Method for rapidly identifying herbicide-resistant transgenic soybean strain by utilizing multiple fluorescent PCR (Polymerase Chain Reaction)

Abstract

The invention relates to the fields of genetic engineering and food safety transgenic detection. The invention provides a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) detection technology, specific target sequences of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 and a soybean endogenous gene Lectin are simultaneously detected by utilizing the high-throughput detection characteristic of the technology, a whole set of proper primers and probes and a nucleic acid extraction and multiplex amplification and analysis method are established, and the specific target sequences of the transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 and the endogenous gene Lectin of the soybeans are detected. And carrying out multiple rapid identification on transgenic soybean lines (including deep processed food). According to the invention, the actual requirement of one-tube multi-detection can be met, the reagent cost is reduced, and the detection time is shortened; endogenous gene detection is set in the multiple amplification system, so that the effectiveness of nucleic acid extraction and amplification reaction can be judged, and a false negative reaction result is avoided.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, in particular to a multiplex fluorescent PCR rapid identification method applicable to four herbicide-resistant transgenic soybean lines, belonging to the field of food safety transgenic detection. Background Art

[0002] According to the survey report of the International Service for the Acquisition of Agri-biotech Applications (ISAAA), the total planting area has been rising since the first commercial planting of genetically modified crops; the planting area of ​​genetically modified soybeans has been growing steadily. With the rapid development of agricultural biotechnology, a total of 525 transformation events such as insect resistance, virus resistance, herbicide resistance, extreme environment resistance, storage resistance and special nutrition have been approved for commercial planting, of which 41 were genetically modified soybean transformations. The genetically modified traits of soybeans have gradually extended from insect resistance and herbicide resistance to oil increase, high yield, drought resistance and the addition of special nutrients. With the improvement of people's living standards, soybeans, as the main source of feed protein, need to be imported in increasing quantities.

[0003] According to relevant regulations, after obtaining a biosafety certificate, genetically modified varieties need to pass variety approval and obtain a seed production and operation license before they can truly enter commercial production and application. Based on the guiding principle of "strict supervision, strict risk control, and steady and orderly promotion", different varieties are promoted and planted in designated provinces and designated areas to promote the development of genetically modified industrialization in an orderly manner.

[0004] DAS-68416-4 is a soybean tolerant to 2,4-D and glufosinate herbicides; DAS-44406-6 is a soybean tolerant to glufosinate, glyphosate, and 2,4-D herbicides; DAS-81419-2 is a soybean tolerant to glufosinate herbicides and resistant to lepidopterans; DP 305423 (SOYA 305423) is a soybean tolerant to sulfonylurea herbicides. These four transgenic soybeans are relatively common and are key soybean lines under port supervision. Among them, DAS-44406-6 and DP 305423 have been approved by my country for processing and feed respectively; DAS-68416-4 and DAS-81419-2 have not yet been approved to enter the Chinese market. The molecular characteristics of transformants, environmental safety, and food safety evaluation technology systems are still flawed. It is necessary to strengthen the screening and supervision of commercial transgenic soybean lines to ensure the quality and safety of transgenic soybeans and their products and promote the ecological development of the transgenic soybean industry.

[0005] At present, the detection method used for identification of transgenic crop strains is mainly PCR. Qian Yunkai et al. used real-time fluorescence PCR to screen 45 batches of transgenic soybeans from Qinhuangdao Port and Jingtang Port, the main ports for importing transgenic soybeans (a total of 16 strains), and detected 5 strains, GTS-40-3-2, MON89788, A2704-12, MON87701, and MON87701×MON89788. Zhao Yang et al. used qualitative PCR to screen 706 conventional soybeans for two herbicide-resistant transgenic soybean transformants, GTS40-3-2 and MON89788. A total of 6 soybean samples were detected with MON89788 transformant components, with a positive ratio of 0.85%. Zhou Jie et al. developed a loop-mediated isothermal amplification (LAMP) detection method through verification of specificity and sensitivity, which can be used to identify the strains of transgenic soybeans DAS-81419-2, DP-356043, A2704-12, FG72, BPS-CV127-9 and MON89788, and the detection sensitivity can reach 0.1% (W / W). Yan Wei et al. developed a triple fluorescence PCR detection system for transgenic soybeans MON87701, MON87708, and MON87769, with a detection sensitivity of 43 DNA copies, equivalent to 0.05% (w / w). Alexandra et al. developed the Naica six-color Crystal dPCR technology, which can achieve rapid and accurate multiple identification and quantification of 5 transgenic soybean lines in a single six-fold experiment, with a detection limit or LOD of less than 25 copies / reaction. Lutz Grohmann et al. used event-specific multiplex qualitative PCR to screen and identify five transgenic soybean lines, including MON 87708, MON 87769, DP-305423, CV-127 and DAS-68416, and verified it in a collaborative research experiment of 16 participating laboratories. The above technical methods mainly use real-time fluorescence PCR to screen and identify single products, or use multiplex qualitative PCR to identify 3 to 5 lines. The former has high accuracy, but the throughput cannot meet the screening needs of the growing number of transgenic crop lines. The latter detection also requires electrophoresis and gel imaging analysis, which is time-consuming and labor-intensive. The primer method may bring unexpected non-specific amplification, resulting in reduced method accuracy. Therefore, it is necessary to develop a multi-channel real-time fluorescence PCR rapid identification and screening system for transgenic soybean lines to provide technical support for the import, circulation and labeling of transgenic soybeans and their products. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a method for detecting transgenic soybean strains by using quadruple real-time fluorescence PCR, so as to achieve rapid, efficient and accurate identification of strains of soybean samples to be tested.

[0007] In order to solve the above technical problems, the present invention provides a primer and probe for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0008] The amplification primers and probes for the transgenic soybean line DAS-68416-4 are:

[0009] DAS-68416-4-F:CAGTCAGCATCATCACACCAAA

[0010] DAS-68416-4-R:GACCTCAATTGCGAGCTTTCTAA

[0011] DAS-68416-4-P: TAMRA-TTAGGCCCGAATAGTTT-MGB;

[0012] The amplification primers and probes for the transgenic soybean line DAS-44406-6 are:

[0013] DAS-44406-6-F: CAAATTCGCTCTTAGCCGTACA

[0014] DAS-44406-6-R:AATCGCGGCCCATGATC

[0015] DAS-44406-6-P: VIC-TATTACTCACCGGATCCTA-MGB;

[0016] The amplification primers and probes for the transgenic soybean line DAS-81419-2 are:

[0017] DAS-81419-2-F: GCTAATGCTACAGCACTTATTCGTACTT

[0018] DAS-81419-2-R:TTGCCGGGATCAACAG

[0019] DAS-81419-2-P: FAM-CTCTATGAAATAACCACTTGCGCATCGGTG-BHQ1;

[0020] The amplification primers and probes for transgenic soybean line DP 305423 are:

[0021] DP 305423-F:GGAATAAAGGAAGTACAGTAGAATTTAAAGG

[0022] DP 305423-R: GAGAAAAAAACACTAGCTAGCCAAAAA

[0023] DP 305423-P:ROX-ACTCTTTTTATATATACCCGTGTTC-BHQ3.

[0024] Note: The 5' fluorescent dye labeling of the probe depends on the configuration of the real-time fluorescent PCR instrument used and the emission spectrum or absorption spectrum of the fluorescent group. The 3' quenching group of the probe is a non-fluorescent label, which includes ECLIPSE, BHQ or MGB.

[0025] The present invention also provides a method for rapidly identifying transgenic soybean lines using quadruple real-time fluorescent PCR, comprising the following steps:

[0026] 1) Screening and determination of target genes

[0027] Four transgenic soybean lines, DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP 305423 (lines of concern for transgenic food safety supervision) were selected as target genes;

[0028] 2) Designing primers and probes required for the quadruple real-time fluorescent PCR amplification as described above;

[0029] 3) Extraction of genomic DNA from soybean samples to be tested;

[0030] 4) Setting up quadruple real-time fluorescence PCR amplification system;

[0031] 5) Determine whether the soybean transgenic strain to be tested contains a transformant component of a certain strain.

[0032] As an improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0033] The step 5) determines whether the soybean transgenic strain to be tested contains a certain strain transformant component, specifically: judging the soybean sample strain to be tested or whether it contains a certain strain transformant component according to the specific S curve in the quadruple real-time fluorescent PCR reaction and the corresponding threshold value.

[0034] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0035] The step 5) comprises:

[0036] 5.2) For strain-specific genes:

[0037] 1. When no S curve is generated for the four target sequences of DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be a non-DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line or does not contain transformant components of these four lines;

[0038] When the Ct value of the DAS-68416-4 specific gene sequence is less than 35, and no S curve is generated for the DAS-44406-6, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-68416-4 line or contains the transformant components of this line;

[0039] When the Ct value of the DAS-44406-6 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-44406-6 line or contains the transformant components of this line;

[0040] When the Ct value of the DAS-81419-2 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-81419-2 line or contains the transformant components of this line;

[0041] When the Ct value of the DP305423 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DAS--81419-2 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DP305423 line or contains the transformant components of this line;

[0042] When the Ct values ​​of the target sequences of two or more soybean lines are all <35, the sample to be tested is determined to be a mixed sample of the multiple soybean lines or contains transformant components of the multiple lines;

[0043] 2. When 35≤DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line target sequence Ct value≤40, the soybean sample to be tested shall be retested and the determination method shall be the same as above.

[0044] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0045] In step 4), the 25 μL quadruple real-time fluorescence PCR amplification system is as follows: the detection primer and probe concentrations are 0.1-1 μM, respectively, SuperRealPreMix (Probe) (2×, Tiangen, Catalog No. FP206) 12.5 μL, 0.4 μL PassiveRefereence Dye (50×), genomic DNA 1 pg-100 ng; ddH2O is added to make up to 25 μL.

[0046] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0047] In a 25 μL quadruple real-time fluorescence PCR amplification system:

[0048] Primer DAS-68416-4-F (10μmol / L)0.2μL

[0049] PrimerDAS-68416-4-R(10μmol / L)0.2μL

[0050] Probe DAS-68416-4(10μmol / L)0.4μL

[0051] Primer DAS-44406-6-F (10μmol / L)0.2μL

[0052] Primer DAS-44406-6-R(10μmol / L)0.2μL

[0053] Probe DAS-44406-6 (10μmol / L)0.2μL

[0054] Primer DAS-81419-2-F(10μmol / L)0.2μL

[0055] Primer DAS-81419-2-R(10μmol / L)0.2μL

[0056] Probe DAS-81419-2(10μmol / L)0.1μL

[0057] Primer DP 305423-F(10μmol / L)0.3μL

[0058] Primer DP 305423-R(10μmol / L)0.3μL

[0059] Probe DP 305423 (10μmol / L)0.6μL.

[0060] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0061] The conditions for quadruple real-time fluorescence PCR amplification were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, for a total of 40 cycles.

[0062] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0063] It also covers setting up singleplex real-time PCR:

[0064] The 25 μL single-plex real-time fluorescence PCR amplification system is:

[0065] Primer Lectin-F (10μmol / L) 0.2μL, Primer Lectin-R (10μmol / L) 0.2μL, ProbeLectin (10μmol / L) 0.2μL, SuperRealPreMix (Probe) 12.5μL, 0.4μLPassive ReferenceDye (50×), genomic DNA 1pg~100ng; add ddH2O to 25μL;

[0066] The conditions for single-plex real-time fluorescence PCR amplification were equivalent to those for quadruple-plex real-time fluorescence PCR amplification;

[0067] The step 5) includes 5.1) and 5.2):

[0068] 5.1) Obtain the Ct value of the endogenous gene Lectin;

[0069] When the endogenous gene Lectin Ct value is less than 35, it indicates that the sample genomic DNA extraction is effective (i.e., there is no or little inhibitor interference in the PCR system, and the amplification reaction is normal), then proceed to the following step 5.2) "for strain-specific genes"; otherwise, the test is considered invalid;

[0070] As a further improvement of the method of the present invention for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0071] The extraction of genomic DNA from the soybean sample to be tested in step 3) is as follows:

[0072] Soybeans (i.e., unprocessed soybean fruits, seeds, leaves, soybean powder, etc.) are extracted using the CTAB method, SDS method, high salt and low pH method, or kit method; the kits can use six plant DNA extraction kits, including Beijing Quanshijin (EE111), Tiangen (DP305), Baimai (NEP023), Hangzhou Biori (BSC13), Qiagen (69104), and Koning (F1612);

[0073] Soybean products (i.e. soybean deep-processed products, including tofu, dried tofu, etc.) were extracted using the Tiangen Deep-Processed Products Extraction Kit (DP326) and the German Congen SureFood PREP Plant X (S1006) kit.

[0074] In the present invention:

[0075] The targets of quadruple real-time fluorescence PCR identification are the specific gene sequences of four common transgenic soybean lines (DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423) screened out through the website of the International Service for the Acquisition of Agri-biotech Applications (ISAAA).

[0076] The 5' fluorescent dye label of the probe depends on the configuration of the real-time fluorescence PCR instrument used and the emission spectrum or absorption spectrum of the fluorescent group, mainly including 6-FAM, TET, HEX, VIC, NED, JOE, CY3, CY5, TAMRA, Texas Red, and the 3' quenching group of the probe is a non-fluorescent label, which includes ECLIPSE, BHQ or MGB.

[0077] Real-time fluorescence PCR reaction is suitable for multi-channel real-time fluorescence PCR reaction instruments, mainly including ABI real-time fluorescence PCR system, BioRad real-time fluorescence PCR system, SmartCyclerII system, etc.

[0078] The present invention also needs to amplify the soybean endogenous gene Lectin as a control for nucleic acid extraction and amplification reaction.

[0079] Lectin-F:TTCGCCGCTTCCTTCAACT

[0080] Lectin-R:AGCCCATCTGCAAGCCTTT

[0081] lectin-P: VIC-ACCTTCTATGCCCCTGAC–MGB.

[0082] The present invention determines whether the soybean sample to be tested is genetically modified soybean DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 according to the specific S curve and the corresponding threshold value in the quadruple real-time fluorescent PCR reaction. The main calculation method is to use 10 times the standard deviation of the fluorescence value of the first 3 to 15 cycles of the amplification process as the threshold, and the number of cycles when the fluorescence value exceeds the threshold is the Ct value. The Ct value of each reaction is the number of cycles when the fluorescence signal of the real-time monitoring amplification process reaches exponential amplification. First, it is necessary to ensure that the Ct value of the endogenous gene Lectin in all soybean samples must be less than 35, indicating that the sample genomic DNA extraction is effective, there is no or less inhibitor interference in the PCR system, and the amplification reaction is normal; otherwise, the detection is invalid (the detection must be repeated); on this basis, the amplification of the four target sequences of DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 is checked.

[0083] When determining the Lectin Ct value <35, when the four target sequences of DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP305423 do not produce an S curve or the Ct value is >40, the soybean sample to be tested is judged to be a non-DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 transgenic soybean line or does not contain the transformant components of these four lines; when the Ct value of the DAS-68416-4 specific gene sequence is <35, the DAS-44406-6, DAS-81419-2 and DP When the 305423 specific gene sequence has no S curve or the Ct value is greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-68416-4 line or contains the transformant component of this line; when the Ct value of the DAS-44406-6 specific gene sequence is less than 35, DAS-68416-4, DAS-81419-2 and DP 305423 specific gene sequence has no S curve or the Ct value is greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-44406-6 line or contains the transformant component of this line; when the Ct value of the DAS-81419-2 specific gene sequence is less than 35, DAS-68416-4, DAS-44406-6 and DP When no S curve is generated for the DP 305423 specific gene sequence or the Ct value is greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-81419-2 line or contains the transformant components of this line; when the Ct value of the DP 305423 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6 and DAS-81419-2 specific gene sequences or the Ct value is greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DP 305423 line or contains the transformant components of this line; when the Ct values ​​of the target sequences of two or more soybean lines are all less than 35, the sample to be tested is determined to be a mixed sample of the multiple soybean lines or contains the transformant components of the multiple lines. When 35≤DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 transgenic soybean line target sequence Ct value≤40, the soybean sample to be tested is retested. When the line-specific gene Ct value obtained by the retesting is ≥40, the soybean sample to be tested is judged to be not these four transgenic soybean lines or does not contain the transformant components of these four lines. When any Ct value of the target sequence of the four soybean lines obtained by the retesting is ≤35, the soybean sample to be tested is judged to be this soybean line or contain the transformant components of this line.

[0084] As a further improvement of the method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR of the present invention:

[0085] The 25 μL quadruple real-time fluorescence PCR amplification system is as follows: detection primer and probe concentrations are 0.1-0.8 μM, 12.5 μL SuperRealPreMix (Probe) (2×, Tiangen, product number FP206), 0.4 μL Passive Reference Dye (50×), 1 pg-100 ng genomic DNA; ddH2O is added to 25 μL.

[0086] As a further improvement of the method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR of the present invention:

[0087] The 25 μL quadruple real-time fluorescence PCR amplification system is:

[0088] Table 1 Primer and probe combinations for quadruple real-time fluorescence PCR reaction of transgenic soybean lines

[0089]

[0090]

[0091] As a further improvement of the method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR of the present invention:

[0092] The conditions for quadruple real-time fluorescence PCR amplification were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, for a total of 40 cycles.

[0093] In the present invention, DNA extraction quality control is set to ensure that the nucleic acid sample preparation process is effective and does not interfere with downstream experiments; three replicate wells and non-template blank controls are also set (three replicates are set to ensure reliable and accurate data, and non-template controls are set to avoid false negative results). Experimental results using QuantStudio TM Design&Analysis software is used for analysis and processing.

[0094] As a further improvement of the method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR of the present invention:

[0095] The extraction of genomic DNA from the soybean sample to be tested in step ③ is as follows:

[0096] Soybeans (i.e., unprocessed soybean fruits, seeds, leaves, soybean powder, etc.) are extracted using the CTAB method, SDS method, high salt and low pH method, or kit method; the kits can use six plant DNA extraction kits, including Beijing Quanshijin (EE111), Tiangen (DP305), Baimai (NEP023), Hangzhou Biori (BSC13), Qiagen (69104), and Koning (F1612);

[0097] Soybean products (i.e. soybean deep-processed products, including tofu, dried tofu, etc.) were extracted using the Tiangen Deep-Processed Products Extraction Kit (DP326) and the German Congen SureFood PREP Plant X (S1006) kit.

[0098] In the present invention, the DNA concentration and purity are detected by ND-2000C nucleic acid protein analyzer.

[0099] The present invention belongs to a quadruple real-time fluorescence PCR transgenic soybean line rapid identification technology. The present invention designs 5 sets of amplification primers and 5 fluorescent probes with different labels for the soybean endogenous gene Lectin and four national key monitored transgenic soybean lines. That is, the present invention sets specific amplification sites of DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423.

[0100] During the design process of the present invention, the transgenic database of the International Service for the Acquisition of Agri-biotech Applications was obtained.

[0101] http: / / www.isaaa.org / gmapprovaldatabase / default.asp, collected information on the currently publicly reported commercially produced GM soybean lines and the GM soybean lines approved for import into my country for production of raw materials. Comparative analysis found that these four GM soybeans are relatively common and are key soybean lines under port supervision. Among them, DAS-44406-6 and DP 305423 were approved by my country for processing and feed in 2018 and 2011 respectively; DAS-68416-4 and DAS-81419-2 have not yet been approved to enter the Chinese market. Therefore, the present invention uses transgenic soybean DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 specific target sequences and soybean endogenous gene Lectin as target genes, sets the design principles of TaqMan probes and TaqMan-MGB probes, uses primer probe design software Primer Express 3.0 (Primer Express Software for Real-time PCR, Version 3.0) to design corresponding primers and probes, and entrusts Invitrogen to synthesize them.

[0102] It should be emphasized that: in the present invention, since the present invention is multiplex fluorescence quantification, firstly, the selection of probe labels is critical, and secondly, the probes designed by the software must be screened, and the probe signals of the four genes cannot interfere with each other. This requires considering that the four pairs of primers and the four probes cannot interfere with each other when designing the probes.

[0103] In the present invention, the probe 5' fluorescent dye labeling is determined according to the configuration of the real-time fluorescent PCR instrument used. The first detection channel detects DAS-81419-2, and the emission wavelength of its fluorescent dye is about 517nM; the second detection channel detects DAS-44406-6, and the emission wavelength of its fluorescent dye is about 551nM; the third detection channel detects DAS-68416-4, and the emission wavelength of its fluorescent dye is about 580nM; the fourth detection channel detects DP 305423, and the emission wavelength of its fluorescent dye is about 610nM. Taking ABIQuantStudio Q5 real-time fluorescent PCR instrument (Applied biosystem) as an example, the first to fourth detections are respectively labeled with FAM, VIC, TAMRA and ROX. The 3' quenching group of the probe can select ECLIPSE or BHQ, and VIC and TAMRA fluorescent probes use MGB as the 3' quenching group.

[0104] The primers and probes designed by the present invention are less likely to form primer dimers through BLAST detection, and are more specific through experiments and have no cross signal interference in the same reaction tube.

[0105] The present invention develops and establishes a quadruple fluorescence quantitative PCR detection technology through the processes of target gene screening, transgenic positive sample collection, nucleic acid sample preparation, multiple primer and fluorescent probe combination screening, reaction system optimization and sample suitability testing.

[0106] In summary, the present invention belongs to a multiplex fluorescence quantitative PCR detection technology, which utilizes the high-throughput detection characteristics of the technology to simultaneously detect specific target sequences of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 and the soybean endogenous gene Lectin, and establishes a complete set of suitable primers and probes, nucleic acid extraction and multiplex amplification and analysis methods to perform multiplex rapid identification of transgenic soybean lines (including deep-processed foods). Compared with the prior art, the advantages of the present invention are: it can meet the actual need of one tube for multiple tests, that is, the use of this technology can realize the simultaneous detection of specific gene sequences of four soybean varieties, DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423, in one reaction tube, thereby reducing reagent costs and shortening detection time; endogenous gene detection is set in the multiple amplification system, which can judge the effectiveness of nucleic acid extraction and amplification reactions and avoid false negative reaction results; the present invention provides a reference method for key monitoring of the import trade, market circulation and field planting behavior of four genetically modified soybeans, and provides technical support for the safety supervision of genetically modified soybeans.

[0107] The present invention belongs to a multiplex real-time fluorescence PCR detection technology, and utilizes the high-throughput detection characteristics of the technology to achieve rapid, efficient and accurate identification of strains of soybean samples to be tested. BRIEF DESCRIPTION OF THE DRAWINGS

[0108] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0109] Figure 1 Mixed samples of DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423 GM soybeans;

[0110] Figure 2 DP305423 genetically modified soybean sample;

[0111] Figure 3 DAS-81419-2 genetically modified soybean sample;

[0112] Figure 4DAS-68416-4 genetically modified soybean sample;

[0113] Figure 5 DAS-44406-6 genetically modified soybean sample;

[0114] Figure 6 Zhonghuang 37 non-GMO soybean sample;

[0115] Figure 7 DP356043 / Roundup Ready Soya / MON 87708 / MON 89788 genetically modified soybean mixed sample;

[0116] Figure 8 Mixed samples of transgenic corn labeled MIR604 / MIR162 / Mon89034 / Bt11 / 98140 / GA21 / DAS-40278-9;

[0117] Fig. 9 Standard curve of multiplex fluorescence PCR reaction of DAS-68416-4, DAS-44406-6, DAS-81419-2 and DP 305423 genes in mixed samples. DETAILED DESCRIPTION

[0118] Example 1

[0119] 1.1 Sample collection

[0120] DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423, Roundup-ready, DP356043 transgenic soybean line standards, MON810, Bt11, MON89034, MIR162, MIR604, GA21, DAS-40278-9, 98140, Bt-176, NK603 transgenic corn line standards are all European Bureau of Standards standard materials, which can be provided by relevant units or purchased from Shenzhen Anlaier Technology Co., Ltd.; MON 87708, MON 89788 transgenic soybeans are donated by Jilin Customs; ACAS-T067-J273 / J213, CNAS T025-24 / 30, CNAS T0659-23 / 74 / 79 / 104 / 175 are all samples of the China National Accreditation Service for Conformity Assessment (CNAS) proficiency testing. Zhonghuang 37, Zhonghuang 13, Hedou 23 and other non-GMO soybean seeds.

[0121] 1.2 Genomic DNA extraction

[0122] Use Plant genomic DNA extraction kit and The PREP Advanced kit was used to extract genomic DNA from soybean samples to be tested (soybean tissue samples, deep-processed products). The operation was carried out according to the instructions of the kit. The tissue samples were fully broken up by grinding with liquid nitrogen or homogenizer. The lysis time of deep-processed products was appropriately increased, and the centrifugal column method was used for DNA separation and purification. In order to reduce interference in downstream experiments, sterile distilled water was used for elution, and the resulting eluate was named the elution buffer for DNA extraction. In order to increase the yield, the eluted DNA solution was eluted again through the column. The obtained DNA samples were tested by Nano-800 nucleic acid protein analyzer, and the purity of the DNA was evaluated by the OD260 / OD280 and OD260 / OD230 values, and the extraction yield was evaluated by the concentration and eluate volume.

[0123] When OD260 / 280 is greater than 1.5 and OD260 / 230 is greater than 1.0, it means that the extraction effect is good and can be used for subsequent detection.

[0124] Specifically, the extraction of genomic DNA from the soybean sample to be tested is as follows:

[0125] Soybeans (i.e. soybean tissue samples such as unprocessed soybean fruits, seeds, leaves, soybean meal, etc.) are extracted using the CTAB method, SDS method, high salt and low pH method, or kit method; the kits can use six plant DNA extraction kits, including Beijing Quanshijin (EE111), Tiangen (DP305), Baimai (NEP023), Beijing Dingguo (NEP003), Qiagen (69104), and Koning (F1612);

[0126] Soybean products (i.e. soybean deep-processed products, including tofu, dried tofu, etc.) were extracted using the Tiangen Deep-Processed Products Extraction Kit (DP326) and the German Congen SureFood PREP Plant X (S1006) kit.

[0127] 1.3 Target screening

[0128] According to the USDA Animal and Plant Health Inspection Service (https: / / www.aphis.usda.gov / aphis / ourfocus / biotechnology / regulatory-processes / petitions / petition-status / petitions-table), the Canadian Food Inspection Agency (Canadian Food Inspection Agency) According to the search results of the International Service for the Acquisition of Agri-biotech Applications (ISAAA, https: / / www.isaaa.org / gmapprovaldatabase / default.asp), transgenic soybean DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 and other transgenic lines that are key monitored in my country's import trade were selected as research objects, and their NCBI accession numbers are JB090926.1, AJ878608.1, LF644865.1, KP784700.1, respectively. The soybean endogenous gene Lectin (soybean lectin gene) was selected as the internal reference gene, and the research results of the research group of the present invention were used to explore the establishment of a rapid identification system for transgenic soybean lines.

[0129] 1.4 Primer and probe design

[0130] The target sequence is the junction region sequence between the 3' end or 5' end of the exogenous insertion vector and the soybean genome in the genome of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423. The target gene is sequenced by NCBI BLAST, and Primer Express 3.0.1 is used for primer and probe analysis to design multiple sets of primers and fluorescent probes. According to the equipment channel conditions, the 5' end of the probe is fluorescently labeled, and the 3' end is non-fluorescent quenching labeled, and the probe is commissioned to be synthesized by a company. The detection primers and fluorescent probes of the target DNA sequence designed by the present invention are shown in Table 1.

[0131] Table 1 Primer and probe sequences for specific detection of transgenic soybean lines

[0132]

[0133] 1.5 Quadruple fluorescence PCR reaction

[0134] A quadruple real-time fluorescence PCR reaction system was established: the genomic DNA of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 were mixed at a ratio of 1:1:1:1 (mass ratio) as a template for the quadruple real-time fluorescence PCR reaction. Four pairs of primers and probes of target genes (final concentration of 0.05-0.3 μmol / L), 10 μL of SuperRealPreMix (Probe) (2×, Tiangen, product number FP206), 0.4 μL of PassiveRefereence Dye (50×), and 100 ng of DNA template were added simultaneously into a PCR reaction tube (20 μL system).

[0135] The soybean endogenous gene Lectin was set as extraction quality control (single-plex real-time fluorescence PCR was set), and sterile distilled water was used as blank control.

[0136] Reaction conditions optimization: The system was optimized based on the nonspecific interference of the blank control and the strength of the fluorescence signal value, and the annealing temperature gradient of 55°C to 65°C and the final concentration gradient of primers and probes of 0.025 μmol / L to 0.6 μmol / L were set to screen the best reaction system. The best reaction system obtained is specifically described in Example 2 below.

[0137] Example 2: A method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR:

[0138] Four transgenic soybean lines (lines of concern for transgenic food safety supervision), DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP 305423, were selected as target genes; and corresponding primers and probes required for quadruple real-time fluorescence PCR amplification were designed for the above four genes, as described in Table 1 above.

[0139] Then follow these steps in sequence:

[0140] 1) The genomic DNA of the sample to be tested was extracted according to step 1.2 of Example 1.

[0141] 2) Setting up the quadruple real-time fluorescence PCR amplification system;

[0142] The 25 μL quadruple real-time fluorescence PCR amplification system is as follows: the detection primers and probe concentrations are as described in Table 1 for “quadruple real-time fluorescence PCR”, 12.5 μL SuperRealPreMix (Probe) (2×, Tiangen, Product No. FP206), 0.4 μL PassiveRefereence Dye (50×), genomic DNA 1 pg~100 ng; ddH2O is added to 25 μL.

[0143] The conditions for quadruple real-time fluorescence PCR amplification were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, for a total of 40 cycles.

[0144] 3) Single-plex real-time fluorescence PCR:

[0145] The 25 μL single-plex real-time fluorescence PCR amplification system is as follows: the detection primer and probe concentrations are changed to the “single-plex real-time fluorescence PCR” as described in Table 1, and the rest is equivalent to the quadruple real-time fluorescence PCR amplification system;

[0146] The conditions for singleplex real-time fluorescence PCR amplification were equivalent to those for quadruplex real-time fluorescence PCR amplification.

[0147] Table 2 Primer and probe combinations for quadruple real-time fluorescence PCR reaction of transgenic soybean lines

[0148]

[0149]

[0150] Note: You can set up corresponding blank controls.

[0151] 4) Determine whether the tested soybean transgenic strain contains a certain strain transformant component:

[0152] The quadruple real-time fluorescence PCR amplification system is located in one reaction tube, and the single real-time fluorescence PCR amplification system is located in another reaction tube; PCR amplification is performed simultaneously;

[0153] According to the specific S curve in the quadruple real-time fluorescent PCR reaction and the corresponding threshold value, the strain of the soybean sample to be tested or whether it contains a transformant component of a certain strain is determined; the following steps are performed in sequence:

[0154] 4.1) Obtain the Ct value of the endogenous gene Lectin;

[0155] When the endogenous gene Lectin Ct value corresponding to the single-plex real-time fluorescence PCR amplification system is less than 35, it indicates that the sample genomic DNA extraction is effective (that is, there is no or little inhibitor interference in the PCR system, and the amplification reaction is normal), then proceed to the following step 5.2); otherwise, the detection is judged to be invalid;

[0156] 4.2) For strain-specific genes:

[0157] At the same time, FAM, VIC, TAMRA, and CY5 channels were used to amplify the target sequences of transgenic soybean DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423, respectively;

[0158] The specific criteria are as follows:

[0159] 1. When no S curve is generated for the four target sequences of DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be a non-DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line or does not contain transformant components of these four lines;

[0160] When the Ct value of the DAS-68416-4 specific gene sequence is less than 35, and no S curve is generated for the DAS-44406-6, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-68416-4 line or contains the transformant components of this line;

[0161] When the Ct value of the DAS-44406-6 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-44406-6 line or contains the transformant components of this line;

[0162] When the Ct value of the DAS-81419-2 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-81419-2 line or contains the transformant components of this line;

[0163] When the Ct value of the DP305423 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DAS-81419-2 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DP305423 line or contains the transformant component of this line;

[0164] When the Ct values ​​of the target sequences of two or more soybean lines are all <35, the sample to be tested is determined to be a mixed sample of multiple soybean lines corresponding to the Ct values ​​of the target sequences <35 or a transformant component containing multiple lines;

[0165] 2. When 35≤DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line target sequence Ct value≤40, the soybean sample to be tested shall be retested and the determination method shall be the same as above.

[0166] Example 3, primer specificity verification:

[0167] According to the method described in Example 2, the genomic DNA of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 was used as the target template, the genomic DNA of transgenic soybeans DP356043, Roundup Ready Soya, MON87708, and MON 89788 was used as the non-target template, and the genomic DNA of transgenic negative soybean Zhonghuang 37 was used as the negative control template. The corresponding fluorescent probe and primer combinations were used, and the reaction system was amplified according to the instructions of the Taqman real-time fluorescent PCR kit to test the specificity of the primer probe.

[0168] The details are as follows:

[0169] In one reaction tube, FAM, VIC, TAMRA, and CY5 channels were used simultaneously to amplify the target sequences of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423, respectively. Non-target controls, transgenic negative controls, and blank controls were set up to perform multiple identifications on known single transformant DNA or mixed DNA of multiple transformants to confirm that there was no cross-interference during the amplification of each target sequence, thereby verifying the specificity of the method.

[0170] illustrate:

[0171] Target: DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423 GM soybean mixed sample and individual samples of DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423;

[0172] Non-target control: using transgenic soybean DP356043, Roundup Ready Soya, MON 87708, MON89788, etc. as templates or using transgenic MIR604 / MIR162 / Mon89034 / Bt1 / 98140 / GA21 / DAS-40278-9 as templates;

[0173] The GM negative control was non-GM soybean, i.e., Zhonghuang 37 was used as the template;

[0174] The blank control is a non-template control, that is, sterile distilled water is used as the template.

[0175] The result is:

[0176] In the reaction tube of the DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423 transgenic soybean mixed sample, amplification signals of four target genes were obtained simultaneously, indicating that the transformant components of these four soybean lines were detected in the mixed sample (see Figure 1 ); In the four single-line standard samples of transgenic soybean DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423, there is an exponentially growing fluorescence signal only in the corresponding probe channel (see Figure 2-5 ); The fluorescent signal of soybean endogenous gene Lectin can be detected in the reaction tubes using the above mixed DNA samples as templates and the single line standard DNA as templates.

[0177] In the reaction tubes using non-target transgenic soybeans such as DP356043 / Roundup Ready Soya / MON 87708 / MON 89788 and non-transgenic soybeans such as Zhonghuang 37 as templates, no exponential growth amplification signal of the target gene was obtained (see Figure 6-7 ), only the relatively stable exponential fluorescence signal of soybean endogenous gene Lectin was detected.

[0178] In the reaction tubes using non-target transgenic corn such as MIR604 / MIR162 / Mon89034 / Bt11 / 98140 / GA21 / DAS-40278-9 as templates, no exponential growth amplification signals of the target gene and endogenous gene Lectin were obtained (see Figure 8 ).

[0179] There was no fluorescent signal in the reaction tube with sterile distilled water as blank control.

[0180] The above results indicate that there is no cross-interference between the amplification signals of the target genes in the multiplex fluorescence PCR detection system, indicating that the designed primer probes are strain-specific, that is, the method has high specificity.

[0181] Example 4, sensitivity detection

[0182] The genomic DNA of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 were diluted to 20 ng / μL, respectively, and prepared into mixed DNA templates according to a ratio of 1:1:1:1 (mass ratio). The elution buffer during DNA extraction was used to dilute 5 gradients at a concentration of 10 times. Since the molecular weight of the haploid genome of soybeans is about 1.15 pg, the mixed DNA templates of each reaction after dilution are 8850, 885, 88.5, 8.85, and 0.885 copies, respectively. The mixed DNA templates of the 5 gradients were multiplexed according to the method described in Example 2, and three replicates were set for each gradient to verify the sensitivity of the method. The minimum detection limit (LOD) was determined by the number of mixed DNA target copies corresponding to the critical value of the fluorescence signal.

[0183] The genomic DNA of transgenic soybeans DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 were mixed in a 1:1:1:1 ratio and serially diluted 10-fold. Each reaction contained 8850, 885, 88.5, 8.85, and 0.885 copies of the mixed DNA template, respectively. The gradient was set in the standard mode on a fluorescent PCR instrument and amplified using the established quadruple reaction system. The standard curve is shown in Fig. 9 The linear regression equations of the four target sequences DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 were y=-3.1524x+36.958, y=-3.1689x+38.828, y=-3.469x+37.933, and y=-3.4839x+39.644, respectively; the Ct values ​​ranged from 24.45 to 37.78, 2 The standard deviations of the three repeatability tests of the four targets of DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 were between 0.053 and 0.193, 0.076 and 0.491, 0.020 and 0.346, and 0.148 and 0.353, respectively; the correlation coefficient R 2 The results showed that the minimum detection limit of the quadruple reaction system can reach 9 copies, and the established quadruple real-time fluorescence PCR amplification system has good repeatability and high sensitivity.

[0184] Table 3 Amplification data of soybean transgenic quadruple real-time fluorescence PCR sensitivity detection

[0185]

[0186] Note: The theoretical copy number is 8850, that is, the concentration in a 25 μl reaction system is 20 ng / μL.

[0187] Comparative experiment 1: Changing the annealing temperature of multiplex real-time fluorescence PCR reactions

[0188] The annealing temperature of the quadruple real-time fluorescence PCR amplification conditions was lowered from 62°C to 52°C, and the rest was referred to Example 2. The specific detection results were as follows: in the reaction tube of the quadruple real-time fluorescence PCR, due to the low annealing temperature, the two genes DAS-44406-6 labeled by VIC and DAS-68416-4 labeled by TAMRA showed fluorescence signal interference and primer dimers appeared, resulting in: fluorescence signal appeared in the blank control tube of the transgenic soybean DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423 quadruple real-time fluorescence PCR, and the Ct value was 33, which was inconsistent with the actual detection result.

[0189] Comparative experiment 2: Changing the probe concentration of DP305423 in the quadruple reaction:

[0190] 1. The probe concentration of DP305423 in the quadruple real-time fluorescence PCR amplification system was increased from the original 0.24 μmol / L to 0.48 μmol / L, and the rest was referred to Example 2. The specific detection results were as follows: an amplification curve appeared in the blank control tube of the DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423 quadruple real-time fluorescence PCR system, indicating that an excess of DP305423 probe led to nonspecific amplification, and a signal of primer dimer amplification appeared in the blank control, with a Ct value of 34, which was inconsistent with the result that the blank control had no fluorescence signal.

[0191] Second, the final concentration of the DP305423 probe in the quadruple fluorescent PCR reaction was reduced from the original 0.24 μmol / L to 0.12 μmol / L. The rest was referred to Example 2. The specific detection results were: the DP305423 gene fragment could not be amplified in the mixed sample DNA of the genetically modified soybean "DP305423" and the genetically modified soybean DAS-68416-4 / DAS-44406-6 / DAS-81419-2 / DP305423. The fact that the fragment was not detected was inconsistent with the actual detection results.

[0192] Comparative experiment 3: Changing the primer and probe sequences of the DAS-68416-4 transformant-specific gene sequence

[0193] The primer and probe sequences of the DAS-68416-4 gene fragment in the quadruple real-time fluorescence PCR amplification system were redesigned as follows:

[0194] FP: CCGCTACTTGCTCTTGTCGTAA, RP: TTTCAAACTATTCGGGCCTAACTT, probe: AAATCATTCAAGCACCAGTCAGCATCATCA, the amplification product length is 145 bp, and the rest is referred to Example 2, and the specific detection results are: all experimental groups containing "DAS-68416-4 samples" can not obtain the amplification signal of the DAS-68416-4 gene fragment in the final reaction of the quadruple PCR reaction tube, and the Ct value is greater than 40. This shows that the designed primers and probes of the DAS-68416-4 gene fragment cannot achieve the amplification effect, and the DAS-68416-4 gene fragment cannot be detected.

[0195] Comparative experiment 4: changing the primer and probe sequences of the specific gene sequence of DAS-44406-6 transformant

[0196] 1. The primers and probe sequences of the DAS-44406-6 gene fragment in the quadruple real-time fluorescence PCR amplification system were redesigned as follows: FP: CGTACAATATTACTCACCGGATCCT, RP: TTGGTTTGGTTCGAATTTGTTTT, probe: TCATGGGCCGCGATTAAAAATCTCAATTA, the amplification product length was 119 bp, and the rest was referred to Example 2. The specific detection results were as follows: all experimental groups containing "DAS-44406-6 samples" were finally reacted in the quadruple PCR reaction tube to obtain no amplification signal of the DAS-44406-6 gene fragment, and the Ct value was greater than 40. This indicates that the designed primers and probes of the DAS-44406-6 gene fragment cannot achieve the amplification effect, and the DAS-44406-6 gene fragment cannot be detected.

[0197] 2. The primers and probe sequences of the DAS-44406-6 gene fragment in the quadruple real-time fluorescence PCR amplification system were redesigned as follows: FP: TCGCTCTTAGCCGTACAATATTACTC, RP: AATCGCGGCCCATGATC, probe: CCGGATCCTAACCGG, the amplification product length was 62 bp, and the rest was referred to Example 2. The specific detection results were as follows: fluorescent signals were also amplified in the reaction tubes of all experimental groups that did not contain the "DAS-44406-6 sample", indicating that non-specific amplification occurred, indicating that the designed primers and probes for the DAS-44406-6 gene fragment did not achieve a specific effect.

[0198] Comparative experiment 5: changing the primer and probe sequences of the specific gene sequence of DAS-81419-2 transformant

[0199] The primer and probe sequences of the DAS-81419-2 gene fragment in the quadruple real-time fluorescence PCR amplification system were redesigned as follows: FP: GCATCGGTGCCTGTTGATC, RP: TGAGCGGAACTTGCTTCAAGA, probe: CGCGCAAGTTGGG, the amplification product length was 55 bp, and the rest was referred to Example 2, and the specific detection results were: all experimental groups containing "DAS-81419-2 samples" were finally reacted in the quadruple PCR reaction tube to obtain no amplification signal of the DAS-81419-2 gene fragment, and the Ct value was greater than 40. This indicates that the designed primers and probes of the DAS-81419-2 gene fragment cannot achieve the amplification effect, and the DAS-81419-2 gene fragment cannot be detected.

[0200] Comparative experiment 6: changing the primer and probe sequences of the specific gene sequence of the DP305423 transformant

[0201] The primer and probe sequences of the DP305423 gene fragment in the quadruple real-time fluorescence PCR amplification system were redesigned as follows: FP: CGTCAGGAATAAAGGAAGTACAGTAGAA, RP: AACACTAGCTAGCCAAAAA GAGAACA, probe: AGGTACTCTTTTTATATATACCC, and the amplification product length was 83 bp. The rest was referred to Example 2. The specific detection results were as follows: all experimental groups containing "DP305423 samples" were finally reacted in the quadruple PCR reaction tube to obtain no amplification signal of the DP305423 gene fragment, the Ct value was 39, and the amplification length was 25-30 bp after agarose gel electrophoresis analysis, which was a non-specific amplification product. This indicated that the designed primers and probes of the DP305423 gene fragment could not achieve the amplification effect, and the DP305423 gene fragment could not be detected.

[0202] Example 5: Daily sample suitability test

[0203] The proficiency test samples of 8 different genetically modified soybean lines, including Roundup-ready, 356043, 305423, DAS-68416-4, DAS-44406-6, DAS-81419-2, MON-87708, and MON 89788, 10 genetically modified corn lines, including Bt-176, MIR162, NK603, DAS-40278-9, 98140, GA21, MON89034, MIR604, MON810, and Bt11, 7 genetically modified soybean proficiency test samples, including CNAS T025-24 / 30, CNAS T0659-23 / 74 / 79 / 104 / 175, ACAS-T067-J273 / J213, FAPAS GeMSU The applicability test was conducted on 4 transgenic corn proficiency verification samples, including 56A / 56B, and 3 non-transgenic soybean samples, including Zhonghuang 37, Zhonghuang 13, and Hedou 23, to verify the consistency of the quadruple real-time fluorescence PCR amplification results with the expected values. On this basis, other testers were commissioned to prepare 24 blind samples using the double-blind verification method, and the quadruple real-time fluorescence PCR system was used for blind sample testing to verify the applicability of the system.

[0204] That is, the established quadruple real-time fluorescence PCR method was used to test 11 satisfactory GMO proficiency verification samples obtained by the laboratory in recent years, 18 GMO standard products that passed acceptance, and 3 commercially available non-GMO soybean samples. The test results were consistent with the single-plex reaction results in accordance with the standard "SN / T1204-2016 Real-time Fluorescence PCR Qualitative Test Method for Genetically Modified Components in Plants and Their Processed Products" (results are shown in Table 4), but the detection of four target genes can be completed simultaneously in the same reaction tube, which can simplify the operation process and reduce costs when strictly controlling the GMO positive control, negative control, and blank control and detecting multiple samples to be tested.

[0205] In addition, 24 blind samples were tested and analyzed using the established quadruple real-time fluorescence PCR method, and the test results were consistent with the given information of the blind samples (results in Table 5), indicating that the established quadruple system can be applied to the rapid screening of transgenic soybean DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 lines and their related transformant components, especially the rapid identification of a large number of samples in a short period of time.

[0206] Table 4 Quadruple fluorescence quantitative PCR suitability test results

[0207]

[0208]

[0209]

[0210] Table 5 Results of quadruple fluorescence quantitative PCR blind sample detection

[0211]

[0212]

[0213]

[0214] Notes:

[0215] DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423, Roundup-ready, DP356043, MON 87708, MON 89788 are different strains of genetically modified soybeans; MON810, Bt11, MON89034, MIR162, MIR604, GA21, DAS-40278-9, 98140, Bt-176, NK603 are different strains of genetically modified corn; ACAS-T067-J273 / J213, CNAS T025-24 / 30, CNAS T0659-23 / 74 / 79 / 104 / 175 are all proficiency testing samples of the China National Accreditation Service for Conformity Assessment (CNAS). Zhonghuang 37, Zhonghuang 13, Hedou 23 and other soybeans are commercially available and have been tested and confirmed to be non-GMO soybeans.

[0216] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Primers and probes for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR, characterized in that: The amplification primers and probes for the transgenic soybean line DAS-68416-4 are: DAS-68416-4-F:CAGTCAGCATCATCACACCAAA DAS-68416-4-R:GACCTCAATTGCGAGCTTTCTAA DAS-68416-4-P: TAMRA-TTAGGCCCGAATAGTTT-MGB; The amplification primers and probes for the transgenic soybean line DAS-44406-6 are: DAS-44406-6-F: CAAATTCGCTCTTAGCCGTACA DAS-44406-6-R:AATCGCGGCCCATGATC DAS-44406-6-P: VIC-TATTACTCACCGGATCCTA-MGB; The amplification primers and probes for the transgenic soybean line DAS-81419-2 are: DAS-81419-2-F: GCTAATGCTACAGCACTTATTCGTACTT DAS-81419-2-R:TTGCCGGGATCAACAG DAS-81419-2-P: FAM-CTCTATGAAATAACCACTTGCGCATCGGTG-BHQ1; The amplification primers and probes for transgenic soybean line DP 305423 are: DP 305423-F:GGAATAAAGGAAGTACAGTAGAATTTAAAGG DP 305423-R:GAGAAAAAAACACTAGCTAGCCAAAAA DP 305423-P:ROX-ACTCTTTTTATATATACCCGTGTTC-BHQ3.

2. A method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR, characterized in that: The steps include: 1) Screening and determination of target genes Four transgenic soybean lines, DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP 305423, were selected as target genes; 2) Design primers and probes required for quadruple real-time fluorescence PCR amplification; 3) Extraction of genomic DNA from soybean samples to be tested; 4) Setting up quadruple real-time fluorescence PCR amplification system; 5) Determine whether the soybean transgenic strain to be tested contains a transformant component of a certain strain.

3. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to claim 2, characterized in that: The step 5) determines whether the tested soybean transgenic strain contains a certain strain transformant component: determines whether the tested soybean sample strain contains a certain strain transformant component according to the specific S curve in the quadruple real-time fluorescent PCR reaction and the corresponding threshold value.

4. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to claim 3, characterized in that The step 5) comprises: 5.2) For strain-specific genes:

1. When no S curve is generated for the four target sequences of DAS-68416-4, DAS-44406-6, DAS-81419-2, and DP305423 or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be a non-DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line or does not contain transformant components of these four lines; When the Ct value of the DAS-68416-4 specific gene sequence is less than 35, and no S curve is generated for the DAS-44406-6, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-68416-4 line or contains the transformant components of this line; When the Ct value of the DAS-44406-6 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-81419-2, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DAS-44406-6 line or contains the transformant components of this line; When the Ct value of the DAS-81419-2 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DP305423 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the transgenic soybean DAS-81419-2 line or contains the transformant components of this line; When the Ct value of the DP305423 specific gene sequence is less than 35, and no S curve is generated for the DAS-68416-4, DAS-44406-6, and DAS--81419-2 specific gene sequences or the Ct values ​​are all greater than 40, the soybean sample to be tested is determined to be the genetically modified soybean DP305423 line or contains the transformant components of this line; When the Ct values ​​of the target sequences of two or more soybean lines are all <35, the sample to be tested is determined to be a mixed sample of the multiple soybean lines or contains transformant components of the multiple lines; 2. When 35≤DAS-68416-4, DAS-44406-6, DAS-81419-2, DP305423 transgenic soybean line target sequence Ct value≤40, the soybean sample to be tested shall be retested and the determination method shall be the same as above.

5. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to any one of claims 2 to 4, characterized in that: In step 4), the 25 μL quadruple real-time fluorescence PCR amplification system is as follows: the detection primer and probe concentrations are 0.1-1 μM, respectively, SuperRealPreMix (Probe) 12.5 μL, 0.4 μL Passive Reference Dye (50×), genomic DNA 1 pg-100 ng; ddH2O is added to make up to 25 μL.

6. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to claim 5, characterized in that In a 25 μL quadruple real-time fluorescence PCR amplification system: Primer DAS-68416-4-F (10μmol / L)0.2μL PrimerDAS-68416-4-R(10μmol / L)0.2μL Probe DAS-68416-4(10μmol / L)0.4μL Primer DAS-44406-6-F (10μmol / L)0.2μL Primer DAS-44406-6-R(10μmol / L)0.2μL Probe DAS-44406-6 (10μmol / L)0.2μL Primer DAS-81419-2-F(10μmol / L)0.2μL Primer DAS-81419-2-R(10μmol / L)0.2μL Probe DAS-81419-2(10μmol / L)0.1μL Primer DP 305423-F(10μmol / L)0.3μL Primer DP 305423-R(10μmol / L)0.3μL Probe DP 305423 (10μmol / L) 0.6μL.

7. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to any one of claims 2 to 6, characterized in that: The conditions for quadruple real-time fluorescence PCR amplification were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, for a total of 40 cycles.

8. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to any one of claims 2 to 7, characterized in that: It also covers setting up singleplex real-time PCR: The 25 μL single-plex real-time fluorescence PCR amplification system is: Primer Lectin-F (10μmol / L) 0.2μL, Primer Lectin-R (10μmol / L) 0.2μL, ProbeLectin (10μmol / L) 0.2μL, SuperRealPreMix (Probe) 12.5μL, 0.4μLPassive ReferenceDye (50×), genomic DNA 1pg~100ng; add ddH2O to 25μL; The conditions for single-plex real-time fluorescence PCR amplification were equivalent to those for quadruple-plex real-time fluorescence PCR amplification; The step 5) includes 5.1) and 5.2): 5.1) Obtain the Ct value of the endogenous gene Lectin; When the endogenous gene Lectin Ct value is less than 35, it indicates that the sample genomic DNA extraction is effective, and then proceed to the following step 5.2) for strain-specific genes; Otherwise, the detection is deemed invalid.

9. The method for rapid identification of transgenic soybean lines using quadruple real-time fluorescent PCR according to any one of claims 2 to 8, characterized in that: The extraction of genomic DNA from the soybean sample to be tested in step 3) is as follows: Soybean is extracted by CTAB method, SDS method, high salt and low pH method or kit method; the kit can be 6 plant DNA extraction kits including Beijing Quanshijin, Tiangen, Baimai, Hangzhou Biori, Qiagen and Koning; Soy products were extracted using the Tiangen Deep Processing Products Extraction Kit and the German Congen SureFood PREP Plant X Kit.

Images