Preparation method of Nrep inhibitor and application of Nrep inhibitor in skin fibrosis
Through Nrep inhibitors, Nrep-shRNA gene is transmitted using lentiviral vectors to inhibit the expression of Nrep, solving the problem of skin fibrosis, significantly reducing the pathological characteristics of skin fibrosis, and having clinical application value.
Patent Information
- Application Number
- CN202411079314.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2024-12-13
AI Technical Summary
The prior art is difficult to effectively inhibit skin fibrosis, especially the mechanism and target of Nrep in skin fibrosis, which has not yet been clarified, resulting in difficulty in clinical transformation.
Develop an Nrep inhibitor, through lentiviral particles containing the Nrep-shRNA gene, the specific steps include synthesis of the Nrep-shRNA gene, cloning into a transfer plasmid, and co-transfecting the packaging cells to prepare lentiviral particles for inhibiting the expression of Nrep. This reduces skin fibrosis.
By injecting Nrep inhibitors, the skin thickness and collagen density were significantly reduced, the expression of fibrosis-related proteins and mRNA was reduced, and the formation of skin fibrosis was successfully reduced, which had clinical transformation value.
Smart Images
Figure HDA0004983262020000011 
Figure HDA0004983262020000012 
Figure HDA0004983262020000013
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and more specifically, to a preparation method of a Nrep inhibitor and application thereof in skin fibrosis. Background Art
[0002] Fibrotic diseases are a class of diseases with excessive deposition of extracellular matrix components as a common pathological feature. They are recognized as a global health problem due to their high prevalence and the accompanying tissue dysfunction and serious complications. According to statistics, the mortality rate caused by fibrotic diseases is as high as 45% in industrialized countries alone. How to reverse the fibrosis process and complete anti-fibrotic treatment is a major challenge currently facing the clinic. Typical skin fibrotic diseases mainly include hypertrophic scars, keloids, and systemic sclerosis, which not only cause a huge medical burden, but also significantly affect the quality of life of patients. Therefore, in-depth exploration of the mechanism of skin fibrosis is of great significance for the development of new drugs for anti-fibrotic treatment and improving the quality of life of patients.
[0003] In recent years, researchers have found that neuronal regeneration related protein (Nrep) can specifically mediate the translation of TGFβmRNA in fibroblasts and participate in the fibrosis of various organs such as liver, kidney, lung and skin. Nrep, also known as neuronal protein 3.1 (P311), is a highly conserved 8-kDa intracellular protein. It was first reported by Studler et al. in 1993 to be expressed in the embryonic mouse brain, and was later found to be widely expressed in various tissues, such as motor neurons, smooth muscle cells, epidermal stem cells and fibroblasts. In addition, these studies have shown that Nrep is widely involved in the occurrence of physiological activities or diseases, such as fat metabolism, blood pressure homeostasis, behavioral responses in learning and memory, tumor invasion, tissue regeneration and fibrosis. In different organs and tissues, Nrep has been confirmed to be involved in the pathogenesis of fibrosis. In liver fibrosis studies, siRNA-mediated knockdown of Nrep reduced TGFβ-induced migration of hepatic stellate cells; Nrep promoted renal fibrosis through TGFβ1 / Smad signaling; Nrep promoted pulmonary fibrosis by stimulating the translation of TGF-β1, -β2, and -β3 in lung fibroblasts; Nrep was highly expressed in human hypertrophic scars, and Nrep deficiency led to impaired TGF-βRII-Smad signaling in dermal fibroblasts and reduced scar stiffness and tensile strength. The above studies indicate that Nrep has a conserved pathological mechanism in the development of cross-organ fibrosis.
[0004] However, most of the current research focuses on fibrosis of internal organs, while relatively few studies have been conducted on the role of Nrep in skin fibrosis. In addition, there is controversy over the direction of action of Nrep on the transforming growth factor β family in previous studies, and the direction of action on skin fibrosis is still unclear. In addition, the occurrence of different skin fibrosis diseases (hypertrophic scars, keloids, and systemic sclerosis, etc.) is different, and there are no reports on the mechanism of action of Nrep in regulating skin fibrosis and the clinical transformation of Nrep targets. Summary of the invention
[0005] The present invention provides a Nrep inhibitor to overcome the defects of the prior art that the inhibition of skin fibrosis is not achieved by inhibiting Nrep and the target Nrep has not been found to have the possibility of clinical transformation.
[0006] Another object of the present invention is to provide a method for preparing a Nrep inhibitor;
[0007] Another object of the present invention is to provide a use of a Nrep inhibitor.
[0008] In order to solve the above technical problems, the technical solution of the present invention is as follows:
[0009] A Nrep inhibitor is a lentiviral particle containing a Nrep-shRNA gene; the upper strand of the Nrep-shRNA gene sequence is
[0010] GATCCGCAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTAACTGA TTCTTGTTTTTTG,
[0011] The next link is
[0012] AATTCAAAAAACAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTA ACTGATTCTTGCG.
[0013] A method for preparing the Nrep inhibitor comprises the following steps:
[0014] S1: Synthesize Nrep-shRNA gene;
[0015] S2: cloning the Nrep-shRNA gene into a transfer plasmid to obtain a transfer plasmid containing the Nrep-shRNA gene;
[0016] S3: co-transfecting the transfer plasmid, packaging plasmid and envelope plasmid containing the Nrep-shRNA gene into packaging cells;
[0017] S4: Collect and concentrate the obtained lentiviral particles, which are the Nrep inhibitors.
[0018] Preferably, the packaging cell is 293T.
[0019] Furthermore, the transfer plasmid includes a long terminal repeat sequence, a packaging signal, and a promoter.
[0020] Furthermore, the transfer plasmid is a lentiviral vector.
[0021] Furthermore, the packaging plasmid includes Gag gene, Pol gene and Rev gene.
[0022] Preferably, the packaging plasmid is a psPAX2 vector.
[0023] Furthermore, the envelope plasmid includes a VSV-G gene.
[0024] Preferably, the envelope plasmid is a pMD2.G vector.
[0025] The Nrep-shRNA gene was cloned into a lentiviral vector using molecular cloning. The lentiviral vector contains the basic elements of the virus, 5'LTR and 3'LTR, as well as other auxiliary elements and Nrep-shRNA sequences. The Gag gene in the psPAX2 vector encodes the main structural protein of the virus; the Pol gene encodes a virus-specific enzyme; and the Rev gene encodes a regulatory factor that regulates the expression of the Gag and Pol genes. The VSV-G gene in the pMD2.G vector provides the envelope protein required for viral packaging. The three plasmids were co-transfected into the packaging cell 293T using a transfection reagent, and the transcribed Nrep-shRNA and the proteins translated from the psPAX2 and pMD2.G genes can be assembled into a lentivirus.
[0026] A transfer plasmid containing Nrep-shRNA gene is prepared by the method.
[0027] An application of the Nrep inhibitor is used for preparing a drug for inhibiting skin fibrosis.
[0028] Furthermore, it is used to prepare drugs for reducing the expression levels of Tgf-β1, α-Sma and Col1a2 proteins.
[0029] Furthermore, it is used to prepare drugs for reducing the mRNA expression levels of Tgf-β1, α-Sma and Col1a2.
[0030] The present invention clarifies that Nrep plays a promoting role in the formation of mouse skin fibrosis, and can promote the secretion of type I collagen through the transforming growth factor β1 signaling pathway to promote the formation of fibrosis. Compared with the WT group, the skin thickness and collagen density of Nrep systemic knockout mice were reduced; the expression of fibrosis-related proteins was reduced; and the mRNA expression level of fibrosis-related proteins was reduced. Compared with the Control group, the skin thickness and collagen density of Nrep conditional knockout mice were reduced; the levels of fibrosis-related proteins and mRNA were also detected, and the expression of fibrosis-related proteins in Nrep conditional knockout mice was reduced; and the expression level of fibrosis-related mRNA was reduced.
[0031] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:
[0032] By injecting the Nrep inhibitor of the present invention (using lentivirus as a vector), the skin thickness and collagen density were significantly reduced compared with the NC group. Specifically, the results of HE staining and Masson staining showed that the Nrep inhibitor significantly reduced the degree of skin fibrosis, which was manifested as a significant reduction in skin dermal thickness and collagen deposition. At the same time, the expression levels of fibrosis-related proteins (such as TGF-β1, α-SMA and COL1A2) were significantly reduced both at the protein level and at the mRNA level. Through the effective inhibition of the target Nrep by the Nrep inhibitor of the present invention, the formation of skin fibrosis in mice was successfully reduced. The above results fully demonstrate the significant effect of the Nrep inhibitor of the present invention in inhibiting skin fibrosis, which can effectively reduce the expression of fibrosis-related genes and proteins, and significantly improve the pathological characteristics of skin fibrosis, indicating that the Nrep inhibitor of the present invention has clinical transformation value. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 The figure shows the construction of Nrep-KO mice and the verification of gene knockout efficiency; A is a schematic diagram of the construction of Nrep-KO mice; B is a comparison of the relative expression levels of Nrep mRNA between Nrep-KO mice and WT mice; **P<0.01.
[0034] Figure 2 The figures are as follows: Construction of Nrep-cKO and Nrep-shRNA mice and verification of gene knockout efficiency; A is a schematic diagram of the breeding scheme of Nrep-cKO mice; B is a schematic diagram of the construction of Nrep-cKO mice; C is a comparison of Nrep expression at the mRNA level between Nrep-cKO mice and the Control group by qPCR; D is a comparison of Nrep mRNA expression in cell culture between Nrep-shRNA and NC groups; E is a comparison of Nrep mRNA expression in mouse skin between Nrep-shRNA and NC groups; *P<0.05.
[0035] Figure 3 Comparison of pathological staining between normal skin and skin fibrosis. A is the comparison of HE and IHC staining between normal skin and skin fibrosis group; B is the comparison of skin thickness between HS, Keloid, SSc group and NS group respectively; C is the comparison of Nrep average optical density between HS, Keloid, SSc group and NS group respectively; **P<0.01.
[0036] Figure 4 The fibrotic skin tissue conditions of the mouse model at different times, A is a schematic diagram of HE staining, Masson staining and IHC staining of skin tissue samples, B is the dermis thickness of the skin tissue, C is the relative collagen area in the skin tissue, and D is the relative expression of Nrep in the skin tissue; *P<0.05, **P<0.01, ***P<0.001.
[0037] Figure 5 Skin thickness and collagen density of Nrep knockout mice. A is the comparison of HE and Masson staining of the skin between Nrep-KO and WT mice; B is the comparison of skin thickness between Nrep-KO and WT mice; C is the comparison of skin collagen area between Nrep-KO and WT mice; **P<0.01.
[0038] Figure 6 Figure 2 shows the expression of fibrosis-related proteins and mRNA in Nrep knockout mice. A is the WB detection result of fibrosis-related proteins between Nrep-KO group and WT group; B is the comparison of relative content of type I collagen between Nrep-KO group and WT group; C is the comparison of relative content of TGF-β1 between Nrep-KO group and WT group; D is the comparison of relative content of α-SMA between Nrep-KO group and WT group; E is the comparison of relative mRNA expression of α-SMA between Nrep-KO group and WT group; F is the comparison of relative mRNA expression of TGF-β1 between Nrep-KO group and WT group; G is the comparison of relative mRNA expression of COL1A2 between NrepKO group and WT group; *P<0.05, **P<0.01.
[0039] Figure 7 Skin thickness and collagen density of Nrep conditional knockout mice. A is the comparison of HE and Masson staining of the skin of Nrep-cKO and Control mice; B is the comparison of skin thickness of Nrep-cKO and Control mice; C is the comparison of skin collagen area of Nrep-cKO and Control mice; *P<0.05, **P<0.01.
[0040] Figure 8Figure 2 shows the expression of fibrosis-related proteins and mRNA in Nrep conditional knockout mice. A is the WB detection result of fibrosis-related proteins between Nrep-cKO group and Control group; B is the comparison of relative content of type I collagen between Nrep-cKO group and Control group; C is the comparison of relative content of TGF-β1 between Nrep-cKO group and Control group; D is the comparison of relative content of α-SMA between Nrep-cKO group and Control group; E is the comparison of relative mRNA expression of α-SMA between Nrep-cKO group and Control group; F is the comparison of relative mRNA expression of TGF-β1 between Nrep-cKO group and Control group; G is the comparison of relative mRNA expression of COL1A2 between Nrep-cKO group and Control group; *P<0.05.
[0041] Fig. 9 Shown are the skin thickness and collagen density of Nrep-shRNA targeted mice. A is the comparison of HE and Masson staining of the skin of mice in the Nrep-shRNA group and the NC group; B is the comparison of skin thickness of mice in the Nrep-shRNA group and the NC group; C is the comparison of skin collagen area of mice in the Nrep-shRNA group and the NC group; *P<0.05, **P<0.01, ***P<0.001.
[0042] Fig.10 Figure 2 shows the expression of fibrosis-related proteins and mRNA in Nrep-shRNA targeted mice. A is the WB detection results of fibrosis-related proteins in Nrep-shRNA group and NC group; B is the comparison of the relative content of type I collagen between Nrep-shRNA group and NC group; C is the comparison of the relative content of TGF-β1 between Nrep-shRNA group and NC group; D is the comparison of the relative content of α-SMA between Nrep-shRNA group and NC group; E is the comparison of the relative mRNA expression of α-SMA between Nrep-shRNA group and NC group; F is the comparison of the relative mRNA expression of TGF-β1 between Nrep-shRNA group and NC group; G is the comparison of the relative mRNA expression of COL1A2 between Nrep-shRNA group and NC group; *P<0.05. DETAILED DESCRIPTION
[0043] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0044] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0045] The human skin samples used in the present invention were taken from patients with skin diseases who visited the Affiliated Hospital of Zunyi Medical University from 2021 to 2023, including outpatients and inpatients. The sample size in each group was ≥ 3 cases, aged 18-65 years, with a clear diagnosis of skin fibrosis diseases, and samples were collected for experimental research with the informed consent of the patients.
[0046] The present invention uses mice as experimental animals, C57BL / 6 (B6) wild-type (Wild-type, WT) male mice were purchased from the Animal Experiment Center of Zunyi Medical University, Nrep whole body knockout mice (C57BL / 6J-Nrepem1cyagen, Nrep-KO) mice were purchased from Saiye Company, Nrep-flox (C57BL / 6-Nrepem1 (flox) Smoc) tool mice were purchased from Nanjing Model Biological Company, and COL1A2-CreERT (Col1a2-cre / ERT, -ALPP) tool mice were purchased from JAX Company. All purchased mice were 6 to 8 weeks old.
[0047] Example 1
[0048] 1. Preparation of Nrep inhibitors
[0049] S1: Synthesize Nrep-shRNA gene;
[0050] The sequence of the Nrep-shRNA gene is:
[0051] GATCCGCAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTAACTGA TTCTTGTTTTTTG, the lower chain is:
[0052] AATTCAAAAAACAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTA ACTGATTCTTGCG.
[0053] S2: Using molecular cloning, Nrep-shRNA is cloned into a lentiviral vector to obtain a transfer plasmid containing the Nrep-shRNA gene, wherein the lentiviral vector contains the long terminal repeat sequences 5'LTR and 3'LTR of the virus, as well as a packaging signal and a promoter.
[0054] S3: Select the lentiviral vector containing Nrep-shRNA gene, psPAX2 vector (containing Gag gene, encoding the main structural protein of the virus; Pol gene, encoding virus-specific enzymes; Rev gene, encoding regulatory factors that regulate the expression of Gag gene and Pol gene) and pMD2.G vector (containing VSV-G gene, providing envelope protein required for virus packaging). The above three plasmids are co-transfected into packaging cells 293T using transfection reagents, and the transcribed Nrep-shRNA and the proteins translated from psPAX2 and pMD2G genes can be assembled into lentivirus.
[0055] S4: Collect and concentrate the obtained lentiviral particles, which are the Nrep inhibitors.
[0056] 2. Verification of the function of inhibiting skin fibrosis
[0057] Verification Method
[0058] (1) Expression of Nrep in fibrotic skin tissue
[0059] HE staining and IHC staining were used to detect the expression of Nrep in skin samples of clinical typical skin fibrosis diseases (hypertrophic scar (HS), keloid and systemic sclerosis (SSc)) and skin samples of healthy adults (NS).
[0060] The skin fibrosis tissues of the bleomycin-induced skin fibrosis mouse model were collected on days 0, 7, 14, and 21 for HE, Masson, and IHC staining.
[0061] (2) Effects of Nrep knockout on skin fibrosis
[0062] CRISPR / CAS9 gene editing technology was used to construct Nrep knockout (Nrep-KO) mice ( Figure 1 A), the genotype of Nrep-KO mice was detected by PCR, and the Nrep knockout efficiency was detected by qPCR ( Figure 1 B). Bleomycin-induced skin fibrosis mouse model was established using Nrep-KO mice and wild-type (WT) mice, and samples were collected for analysis on day 21. Dermal thickness and collagen deposition were evaluated by histological analysis. Western blot and qPCR were used to detect the expression levels of fibrosis-related genes at the protein and mRNA levels.
[0063] (3) Effects of conditional knockout of Nrep fibroblasts on skin fibrosis
[0064] CRISPR / CAS9 gene editing technology was used to construct Nrep conditional knockout mice ( Figure 2A to B), and then Nrep fibroblast conditional knockout mice (Nrep-cKO) were obtained by hybridization with COL1A2-creERT2, and knockout was achieved under tamoxifen induction, and Nrep-cKO mice were verified by PCR and qPCR ( Figure 2 C). The mouse model of bleomycin-induced skin fibrosis was established using Nrep-cKO mice and Nrep-flox mice, and samples were collected for analysis on day 21. Dermal thickness and collagen deposition were first evaluated by histological analysis. Western blot and qPCR were used to detect the expression levels of fibrosis-related genes at the protein and mRNA levels.
[0065] (4) Effects of Nrep-shRNA on skin fibrosis
[0066] Nrep-shRNA was used to knock down Nrep in mouse skin, and qPCR was used to detect the efficiency of shRNA ( Figure 2 D-E). shRNA was delivered by lentiviral vector (PBS dilution concentration was 4×10 8 TU / ml), and the control group received the same concentration of empty virus (NC), and the injection method was subcutaneous injection, and the volume was 100μl / mouse. After 24 hours, bleomycin (1mg / ml) was given subcutaneously, once every two days, and samples were collected and analyzed on the 21st day. The results of HE staining and Masson staining were analyzed for histological analysis, and the relative expression levels of Tgf-β1, α-Sma and Col1a2 at the protein level and mRNA level were also detected.
[0067] Verify the results
[0068] (1) Nrep expression is upregulated in fibrotic skin tissue
[0069] HE staining revealed that the skin thickness of fibrotic skin tissue was significantly higher than that of NS skin tissue ( Figure 3 A, B). IHC staining showed that the expression of Nrep in the epidermis and dermis of fibrotic skin tissue was significantly increased compared with that in NS skin tissue ( Figure 3 A, C). The above results indicate that the fibrosis process leads to significant thickening of skin tissue, and Nrep may play an important role in the process of skin fibrosis.
[0070] The dermal thickness and collagen deposition of fibrotic skin tissue increased significantly over time ( Figure 4 A~C), indicating that the fibrosis process is a time-dependent process. In the bleomycin-induced skin fibrosis model, the expression of Nrep in normal skin tissue is very low, but it is significantly upregulated on the 21st day after induction ( Figure 4A, D), further indicating that Nrep is closely related to the fibrosis process.
[0071] (2) Nrep knockout improves skin fibrosis
[0072] HE staining and Masson staining results showed that the dermal thickness and collagen density of Nrep-KO mice were significantly lower than those of WT mice ( Figure 5 A~C), indicating that Nrep deficiency alleviates the degree of skin fibrosis. Compared with WT mice, the protein levels of Tgf-β1 and Col1a2 in the skin of Nrep-KO mice were significantly downregulated ( Figure 6 A~C), and mRNA level expression was also significantly downregulated ( Figure 6 F~G), further supporting the important role of Nrep in regulating the expression of fibrosis-related genes, and Nrep deficiency inhibited the expression of fibrosis-related proteins. The expression of α-SMA at the mRNA and protein levels was also downregulated to a certain extent compared with WT mice ( Figure 6 D~E).
[0073] (3) Conditional knockout of Nrep fibroblasts improves skin fibrosis
[0074] HE staining and Masson staining results showed that the dermal thickness and collagen density of Nrep-cKO mice were significantly lower than those of Nrep-flox mice ( Figure 7 A~C). Compared with Nrep-flox mice, the mRNA and protein levels of Tgf-β1 and Col1a2 in the skin of Nrep-cKO mice were significantly downregulated, and the expression of α-SMA at the mRNA and protein levels was also downregulated to a certain extent compared with WT mice ( Figure 8 A-G), consistent with the results of Nrep-KO mice.
[0075] (4) Targeting Nrep to improve skin fibrosis
[0076] HE staining results showed that the dermal thickness of Nrep-cKO mice was significantly lower than that of Nrep-flox mice, indicating that conditional knockout of Nrep by the Nrep inhibitor of Example 1 alleviated the dermal thickening phenomenon caused by skin fibrosis ( Fig. 9 A~B). Masson staining results further showed that the collagen density of Nrep-cKO mice was significantly lower than that of Nrep-flox mice, indicating that the knockout of Nrep can reduce the excessive deposition of collagen fibers during fibrosis ( Fig. 9 A, C). The relative expression of TGF-β1, α-SMA, and COL1A2 at the protein level was detected by WB. Compared with the NC group, the expression of fibrosis-related proteins in the Nrep-shRNA group was reduced ( Fig.10 A~D); the mRNA expression levels of TGF-β1, α-SMA, and COL1A2 also showed a decreasing trend ( Fig.10 E-G). These results indicate that Nrep plays an important role in promoting the process of skin fibrosis. Conditional knockout of the Nrep gene by the Nrep inhibitor of the present invention can effectively reduce the degree of skin fibrosis.
[0077] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the embodiments here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.
Claims
1. A Nrep inhibitor, characterized in that It is a lentiviral particle containing the Nrep-shRNA gene; the upper strand of the Nrep-shRNA gene sequence is GATCCGCAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTAACTGA TTCTTGTTTTTTG, The lower chain is AATTCAAAAAACAAGAATCAGTTACCTCCACTCTCGAGAGTGGAGGTA ACTGATTCTTGCG.
2. A method for preparing the Nrep inhibitor according to claim 1, characterized in that: The following steps are involved: S1: Synthesize Nrep-shRNA gene; S2: cloning the Nrep-shRNA gene into a transfer plasmid to obtain a transfer plasmid containing the Nrep-shRNA gene; S3: co-transfecting the transfer plasmid, packaging plasmid and envelope plasmid containing the Nrep-shRNA gene into packaging cells; S4: Collect and concentrate the lentiviral particles, which are the Nrep inhibitors.
3. The method for preparing the Nrep inhibitor according to claim 2, characterized in that: The transfer plasmid comprises a long terminal repeat sequence, a packaging signal and a promoter.
4. The method for preparing the Nrep inhibitor according to claim 2, characterized in that: The transfer plasmid is a lentiviral vector.
5. The method for preparing the Nrep inhibitor according to claim 2, characterized in that: The packaging plasmid includes Gag gene, Pol gene and Rev gene.
6. The method for preparing the Nrep inhibitor according to claim 2, characterized in that: The envelope plasmid includes the VSV-G gene.
7. A transfer plasmid containing Nrep-shRNA gene, characterized in that: The product is prepared by the method described in claims 2 to 3.
8. A use of the Nrep inhibitor according to claim 1, characterized in that: Used for preparing drugs for inhibiting skin fibrosis.
9. The use of the Nrep inhibitor according to claim 8, characterized in that: Used to prepare drugs that reduce the expression levels of Tgf-β1, α-Sma and Col1a2 proteins.
10. The use of the Nrep inhibitor according to claim 8, characterized in that: Used to prepare drugs that reduce the mRNA level expression of Tgf-β1, α-Sma and Col1a2.