabolism and synthesis, the plasmid is selected from any one of pETDuet, pCOLADuet, pRSFDuet or pCDFDuet, or a combination of at least two thereof; Preferably, in step (2), the glucosamine synthase gene glmS is derived from any one of: Escherichia coli K-12MG1655, Bacillus subtilis or Corynebacterium glutamate; Preferably, the glucosamine synthase gene glmS is derived from Escherichia coli K-12MG1655, and the nucleotide sequence is shown in SEQ ID NO.3; Preferably, the glucosamine acetylase gene gna1 is derived from: Saccharomyces cerevisiae, Caenorhabditis elegans, or the glucosamine acetylase gene gna1 is gna1 derived from Saccharomyces cerevisiae after being codon-optimized by Escherichia coli, and the nucleotide sequence is shown in SEQ ID NO.4, or the glucosamine acetylase gene gna1 is gna1 derived from Caenorhabditis elegans after being codon-optimized by Escherichia coli, and the nucleotide sequence is shown in SEQ ID NO.9; Preferably, the glucosamine acetylase gene gna1 is a gna1 gene derived from Saccharomyces cerevisiae, and the nucleotide sequence is shown in SEQ ID NO.7; Preferably, the galP, glk, glnA, and yqaB genes are derived from Escherichia coli K-12MG1655, wherein the nucleotide sequence of the galP is shown in SEQ ID NO.14, the nucleotide sequence of the glk is shown in SEQ ID NO.15, the nucleotide sequence of the glnA is shown in SEQ ID NO.16, and the nucleotide sequence of the yqaB is shown in SEQ ID NO.17; Preferably, the icaC gene is derived from Bacillus subtilis, and the nucleotide sequence of the icaC is shown in SEQ ID NO.

18.

10. The preparation method according to claim 8 or 9, It is characterized in that In the initial strain, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE and the acetylglucosamine kinase gene nagK were knocked out, and the glucosamine synthase gene glmS and the glucosamine acetylase gene gna1 were overexpressed; Preferably, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE and the acetylglucosamine kinase gene nagK are knocked out in the initial bacteria, the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, and one or more of the glutamine synthetase gene glnA, the fructose-1-phosphate phosphatase gene yqaB and the acetylglucosamine transporter gene icaC are further overexpressed; Preferably, the deaminase gene nagB and the deacetylase gene nagA, the mannose phosphate transporter gene manX, the acetylglucosamine transporter gene nagE, the acetylglucosamine kinase gene nagK, and the glucose transmembrane transporter gene ptsG are knocked out in the initial bacteria, and the glucosamine synthetase gene glmS and the glucosamine acetylase gene gna1 are overexpressed, while the galactose co-transporter gene galP and the glucose kinase gene glk are overexpressed.

11. The preparation method according to any one of claims 8 to 10, It is characterized in that The genetic modification of the Nissle 1917 engineered bacteria integrated with the T7 RNA polymerase expression cassette includes: inserting the T7 RNA polymerase expression cassette into the attB site of the Nissle 1917 genome, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2; The T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, the 5' end of which is shown in SEQ ID NO.19, and the T7 RNA polymerase expression cassette sequence is shown in SEQ ID NO.83.

Images