Anti-statin B single-chain antibody or fragment thereof, preparation method, DNA molecule and kit

Abstract

The invention discloses an anti-statin B single-chain antibody or a fragment thereof, a preparation method, a DNA (deoxyribonucleic acid) molecule and a kit. The antibody or the fragment thereof comprises a light chain variable region CDR1-3 and a heavy chain variable region CDR1-3, wherein the amino acid sequences of the light chain variable region CDR1-3 are as follows: VLCDR1 is shown as SEQ ID No: 3 in a sequence table; the VLCDR2 is as shown in SEQ ID No: 4 in the sequence table; the VLCDR3 is as shown in SEQ ID No: 5 in the sequence table; the amino acid sequence of the heavy chain variable region VHCDR1-3 is as follows: VHCDR1 is shown as SEQ ID No: 6 in a sequence table; the VHCDR2 is shown as SEQ ID No: 7 in the sequence table; and the VHCDR3 is shown as SEQ ID No: 8 in the sequence table. According to the invention, the anti-statin B single-chain antibody sequence with strong specificity and high affinity is obtained.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody bioengineering, and in particular to an anti-inhibin B single-chain antibody or a fragment thereof, a preparation method, a DNA molecule and a kit. Background Art

[0002] Infertility is a common problem worldwide. Surveys show that male factors are the main or only factor in about 20-50% of infertility. The incidence of azoospermia accounts for 10%-20% of male infertility.

[0003] Inhibin B is a glycoprotein hormone secreted by cells of the reproductive system. Serum inhibin B can directly reflect the spermatogenic function of the testicles and is a more effective indicator for determining male fertility. Inhibin B testing can guide male infertility analysis, assisted reproductive technology, detection of damage to male spermatogenic function caused by radiotherapy and chemotherapy, diagnosis of precocious puberty, delayed puberty, etc. Female INHB is secreted by ovarian granulosa cells and theca cells. Inhibin B can guide the evaluation of ovarian reserve function, assist in the diagnosis of polycystic ovary syndrome (PCOS); assist in the diagnosis of endometriosis; diagnose and monitor ovarian granulosa cell cancer; guide the selection of assisted reproductive technology programs, etc.

[0004] At present, there are several methods for determining inhibin B, such as radioimmunoassay, enzyme-linked immunosorbent assay, time-resolved fluorescence analysis, colloidal gold method, etc. Most of these methods require anti-inhibin B antibodies with strong specificity and high affinity. However, in order to obtain antibodies with strong specificity and high affinity through traditional hybridoma technology, the screening cycle is long, the cost is high, and the screening success rate is low.

[0005] In view of this, this patent application is filed. Summary of the invention

[0006] To solve the above problems, the present invention provides an anti-inhibin B single-chain antibody or a fragment thereof, a preparation method, and a kit. The anti-inhibin B single-chain antibody is selected by phage display technology. Compared with traditional hybridoma technology, the present invention has the advantages of large antibody capacity, simple operation, low cost, and high screening success rate.

[0007] The first object of the present invention is to provide an anti-inhibin B single-chain antibody or a fragment thereof, wherein the antibody comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, and the antibody fragment comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, and the amino acid sequence of the light chain variable region VLCDR1-3 is:

[0008] VLCDR1: as shown in SEQ ID No: 3 in the sequence listing, specifically: SSRYYGRYGYMYG;

[0009] VLCDR2: as shown in SEQ ID No: 4 in the sequence listing, specifically: INRPRPS;

[0010] VLCDR3: as shown in SEQ ID No: 5 in the sequence listing, specifically SGTEGSFDSF;

[0011] The amino acid sequence of the heavy chain variable region VHCDR1-3 is:

[0012] VHCDR1: as shown in SEQ ID No: 6 in the sequence listing, specifically SDGMG;

[0013] VHCDR2: as shown in SEQ ID No: 7 in the sequence listing, specifically SISDDGSLTNYASPVRG;

[0014] VHCDR3: as shown in SEQ ID No: 8 in the sequence listing, specifically SPGGGWLANAIDA.

[0015] In an optional embodiment, the light chain variable region nucleotide sequence is shown as SEQ ID No: 1, and the heavy chain variable region nucleotide sequence is shown as SEQ ID No: 2.

[0016] The sequence SEQ ID No: 1 is specifically:

[0017] ACCGCCGCACTAACACAACCAAGCAGCGTATCACCAAACCTAGGAGGCCAAGTAAAATCACA

[0018] TGCAGCAGCAGATATTACGGCAGATACGGCTACATGTACGGATGGTATCAACAGAAATCACCAGG

[0019] CAGCGCCCCCGTAACACTAATATACATCAACAGACCACGCCCCAGCAACATCCCGTCACGCTTC

[0020] AGCGGCAGCCTAAGCGGCTCAACAAACACCCTAACAATAACAGGCGTCCAAGCCGAAGACGAA

[0021] GCAGTATACTTCTGCAGCGGCACAGAAGGCTCGTTCGACAGCTTTGGCGCCGGCACAACACTAACAGTACTA;

[0022] The sequence SEQ ID No: 2 is specifically:

[0023] GCCGTCACCCCGGACGAGTCAGGCGGAGGCTTCCAAACACCGGGAGGGGCCCTAGTCTGTAAG

[0024] AACTCCGGCTTCACCTTCTCATCAGACGGCATGGGCTGGGTCAGACAAGCCCCAGGAAAAGGA

[0025] CTAGAATATGTAGCCAGCATCAGCGACGACGGCTCCCTAACAAACTACGCCTCACCTGTCAGAG

[0026] GCAGAGCTACAATCTCACGAGATAACGGCCAATCAACCGTAAAACTGCAACTAAACAACCTACG

[0027] CGCCGAAGACACAGGCACATACTACTGCGCCAAAAGCCCAGGCGGCGGCTGGCTGGCCAACGCCATCGACGCATGGGGCCGAGGCCAAGAAGTAATGGTCAGCAGC.

[0028] The second object of the present invention is to provide a DNA molecule encoding the anti-inhibin B single-chain antibody or fragment thereof as described in any one of the above items.

[0029] The third object of the present invention is to provide a method for preparing the anti-inhibin B single-chain antibody or fragment thereof as described in any one of the above, comprising the following steps:

[0030] (1) Immunizing mice with recombinant inhibin B antigen, taking spleen tissue from the mice, extracting RNA, and amplifying the light chain variable region and heavy chain variable region sequences by RT-PCR and PCR;

[0031] Design primer sequences with flexible linkers to splice the obtained light and heavy chain variable regions into multiple pairs of ScFVs through overlapping PCR technology;

[0032] (2) ScFv and pCANTAB5e phage plasmid were double-digested with Sfi I and Not I respectively and then ligated to construct pCANTAB5e-ScFV recombinant plasmid;

[0033] (3) The pCANTAB5e-ScFV recombinant plasmid was electroporated into TG1 competent cells to construct a phage single-chain antibody library;

[0034] (4) Specific screening is performed on the above library to obtain a high-affinity ScFV antibody library or fragment library.

[0035] In an optional embodiment, in step (1), the sequence of the primer used for PCR amplification of the light chain is: VLF1: ​​as shown in SEQ ID No: 9, specifically:

[0036] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAAGTCATGTAACGTCGAGC;

[0037] VLF2: as shown in SEQ ID No: 10, specifically:

[0038] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTCTATTGTTGAATCGC;

[0039] VLF3: as shown in SEQ ID No: 11, specifically:

[0040] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACACACTTACGCTACATCCTTCA;

[0041] VLF4: as shown in SEQ ID No: 12, specifically:

[0042] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTGCTCTAACATGCGAG;

[0043] VLR1: as shown in SEQ ID No: 13, specifically:

[0044] ATAAGAATGCGGCCGCGGCAAAATGGTCGAAAAACGACGGGATAGG;

[0045] VLR2: as shown in SEQ ID No: 14, specifically:

[0046] ATAAGAATGCGGCCGCGGCAAAATAATACCAGAACCAATTAGAGCG;

[0047] VLR3: as shown in SEQ ID No: 15, specifically:

[0048] ATAAGAATGCGGCCGCGGCAAAATGGTAAACGCACATACTGAAATC.

[0049] In an optional embodiment, in step (1), the sequence of the primer used for PCR amplification of the heavy chain is: VHF1: as shown in SEQ ID No: 16, specifically:

[0050] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTGGGAGTCTCTTCCGA;

[0051] VHF2: as shown in SEQ ID No: 17, specifically:

[0052] CGGAGTCAGGCCACCGGCCTACCTCAGACCGTATCCGGATCCCTTAACT;

[0053] VHF3: as shown in SEQ ID No: 18, specifically:

[0054] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTCTTGAACACGAAGGA;

[0055] VHF4: as shown in SEQ ID No: 19, specifically:

[0056] CGGAGTCAGGCCACCGGCCTACCTCAGAGTAGCTGCGAAGCAAAATGTA;

[0057] VHR1: as shown in SEQ ID No: 20, specifically:

[0058] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCTTCTGAGAGTGTCAAAACCG;

[0059] VHR2: as shown in SEQ ID No: 21, specifically:

[0060] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTACCCTGCCACTATCAGAGCGG;

[0061] VHR3: as shown in SEQ ID No: 22, specifically:

[0062] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCCTCGGCGACTCACATGGGAT.

[0063] In an optional embodiment, in step (2), ScFv and pCANTAB5e phage plasmid are digested and then connected at a mass ratio of 1:3;

[0064] In step (2), the primer sequences used to construct the pCANTAB5e-ScFV recombinant plasmid are:

[0065] ScFv F Sfi I: as shown in SEQ ID No: 23, specifically:

[0066] CGGAGTCAGGCCACCGGCCTACCGCAGGCCC;

[0067] ScFv R Not I: as shown in SEQ ID No: 24, specifically:

[0068] ATAAGAATGCGGCCGCGCCCGCCTAACG.

[0069] In an optional embodiment, in step (3), when the pCANTAB5e-ScFV recombinant plasmid is electroporated into TG1 competent cells, helper phage M13K07 is added to obtain a ScFv antibody library;

[0070] In step (4), the inhibin B antigen is used to coat the ELISA plate, and 3-5 rounds of antibody library screening are performed to obtain the ScFv antibody library or fragment library with the highest affinity to the antigen.

[0071] The fourth object of the present invention is to provide a kit, comprising the anti-inhibin B single-chain antibody or a fragment thereof as described in any one of the above items, or comprising the anti-inhibin B single-chain antibody or a fragment thereof obtained by the preparation method as described in any one of the above items.

[0072] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0073] The light chain variable region sequence and heavy chain variable region sequence of the anti-inhibin B single-chain antibody or its fragment disclosed in the embodiments of the present invention provide a basis for constructing an anti-inhibin B single-chain antibody with strong specificity and high affinity. The anti-inhibin B single-chain antibody sequence with strong specificity and high affinity was successfully screened using phage surface display technology, which has the advantages of large antibody library capacity, relatively simple operation, low cost and high screening success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings:

[0075] Figure 1 This is the PCR agarose gel electrophoresis diagram of the DNA fragments of the heavy chain variable region (VH) and the light chain variable region (VL) in Example 1.

[0076] Figure 2 This is the agarose gel electrophoresis diagram of PCR of ScFv in Example 1.

[0077] Figure 3 This is a map of the pCANTAB5e vector.

[0078] Figure 4 This is the ELISA titer determination diagram of ScFv and coated antigen in Example 2. DETAILED DESCRIPTION

[0079] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0080] Throughout the specification, references to "one embodiment," "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in conjunction with the embodiment or example is included in at least one embodiment of the present invention. Therefore, the phrases "one embodiment," "an embodiment," "an example," or "an example" appearing in various places throughout the specification do not necessarily all refer to the same embodiment or example. In addition, particular features, structures, or characteristics may be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. In addition, it will be appreciated by those of ordinary skill in the art that the figures provided herein are for illustrative purposes and that the figures are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0081] Example 1: Construction of antibody library

[0082] 1. Animal immunization and extraction of total RNA from spleen cells

[0083] Mice were immunized with human inhibin B antigen. After multiple immunizations until the antibody titer reached the required level, the spleen tissue of the mice was obtained, frozen in liquid nitrogen and ground into powder. The total RNA of the spleen was extracted using the TRIzol method.

[0084] 2. RT-PCR (reverse transcription amplification) amplification of cDNA

[0085] First, add total RNA, Oligo (dT) 18 primer and purified water, treat at 65 ° C for 5 minutes to open the secondary structure, then add RT enzyme (reverse transcriptase), Reaction Mix, gDNA remover, and treat at 42 ° C for 30 minutes to reverse transcribe and amplify cDNA.

[0086] 3. PCR amplification of light and heavy chain variable region sequences

[0087] The primers for amplifying the light chain variable region come from any combination of VLF1-VLF4 and any combination of VLR1-VLR3 (a total of 12 groups), and the primers for amplifying the heavy chain variable region come from any combination of VHF1-VHF4 and any combination of VHR1-VHR3 (a total of 12 groups).

[0088] The light chain upstream primer introduced the Sfi I restriction site and protective base, and the heavy chain downstream primer introduced the Not I restriction site and protective base. A 15-amino acid sequence (GGGGS)3 was introduced into the light chain downstream primer and the heavy chain upstream primer as a linker. Specifically, cDNA was used as a template, denatured at 94°C for 30s, annealed at 56°C for 30s, and extended at 72°C for 40s, and amplified for 30 cycles. Agarose gel electrophoresis was performed (results are shown in Figure 1 ), recover the amplified heavy chain variable region and light chain variable region DNA fragments (corresponding to the VH and VL products described in step 4 below, respectively). Figure 1 It can be seen that the antibody light chain and heavy chain variable regions were amplified.

[0089] The above primer sequences are specifically:

[0090] Light chain amplification primer: VLF1 (SEQ ID No: 9):

[0091] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAAGTCATGTAACGTCGAGC.

[0092] VLF2 (SEQ ID No: 10):

[0093] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTCTATTGTTGAATCGC.

[0094] VLF3 (SEQ ID No: 11):

[0095] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACACACTTACGCTACATCCTTCA.

[0096] VLF4 (SEQ ID No: 12):

[0097] CCACCACCACCAAGTCCACCACCACCAAGTCCACCACCACCAAGTGACAGACACTGAGGTGCTCTAACATGCGAG.

[0098] VLR1 (SEQ ID No: 13):

[0099] ATAAGAATGCGGCCGCGGCAAAATGGTCGAAAAACGACGGGATAGG.

[0100] VLR2 (SEQ ID No: 14):

[0101] ATAAGAATGCGGCCGCGGCAAAATAATACCAGAACCAATTAGAGCG.

[0102] VLR3 (SEQ ID No: 15):

[0103] ATAAGAATGCGGCCGCGGCAAAATGGTAAACGCACATACTGAAATC.

[0104] Heavy chain amplification primer:

[0105] VHF1 (SEQ ID No: 16):

[0106] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTGGGAGTCTCTTCCGA.

[0107] VHF2 (SEQ ID No: 17):

[0108] CGGAGTCAGGCCACCGGCCTACCTCAGACCGTATCCGGATCCCTTAACT.

[0109] VHF3 (SEQ ID No: 18):

[0110] CGGAGTCAGGCCACCGGCCTACCTCAGACCCGCTCTTGAACACGAAGGA.

[0111] VHF4 (SEQ ID No: 19):

[0112] CGGAGTCAGGCCACCGGCCTACCTCAGAGTAGCTGCGAAGCAAAATGTA.

[0113] VHR1 (SEQ ID No: 20):

[0114] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCTTCTGAGAGTGTCAAAACCG.

[0115] VHR2 (SEQ ID No: 21):

[0116] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTACCCTGCCACTATCAGAGCGG.

[0117] VHR3 (SEQ ID No: 22):

[0118] ACTTGGTGGTGGTGGACTTGGTGGTGGTGGACTTGGTGGTGGTGGAAACCGACTCCTCGGCGACTCACATGGGAT.

[0119] 4. ScFV sequence amplification

[0120] The upstream primer of ScFv introduces Sfi I restriction site and protection base, and the downstream primer of ScFv introduces Not I restriction site and protection base. The sequences of ScFv F Sfi I and ScFv R Not I are shown below. Specifically, the VH and VL products obtained by PCR amplification were used as mixed templates, denatured at 94°C for 30s, annealed at 62°C for 30s, extended at 72°C for 40s, and amplified for 30 cycles, and randomly spliced ​​to form ScFv using overlap extension PCR technology. Perform agarose gel electrophoresis (results as shown in Figure 2 ), and the amplified ScFv DNA fragment was recovered. Figure 2 It can be seen that the ScFv fragment was recovered.

[0121] The above primer sequences are:

[0122] ScFv F Sfi I (SEQ ID No: 23): CGGAGTCAGGCCACCGGCCTACCGCAGGCCC.

[0123] ScFv R Not I (SEQ ID No: 24):ATAAGAATGCGGCCGCGCCCGCCTAACG.

[0124] 5. Double digestion of ScFv and pCANTAB5e

[0125] The ScFv fragment was combined with the pCANTAB5e vector (map as shown in Figure 3 Specifically, Not I was first added to the reaction system, and the enzyme digestion was carried out in a constant temperature water bath at 37° C. for 10 h. After the Not I digestion was completed, Sfi I was added, and the enzyme digestion was carried out in a constant temperature water bath at 50° C. for 6 h. Agarose gel electrophoresis was performed to recover the target fragment.

[0126] 6. Preparation of pCANTAB5e-ScFv recombinants

[0127] Specifically, the ligation reaction system was prepared at a mass ratio of ScFv:pCANTAB5e of 1:3, and the reaction was carried out at 16° C. for 18 h. Agarose gel electrophoresis was performed to recover the target fragment.

[0128] 7. Electroporation of pCANTAB5e-ScFv into TG1

[0129] Specifically, the ligation product (pCANTAB5e-ScFV) was added to the TG1 competent cells, mixed and quickly transferred to a dry, pre-cooled electroporation cup, and electroporation was performed at 2.5 kV and 10 ms. After completion, SOC medium (without antibiotics) preheated at 37°C was added immediately, and cultured at 37°C and 200 rpm for 1 hour. Centrifuge at 4000 rpm for 10 minutes, retain 1 / 5 of the supernatant, gently resuspend the bacteria, take a small amount to coat 2xYT-A plates (containing Amp resistance), and invert and culture overnight in a 37°C constant temperature incubator; the remaining bacterial solution was added with 50% final concentration of glycerol and frozen for storage as the primary ScFv antibody library, that is, the phage single-chain antibody library.

[0130] Example 2: Panning of high affinity ScFv

[0131] 1. Identification of positive clones

[0132] Specifically, on the second day, a single colony was picked from the plate and inoculated into 2xYT-A liquid culture medium (containing Amp resistance), and the culture was rejuvenated at 37°C and 200 rpm for 4 hours. The bacterial solution was taken for PCR identification, and the PCR procedure was the same as 2.3 in Example 2; the positive clones were expanded and cultured, and the plasmids were extracted for double enzyme digestion identification. The clones with bands that met the expectations were sequenced and identified, and the strains were retained.

[0133] 2. Phage rescue and proliferation

[0134] Specifically, positive strains were rejuvenated in 2xYT-A liquid culture medium (containing Amp resistance) at 37°C and 200 rpm for 4 hours, helper phage M13K07 was added at moi = 20:1, cultured at 37°C for 1 hour, and then cultured at 37°C and 200 rpm for 1 hour, centrifuged at 400 rpm for 10 minutes to precipitate the bacteria, and the supernatant was discarded; 2xYT-A liquid culture medium (containing Amp and Kan resistance) was added to resuspend the bacteria, and cultured at 37°C and 200 rpm overnight; the bacterial solution was collected and centrifuged at 10000 rpm for 20 minutes, the supernatant was retained and 1 / 5 volume of PEG-8000 / NaCl was added to ice bath for 1 hour to precipitate the phage, centrifuged at 4000 rpm for 20 minutes, ensuring that all supernatant was removed, 1 / 50 volume of PBS was added to resuspend the precipitate, centrifuged at 8000 rpm for 10 minutes, and the supernatant retained was the ScFv library.

[0135] 3. Selection of ScFv

[0136] Specifically, the alanyl-tRNA synthetase target antigen was diluted in sodium carbonate coating solution and coated on the ELISA plate, the antigen concentration was 100 μg / mL, the coating volume was 100 μL, and it was incubated at 4°C overnight; the coating solution was discarded and the plate was washed 5 times with PBST; the blocking solution (5% skim milk powder-PBST) was added and blocked at 37°C for 2 hours; the blocking solution was discarded and the plate was washed 5 times with PBST; the phage library diluted with PBS was added and combined at 37°C for 2 hours; the plate was washed 10 times with PBST; 2M Gly-HCl (pH2.2) was added and incubated at 37°C for 10 minutes, the liquid in the well was blown to elute the phage and transferred to a centrifuge tube, Tris-HCl (pH8.0) was quickly added for neutralization, TG1 bacterial solution was added, and the plate was cultured on a shaking table at 200 rpm for 1 hour after being incubated in a water bath at 37°C for 30 minutes, thus completing the first round of panning.

[0137] The phages after the first round of panning were rescued and proliferated according to step 2 of this embodiment and then subjected to subsequent panning. Starting from the second panning, the antigen coating concentration was reduced to 50 μg / mL, and the number of washes after incubating the phages increased with the increase in the number of panning rounds (5 times per round), and the rest of the panning method was the same as the first round. After a total of 3 rounds of panning, the ultimate antibody library with the highest affinity was obtained.

[0138] Test example:

[0139] The binding of the high-affinity ScFv antibody library to the target antigen was detected by ELISA. The specific method is as follows:

[0140] The target antigen of inhibin B (here, the immunogen and the natural antigen are coated separately) was diluted in sodium carbonate coating solution and coated on the ELISA plate, with an antigen concentration of 2 μg / mL and a coating volume of 100 μL, and the plate was incubated at 4°C overnight; the coating solution was discarded the next day, and the plate was washed 3 times with PBST; the blocking solution (5% skim milk powder-PBST) was added, and the plate was blocked at 37°C for 2 hours, and the blocking solution was discarded, and the plate was washed 3 times with PBST; the ultimate phage ScFv antibody library after panning diluted with PBS was added, and the plate was bound at 37°C for 1 hour, and the plate was washed 5 times with PBST; mouse anti-M13 antibody (HRP labeled) was added, and the plate was incubated at 37°C for 1 hour, and the plate was washed 5 times with PBST; TMB colorimetric solution was added, and the plate was incubated at 37°C for 15 minutes; the reaction stop solution was added (the blue color turned into yellow color within 20 minutes), and the absorbance was measured at a wavelength of 450nm on an ELISA reader (the result is shown in FIG. Figure 4 ), determine the ability of the antibody to bind to the target antigen. Figure 4 By comparison, it can be seen that the binding ability of anti-inhibin B single-chain antibody to natural antigen is equivalent to that of coated antigen. Figure 4 The conclusion was drawn that the anti-inhibin B single-chain antibody has good binding ability with the natural antigen. Figure 4 The control antigen in represents the natural inhibin B target antigen, and the coating antigen represents the immunogen.

[0141] The present invention successfully utilizes phage surface display technology to screen out anti-inhibin B single-chain antibody sequences with strong specificity and high affinity. The present invention has the advantages of large antibody library capacity, relatively simple operation, low cost and high screening success rate, and has broad prospects in the development of diagnostic kits using this antibody.

[0142] The above specific implementation methods further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above are only specific implementation methods of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An anti-inhibin B single-chain antibody or a fragment thereof, wherein the antibody comprises a light chain variable region CDR1-3 and a heavy chain variable region CDR1-3, and the antibody fragment comprises a light chain variable region VLCDR1-3 and a heavy chain variable region VHCDR1-3, characterized in that: The amino acid sequences of the light chain variable regions VLCDR1-3 are: VLCDR1: as shown in SEQ ID No: 3 in the sequence listing; VLCDR2: as shown in SEQ ID No: 4 in the sequence listing; VLCDR3: as shown in SEQ ID No: 5 in the sequence listing; The amino acid sequence of the heavy chain variable region VHCDR1-3 is: VHCDR1: as shown in SEQ ID No: 6 in the sequence listing; VHCDR2: as shown in SEQ ID No: 7 in the sequence listing; VHCDR3: as shown in SEQ ID No: 8 in the sequence listing.

2. An anti-inhibin B single-chain antibody or a fragment thereof according to claim 1, characterized in that: The nucleotide sequence of the light chain variable region is shown in SEQ ID No: 1, and the nucleotide sequence of the heavy chain variable region is shown in SEQ ID No:

2.

3. A DNA molecule encoding the anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 1 to 2.

4. The method for preparing the anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 1 to 2, characterized in that: The anti-inhibin B single-chain antibody was obtained by panning from a phage single-chain antibody library using phage display technology.

5. The method for preparing an anti-inhibin B single-chain antibody or a fragment thereof according to claim 4, characterized in that: The following steps are involved: (1) Immunizing mice with recombinant inhibin B antigen, taking spleen tissue from the mice, extracting RNA, and amplifying the light chain variable region and heavy chain variable region sequences by RT-PCR and PCR; Design primer sequences with flexible linkers to splice the obtained light and heavy chain variable regions into multiple pairs of ScFVs through overlapping PCR technology; (2) ScFv and pCANTAB5e phage plasmid were double-digested with Sfi I and Not I respectively and then ligated to construct pCANTAB5e-ScFV recombinant plasmid; (3) The pCANTAB5e-ScFV recombinant plasmid was electroporated into TG1 competent cells to construct a phage single-chain antibody library; (4) Specific screening is performed on the above library to obtain a high-affinity ScFV antibody library or fragment library.

6. The method for preparing an anti-inhibin B single-chain antibody or a fragment thereof according to claim 5, characterized in that: In the step (1), the primers used for PCR amplification of the light chain are a combination of any one of VLF1-VLF4 and any one of VLR1-VLR3; VLF1: ​​sequence as shown in SEQ ID No: 9; VLF2: sequence as shown in SEQ ID No: 10; VLF3: sequence as shown in SEQ ID No: 11; VLF4: sequence as shown in SEQ ID No: 12; VLR1: sequence as shown in SEQ ID No: 13; VLR2: sequence as shown in SEQ ID No: 14; VLR3: The sequence is shown in SEQ ID No:

15.

7. The method for preparing an anti-inhibin B single-chain antibody or a fragment thereof according to claim 5, characterized in that: In the step (1), the primers used for PCR amplification of the heavy chain are a combination of any one of VHF1-VHF4 and any one of VHR1-VHR3; VHF1: sequence as shown in SEQ ID No: 16; VHF2: sequence as shown in SEQ ID No: 17; VHF3: sequence as shown in SEQ ID No: 18; VHF4: sequence as shown in SEQ ID No: 19; VHR1: sequence as shown in SEQ ID No: 20; VHR2: sequence as shown in SEQ ID No: 21; VHR3: The sequence is shown in SEQ ID No:

22.

8. The method for preparing an anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 5 to 7, characterized in that: In step (2), ScFv and pCANTAB5e phage plasmid were digested and ligated at a mass ratio of 1:3; In step (2), the primer sequences used to construct the pCANTAB5e-ScFV recombinant plasmid are: ScFv F Sfi I: as shown in SEQ ID No: 23; ScFv R Not I: as shown in SEQ ID No:

24.

9. The method for preparing an anti-inhibin B single-chain antibody or a fragment thereof according to any one of claims 5 to 7, characterized in that: In step (3), when the pCANTAB5e-ScFV recombinant plasmid is electroporated into TG1 competent cells, helper phage M13K07 is added to obtain the ScFv antibody library; In step (4), the inhibin B antigen is used to coat the ELISA plate, and 3-5 rounds of antibody library screening are performed to obtain the ScFv antibody library or fragment library with the highest affinity to the antigen.

10. A kit, characterized in that: The invention comprises the anti-inhibin B single-chain antibody or a fragment thereof as claimed in any one of claims 1 to 2, or comprises the anti-inhibin B single-chain antibody or a fragment thereof obtained by the preparation method as claimed in any one of claims 4 to 9.

Images