Application of cepharanthine in preparation of antitumor drugs

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of cepharanthine in preparation of antitumor drugs. The technical problem to be solved by the invention is to provide a new choice for tumor treatment. The technical scheme of the invention is application of cepharanthine in preparation of antitumor drugs. The invention reveals that cepharanthine significantly inhibits the expression of CD47 on pancreatic cancer cells for the first time, further inhibits the growth of pancreatic cancer and enhances the anti-tumor effect, cepharanthine can be used as a new drug for preparing a CD47 immune checkpoint inhibitor for treating pancreatic cancer, and a new choice is provided for the treatment of pancreatic cancer.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to the application of cepharanthin in the preparation of anti-tumor drugs. Background Art

[0002] Pancreatic cancer is a common malignant disease of the digestive system, which mainly originates from pancreatic epithelial tissue. Among them, pancreatic ductal adenocarcinoma (PDAC) type accounts for 95%, which means that pancreatic ductal carcinoma is the main component of pancreatic cancer. Pancreatic cancer cells are characterized by strong invasiveness, metastasis and high proliferation rate (metastasis to peritoneum, lymph nodes, liver, etc.). These characteristics give the pancreatic cancer tumor microenvironment a special role and play a key role in the process of pancreatic cancer metastasis. Related to the characteristics of pancreatic cancer cells, pancreatic cancer symptoms are not obvious and progress rapidly, early diagnosis is very difficult, and is accompanied by poor prognosis and high mortality. In 2022, the number of new and fatal cases of pancreatic cancer in China ranked first in the world. The 5-year survival rate of pancreatic cancer is generally low, usually between 5% and 10%. The treatment of pancreatic cancer is a complex and multifaceted process involving multiple therapeutic methods. Immunotherapy provides new treatment hope for pancreatic cancer patients. In-depth innovative research on immune checkpoints and traditional Chinese medicine monomers is expected to develop more effective treatment options.

[0003] CD47 is also known as integrin-associated protein, with a molecular weight of approximately 45 kDa. Studies have shown that CD47 is highly expressed in various types of malignant tumors, including colorectal cancer, gastric cancer, hepatocellular carcinoma, and pancreatic cancer. As an immune checkpoint molecule, CD47 plays an important role in multiple biological processes such as cell signaling and cell survival. Cancer cells highly express CD47 and use its "don't eat me" signal to escape recognition and clearance by the immune system, suggesting that CD47 can be used as a new target for cancer immunotherapy. Studies have found that CD47 downstream signaling pathways can regulate many immune cell functions, including macrophage-mediated phagocytosis, neutrophil migration, and activation of dendritic cells, T cells, and B cells. TAMs show different polarization states between M1 macrophages with an anti-tumor phenotype and M2 macrophages with a pro-tumor and immunosuppressive phenotype. In general, in tumor immunology, the expression and regulatory mechanisms of CD47 provide new ideas and methods for tumor treatment. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a new option for tumor treatment.

[0005] The technical solution of the present invention is the application of cepharanthin in the preparation of anti-tumor drugs.

[0006] Specifically, the tumor is pancreatic cancer.

[0007] The present invention also provides the use of cephalaenopsis in preparing CD47 inhibitors.

[0008] Furthermore, the CD47 is CD47 in pancreatic cancer cells.

[0009] The present invention also provides the use of cephalothin in preparing a medicine for enhancing the phagocytic ability of macrophages.

[0010] The present invention also provides the use of cephalaenopsis in preparing a drug for inhibiting the polarization of macrophages to M2 type.

[0011] The present invention also provides an anti-tumor drug, comprising cepharanthin.

[0012] Specifically, the tumor is pancreatic cancer.

[0013] The present invention also provides a CD47 inhibitor, including cephalaenopsis indica.

[0014] Furthermore, the CD47 is CD47 in pancreatic cancer cells.

[0015] The present invention also provides a drug for enhancing the phagocytic ability of macrophages, comprising cephalothin.

[0016] The present invention also provides a drug for inhibiting macrophage polarization to M2 type, comprising cepharanthin.

[0017] Furthermore, the above-mentioned medicine also includes pharmaceutically acceptable excipients.

[0018] Beneficial effects of the present invention: The present invention reveals for the first time that cephalothin significantly inhibits the expression of CD47 on pancreatic cancer cells, thereby inhibiting the growth of pancreatic cancer and enhancing the anti-tumor effect. Cephalothin can be used as a new drug for preparing CD47 immune checkpoint inhibitors for the treatment of pancreatic cancer, providing a new option for the treatment of pancreatic cancer. The present invention also confirms that: (1) cephalothin significantly inhibits the proliferation of pancreatic cancer cells; CCK-8 and other technical means confirm that cephalothin inhibits the proliferation of pancreatic cancer cells at a certain concentration and has anti-pancreatic cancer efficacy; (2) cephalothin significantly inhibits the expression of CD47 on pancreatic cancer cells; real-time fluorescence quantitative PCR, Western Blotting and flow cytometry analysis and other technical means further confirm that cephalothin can reduce the expression of CD47 in pancreatic cancer cells at the mRNA and protein levels, which provides a new strategy for the development of pancreatic cancer therapeutic drugs targeting the CD47 immune checkpoint; (3) In vivo experiments show that cephalothin promotes CD4 in pancreatic cancer-bearing mice +T, CD8 + It can inhibit the infiltration of anti-tumor immune cells such as T and macrophages, inhibit regulatory T cells (cells that promote tumorigenesis), and enhance anti-tumor immunity overall. Cephalothin has the potential to develop drugs for the treatment of pancreatic cancer; (4) Cephalothin enhances the phagocytic ability of macrophages and inhibits their polarization to M2 type (macrophages that promote tumorigenesis); flow cytometry detection results show that Cephalothin enhances the phagocytic effect of macrophages on pancreatic cancer cells at a certain concentration, inhibits the polarization of macrophages to M2 type, and thus enhances the anti-tumor immune response. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of the cell counting kit (Cell Counting Kit-8, CCK-8), 5,6-carboxyfluorescein diacetate, succinimidyl ester (CFSE) and clone formation assay to detect the effect of cephalothin on the proliferation of mouse pancreatic cancer Panc02 cells. Among them, A, B and C are histograms of the effect of cephalothin on cell viability after 24 h, 48 h and 72 h of Panc02 cell treatment detected by CCK-8 assay, D and E are histograms and statistical graphs of the effect of cephalothin on the proliferation ability of Panc02 cells detected by CFSE assay, and F and G are statistical graphs of the effect of cephalothin on the colony formation ability of Panc02 cells detected by clone formation assay.

[0020] Figure 2 The results of CCK-8, CFSE and clone formation experiments to detect the effect of cephalaenoside on the proliferation of mouse pancreatic cancer Panc02 cells. Among them, A, B and C are histograms of the effect of cephalaenoside on cell viability after 24 h, 48 h and 72 h of treatment with Panc01 cells using CCK-8 experiments, D and E are histograms and statistical graphs of the effect of cephalaenoside on the proliferation ability of Panc01 cells using CFSE experiments, and F and G are statistical graphs of the effect of cephalaenoside on the colony formation ability of Panc01 cells using clone formation experiments.

[0021] Figure 3The results of flow cytometry, Western Blotting and real-time fluorescence quantitative PCR were used to detect the inhibitory effect of cephalothin on the protein and mRNA levels of CD47 in mouse pancreatic cancer Panc02 cells. A and B are the histogram and statistical graph of the average fluorescence intensity inhibitory effect of cephalothin on Panc02 cell CD47 detected by flow cytometry, C and D are the results of Western Blotting to detect the inhibitory effect of cephalothin on the protein level of Panc02 cell CD47, and E is a bar chart of the inhibitory effect of cephalothin on the mRNA level of Panc02 cell CD47 analyzed by real-time fluorescence quantitative PCR technology.

[0022] Figure 4 The results of flow cytometry, Western Blotting and real-time fluorescence quantitative PCR were used to detect the inhibitory effect of cephalothin on the protein and mRNA levels of CD47 in human pancreatic cancer Panc01 cells. A and B are the histogram and statistical graph of the average fluorescence intensity inhibitory effect of cephalothin on Panc01 cell CD47 detected by flow cytometry, C and D are the results of Western Blotting to detect the inhibitory effect of cephalothin on the protein level of CD47 in Panc01 cells, and E is a bar chart analyzing the inhibitory effect of cephalothin on the mRNA level of CD47 in Panc01 cells using real-time fluorescence quantitative PCR technology.

[0023] Figure 5 Flow cytometry was used to verify that cephalothin promoted the expression of CD4 + T, CD8 + The results of T and macrophage immune cell infiltration and inhibition of Treg cells. A and B are CD4 + Scatter plot and statistical graph of T cell ratio, C and D are CD8 + The scatter plots and statistical graphs of the proportion of T cells, E and F are the scatter plots and statistical graphs of the proportion of Treg cells in the spleen, and G and H are the scatter plots and statistical graphs of the proportion of macrophages in the spleen.

[0024] Figure 6 Flow cytometry was used to verify that cepharanthin promoted the expression of CD4 + T, CD8 + The results of T and macrophage immune cell infiltration and inhibition of Treg cells. A and B are CD4 + T cell ratio scatter plot and statistical graph, C and D are CD8 +The scatter plots and statistical graphs of the proportion of T cells, E and F are the scatter plots and statistical graphs of the proportion of Treg cells in tumors, and G and H are the scatter plots and statistical graphs of the proportion of macrophages in tumors.

[0025] Figure 7 Immunohistochemical detection of cepharanthin enhancing the expression of CD4 + T and CD8 + The results of T cell infiltration. A and C are the CD4 in tumor tissues of mice in the cephalothin treatment group and the control group, respectively. + T cell graph and statistical graph, B and D represent the CD8 in tumor tissues of mice in the cepharanthin treatment group and the control group, respectively. + T cell graphs and statistics.

[0026] Figure 8 The results of flow cytometry detection of celastrol enhances macrophage phagocytosis of tumor cells and inhibits their polarization to M2 type. Among them, A and B are the cell graphs and statistical graphs of the phagocytic ratio of Panc02 cells and macrophages co-cultured after celastrol treatment, C and D are the cell graphs and statistical graphs of the ratio of macrophages polarized to M1 type pro-inflammatory macrophages in the celastrol treatment group and the control group, and E and F are the cell graphs and statistical graphs of the ratio of macrophages polarized to M2 type pro-inflammatory macrophages in the celastrol treatment group and the control group, respectively. DETAILED DESCRIPTION

[0027] In recent years, with the continuous deepening of research on CD47, its potential role in the anti-tumor field, especially in the treatment of pancreatic cancer, has gradually attracted attention. In addition, Chinese medicine monomers act as or cooperate with immune checkpoint molecules to show potential in anti-tumor treatment. Chinese medicine monomers often have the characteristics of multiple targets and immunomodulation, which may improve the shortcomings of CD47 that are toxic to red blood cells and T lymphocytes. The cepharanthine (Cepharanthine, CEP) described in the present invention, also known as cepharanthine and cepharanthine, etc., is derived from the Menispermaceae plant Cepharanthine or Cepharanthine. Cepharanthine has antiviral, antiparasitic, antibacterial, bone resorption inhibition, anti-tumor and immunomodulatory properties. Cepharanthine achieves anti-tumor effects through multiple mechanisms, including inhibiting tumor cell proliferation, increasing the sensitivity of tumor cells to treatment, and inhibiting tumor cell metastasis. The chemical formula of cepharanthine is C 37 H 38 N 2 O 6, with a molecular weight of 606.707. The research on cephalothin in anti-pancreatic cancer is still insufficient, and its mechanism of action is not fully understood. Whether cephalothin can inhibit the growth of pancreatic cancer, and how to inhibit the immune escape and metastasis of pancreatic cancer cells by down-regulating the expression of CD47, thereby exerting its anti-tumor immunomodulatory effect has not yet been verified. The present invention will study the inhibitory effect of cephalothin on the growth of pancreatic cancer cells and its regulatory effect on the function of immune cells through a series of in vivo and in vitro experiments, so as to reveal the potential application value of cephalothin in the treatment of pancreatic cancer, and provide a new treatment method for pancreatic cancer patients.

[0028] The present invention is further described below in conjunction with the accompanying drawings and examples. If no specific techniques or conditions are specified in the examples, they are all carried out according to the common technical means or product instructions in the medical field. The contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0029] The cephalaenoside used in the following examples was purchased from Beijing Solebao Company; the pancreatic cancer tumor cell lines were mouse pancreatic cancer Panc02 cells and human pancreatic cancer Panc01 cells, purchased from Fuheng Biotechnology Company; other reagents were purchased from commercial sources.

[0030] Example 1 Study on the effect of cepharanthin on the proliferation of mouse pancreatic cancer Panc02 cells CCK-8, CFSE and clone formation assays to detect the effect of cephalaenoside on the proliferation of mouse pancreatic cancer Panc02 cells Experimental method: Mouse pancreatic cancer Panc02 cells were seeded into 96-well plates at a ratio of 1000 cells per well for CCK-8 experiments; and were seeded into 6-well plates at a ratio of 1000 cells per well for clonal formation experiments.

[0031] CCK-8 experiment: After overnight culture, the old culture medium was removed and 100 μL of complete culture medium containing different concentrations of cephalaenopsis (0, 25, 50, 75, 100, 125 and 150 nM) was inoculated into each well; after 24 h, 48 h and 72 h, 10 μL of CCK-8 solution was added to the 96-well plate and incubated for 2 h. After incubation, the optical density value in each well was measured, and the measurement wavelength was set to 450 nm to calculate the cell survival rate.

[0032] CFSE experiment: After digestion and resuspending, the collected cells were placed in a dilution solution containing 1× PBS and 5% fetal bovine serum. Next, the cells were mixed with a 5% fetal bovine serum solution containing CFSE and cultured in the dark. After incubation, the cells were washed by centrifugation and inoculated into a 6-well plate at a ratio of 1.3×105 cells per well. Complete medium with different concentrations of cephalothin (0, 100 and 150 nM) was added and cultured for 48 h. Finally, the washed cells were collected, and the CFSE fluorescence intensity was detected by flow cytometry to analyze the effect of cephalothin on cell labeling and activity.

[0033] Clone formation experiment: After the cells adhered to the wall, DMEM complete medium containing different concentrations of cephalaenopsis (0, 100 and 150 nM) was added to observe and wait for the formation of clones in the control group. After formation, the medium was discarded, the cells were washed with PBS buffer and fixed with 4% cell fixative, washed again and stained with crystal violet stain. Finally, the well plate was washed, the stained cells were imaged, the clone formation was recorded, and the number of clones was quantitatively analyzed using Image J software.

[0034] The experimental results are as follows Figure 1 As shown: The results of CCK-8, CFSE and clone formation experiments showed that after treatment with cephalothin, the viability of mouse pancreatic cancer Panc02 cells decreased, the fluorescence intensity of CFSE-labeled tumors increased, and the colony formation ability decreased. This directly proves that cephalothin significantly inhibits the proliferation of mouse pancreatic cancer Panc02 cells.

[0035] Example 2 Study on the effect of cepharanthin on the proliferation of human pancreatic cancer Panc01 cells Effects of cephalaenoside on proliferation of human pancreatic cancer Panc01 cells detected by CCK-8, CFSE and clone formation assays Experimental method: Human pancreatic cancer Panc01 cells were seeded into 96-well plates at a ratio of 1000 cells per well for CCK-8 experiments; and were seeded into 6-well plates at a ratio of 1000 cells per well for clone formation experiments.

[0036] CCK-8 experiment: After overnight culture, the old culture medium was removed and 100 μL of complete culture medium containing different concentrations of cephalaenopsis (0, 0.25, 0.5, 1, 2, 3 and 5 μM) was inoculated into each well; after 24 h, 48 h and 72 h, 10 μL of CCK-8 solution was added to the 96-well plate and incubated for 2 h. After incubation, the optical density value in each well was measured, the measurement wavelength was set to 450 nm, and the cell survival rate was calculated.

[0037] CFSE experiment: After digestion and resuspending, the collected cells were placed in a dilution solution containing 1× PBS and 5% fetal bovine serum. Next, the cells were mixed with a 5% fetal bovine serum solution containing CFSE and cultured in the dark. After incubation, the cells were washed by centrifugation and plated at 1.3×10 5 The cells were inoculated into 6-well plates at a ratio of 1:1 and 1:1, and different concentrations of cephalothin were added to complete medium (0, 3, and 5 μM) and cultured for 72 h. Finally, the cells were collected and washed, and the CFSE fluorescence intensity was detected by flow cytometry to analyze the effect of cephalothin on cell labeling and activity.

[0038] Clone formation experiment: After the cells adhered to the wall, DMEM complete medium containing different concentrations of cephalaenopsis (0, 3, and 5 μM) was added to observe and wait for the formation of clones in the control group. After formation, the medium was discarded, the cells were washed and fixed with PBS buffer, washed again and stained with crystal violet stain. Finally, the well plate was washed, the stained cells were imaged, the clone formation was recorded, and the number of clones was quantitatively analyzed using Image J software.

[0039] The experimental results are as follows Figure 2 As shown: The results of CCK-8, CFSE and clone formation experiments showed that after treatment with cephalothin, the viability of human pancreatic cancer Panc01 cells decreased, the fluorescence intensity of CFSE-labeled tumors increased, and the colony formation ability decreased. This further proves that cephalothin significantly inhibits the proliferation of human pancreatic cancer Panc01 cells.

[0040] Example 3 Study on the effect of cepharanthin on mouse pancreatic cancer Panc02 cell CD47 Real-time fluorescence quantitative PCR, Western Blotting and flow cytometry were used to detect the effect of cephaladin on the protein and mRNA levels of CD47 on the surface of mouse pancreatic cancer Panc02 cells.

[0041] Experimental method: Digest the cells, collect the cells and count them accurately. Add 1.3×10 5 The cells were seeded in 6-well plates at a ratio of 100 cells / mL, and then different concentrations of cephalothin (0, 100, and 150 nM) were added to the DMEM complete medium. The 6-well plates were placed in a 37°C, 5% CO 2 After culturing in the incubator for 48 h, Panc02 cells were harvested and subjected to flow cytometry, Western Blotting and real-time fluorescence quantitative PCR.

[0042] Flow cytometry: After 48 h of culture, cells were collected and stained with CD47-APC antibody at 4°C in the dark for 30 min. After washing, cells were resuspended in 200 μL PBS and the mean fluorescence intensity (MFI) of the cell surface was detected by flow cytometer, and its changes were analyzed by Flowjo.

[0043] Western Blotting: Cells were lysed with RIPA lysis buffer and total protein was extracted. Protein separation was performed by SDS-PAGE electrophoresis, then transferred to NC membrane, blocked with 5% skim milk, and immunoreaction was performed with CD47-specific antibody (primary antibody), and incubated at 4°C overnight. HRP-labeled secondary antibody was added and incubated at room temperature for 1 h, and finally detected with electrochemiluminescent solution and developed with chemiluminescent gel imager. The above data were statistically analyzed and plotted using GraphPad Prism.

[0044] Real-time fluorescence quantitative PCR method: Total cell RNA was extracted using the cell RNA extraction reagent TRIZOL and reverse transcribed into cDNA using a kit. Using the GAPDH gene as an internal reference, real-time fluorescence quantitative PCR was used to detect changes in the mRNA expression level of CD47 on the surface of tumor cells after pancreatic cancer cells were treated with cephalaenopsis. The primer sequences are as follows: Mouse GAPDH Forward: CCATGTTTGTGATGGGTGTGAACCA (SEQ ID NO.1); Mouse GAPDH Reverse: ACCAGTGGATGCAGGGATGATGTTC (SEQ ID NO. 2); Mouse CD47Forward:TGCGGTTCAGCTCAACTACTG (SEQ ID NO.3); Mouse CD47 Reverse:GCTTTGCGCCTCCACATTAC (SEQ ID NO. 4).

[0045] The experimental results are as follows Figure 3 As shown: The results of flow cytometry, Western Blotting experiments and real-time fluorescence quantitative PCR showed that after treatment with cephalothin, the protein and mRNA expression of CD47 in mouse pancreatic cancer cells decreased significantly with the increase of cephalothin concentration. This directly proves that cephalothin can significantly inhibit the expression of CD47.

[0046] Example 4 Study on the effect of cepharanthin on human pancreatic cancer Panc01 cell CD47 Real-time fluorescence quantitative PCR, Western Blotting and flow cytometry were used to detect the effect of cephaladin on the protein and mRNA levels of CD47 on the surface of human pancreatic cancer Panc01 cells.

[0047] Experimental method: Digest the cells, collect the cells and count them accurately. Add 1.3×10 5 The cells were seeded in 6-well plates at a ratio of 100 cells / mL, and then different concentrations of cephalothin (0, 3, and 5 μM) were added to the DMEM complete medium. The 6-well plates were placed in a 37°C, 5% CO 2 After culturing in the incubator for 72 h, Panc01 cells were harvested and subjected to flow cytometry, Western Blotting and real-time fluorescence quantitative PCR experiments.

[0048] Flow cytometry: After 72 h of culture, cells were collected and stained with CD47-APC antibody at 4°C in the dark for 30 min. After washing, cells were resuspended in 200 μL PBS and the mean fluorescence intensity (MFI) of the cell surface was detected by flow cytometer, and its changes were analyzed by Flowjo.

[0049] Western Blotting: Cells were lysed with RIPA lysis buffer and total protein was extracted. Protein separation was performed by SDS-PAGE electrophoresis, then transferred to NC membrane, blocked with 5% skim milk, and immunoreaction was performed with CD47-specific antibody (primary antibody), and incubated at 4°C overnight. HRP-labeled secondary antibody was added and incubated at room temperature for 1 h, and finally detected with electrochemiluminescent solution and developed with chemiluminescent gel imager. The above data were statistically analyzed and plotted using GraphPad Prism.

[0050] Real-time fluorescence quantitative PCR method: Total cell RNA was extracted using the cell RNA extraction reagent TRIZOL, and reverse transcribed into cDNA using a kit. Actin gene was used as an internal reference, and real-time fluorescence quantitative PCR was used to detect the changes in the mRNA expression level of CD47 on the surface of tumor cells after human pancreatic cancer cells were treated with cephalaenopsis. The primer sequences are as follows: Human ActinForward: AGTGTGACGTGGACATCCGCAAAG (SEQ ID NO.5); Human Actin Reverse: ATCCACATCTGCTGGAAGGTGGAC (SEQ ID NO. 6); Human CD47Forward: AGAAGGTGAAACGATCATCGAGC (SEQ ID NO.7); Human CD47Reverse: CTCATCCATACCACCGGATCT (SEQ ID NO. 8).

[0051] The experimental results are as follows Figure 4 As shown: The results of flow cytometry, Western Blotting and real-time fluorescence quantitative PCR showed that after treatment with cephalothin, the protein and mRNA expression of CD47 in human pancreatic cancer cells decreased significantly with the increase of cephalothin concentration. This directly proves that cephalothin can significantly inhibit the expression of CD47.

[0052] Example 5 Effect of Stephania tetrandra on the anti-tumor immune effect of mice Experimental method: Tumor model construction: 6-week-old female C57BL / 6 mice were adaptively fed for 10 days. Multiple dishes of mouse Panc02 pancreatic cancer cells were cultured in advance, and 5×10 cells / ml were collected and counted. 6 The suspension of 100 μL Panc02 cells was resuspended in 1× sterile PBS and placed on ice for later use; the mice were anesthetized and the hair from the back to the legs of the mice was removed with an electric shaver; 100 μL Panc02 cell suspension was injected into the subcutaneous area with a syringe, and skin bulges were visible during injection; the mice were randomly divided into a cephalothin treatment group (5 mg / kg PBS) and a control group (PBS containing no more than 2% DMSO solvent), 5 mice in each group, and intraperitoneal injection was performed every other day; about 14 days later, the mice were euthanized and the spleen and tumor tissue of the mice were removed, photographed and weighed; the tumor tissue was embedded; the spleen was ground and the red blood cells were lysed to extract spleen immune cells, and the mononuclear cells in the tumor were extracted using the mouse tumor mononuclear cell isolation kit, and the cells were stained with antibodies for 30 min at 4°C. After rinsing with PBS, the cells were resuspended with 200 μL PBS and analyzed by flow cytometry. Flowjo analysis was used, and the data were statistically analyzed and plotted using GraphPad Prism.

[0053] Immunohistochemistry Mouse pancreatic cancer tumor tissue samples were first fixed in 4% paraformaldehyde and then embedded in paraffin. Tissue sections (5 μm) were incubated with CD4 and CD8, developed with DAB, and then placed in hematoxylin staining solution. The staining effect was observed under a microscope, sealed with neutral gum, dried, stored in a box, and photographed.

[0054] The experimental results are as follows Figure 5 , 6 and 7): Changes in the immune microenvironment play an important role in the occurrence and development of tumors. Flow cytometry detected CD4 + T, CD8 +Changes in the proportion of T, macrophages and Treg cells, immunohistochemistry detected CD4 + T and CD8 + The results showed that in the spleen, CD4 + T, CD8 + Compared with the control group, the proportion of T cells and macrophages increased significantly, while the proportion of Treg cells decreased significantly. + T and CD8 + Compared with the control group, the proportion of T cells increased significantly, the proportion of macrophages increased but there was no significant difference, and the proportion of Treg cells decreased significantly compared with the control group; In summary, oxymatrine can enhance the anti-tumor immunity of mice and inhibit the growth of pancreatic cancer. + T and CD8 + The number of T cells increased significantly compared with the control group. It can be seen that cephalothin enhances the anti-tumor immune effect of tumor-bearing mice and promotes the infiltration of anti-tumor immune cells in the spleen and tumors of mice.

[0055] Example 6 Effect of cephalaenopsis on macrophages Experimental method: C57BL / 6 female mice were given an intraperitoneal injection of 2 mL of fluid thioglycollate medium (TG); the mice were euthanized 5 days later. The medium was injected into the mouse peritoneal cavity, the abdomen was slightly squeezed, the skin on the left side was cut, and the peritoneum was not cut. Then, a sterile syringe was slowly inserted into the mouse peritoneum, and the washing fluid in the peritoneal cavity was fully collected into a clean 15 mL centrifuge tube, which was placed on ice. Then, the cells were washed and collected once with serum-free medium; centrifuged at 600 g for 5 min, and the cells were resuspended in 1× PBS buffer, which was repeated 2 to 3 times; the supernatant was discarded, and the cells were transferred to the culture dish by blowing with RPMI-1640 medium, and placed in a 37°C and 5% CO 2 Cell culture incubator.

[0056] Experiment of co-culture of peritoneal induced macrophages and Panc02 cells: Panc02 cells were stained with CFSE in advance and plated in 12-well plates. Different concentrations of cephalothin (0 and 100 nM) were treated for 48 h. Primary mouse macrophages were extracted and inoculated in culture dishes. The next day, the complete medium was discarded and replaced with serum-free 1640 medium for starvation treatment for 2 h. The cells were digested, and macrophages and tumor cells were co-cultured in six-well plates at a ratio of 5:1-10:1 for 4 h. The cells were collected, and macrophages were stained with flow cytometry antibodies (staining antibody: F4 / 80), and analyzed by flow cytometry.

[0057] In vitro polarization experiment of peritoneal macrophages: primary macrophages from mice were extracted and plated in 12-well plates at appropriate proportions; complete RPMI-1640 medium containing LPS (1 μg / mL), IFN-γ (10 ng / mL) and different concentrations of cephalothin (0 and 100 nM) was prepared, and the macrophages were treated for 48 h to induce polarization to M1; complete RPMI-1640 medium containing IL-4 (20 ng / mL) and different concentrations of cephalothin (0 and 100 nM) was prepared, and the macrophages were treated for 48 h to induce polarization to M2; after polarization, the cells were collected and analyzed by flow cytometry.

[0058] The experimental results are as follows Figure 8 As shown: The effect of cephalothin on the phagocytic function of pancreatic cancer cells was observed by co-culturing mouse peritoneal macrophages and pancreatic cancer cells in vitro and flow cytometry; flow cytometry was used to study the effect of cephalothin on the polarization function of macrophages. The results showed that the proportion of macrophages engulfing tumor cells in the cephalothin-treated group was significantly higher than that in the control group, indicating that cephalothin significantly enhanced the phagocytic effect of macrophages on Panc02 cells. The proportion of macrophages polarized to M1 in the cephalothin-treated group increased compared with the control group, but there was no significant difference; the proportion of macrophages polarized to M2 in the cephalothin-treated group was significantly reduced compared with the control group. Inhibiting the polarization of M2 macrophages may help enhance the anti-tumor immune response, allowing the immune system to more effectively identify and eliminate tumor cells. In summary, cephalothin enhances the phagocytic ability of macrophages and inhibits their polarization to M2 macrophages, achieving an anti-tumor effect.

Claims

1. Application of cephalaenopsis in the preparation of CD47 inhibitors in pancreatic cancer cells.

2. Application of cephalaenopsis in the preparation of drugs for inhibiting macrophage polarization to M2 type.

Images