Pseudoneobibacillus capable of efficiently preventing and controlling tomato bacterial wilt and promoting tomato growth and application of pseudoneobibacillus

Abstract

The invention discloses a pseudoneobibacillus capable of efficiently preventing and controlling tomato bacterial wilt and promoting tomato growth and application of the pseudoneobibacillus, and belongs to the technical field of agricultural microorganisms. The bacterial strain C159 is identified as a potential new species of Pseudoneobibacillus, is named as Pseudoneobibacillus sp.C159, is preserved in the Guangdong Microbial Culture Collection Center (GDMCC), and has the preservation number of GDMCC No: 65250. The invention also discloses a preparation method of the bacterial strain C159. The bacterial strain C159 has the advantages that the bacterial strain C159 is named as Pseudoneobibacillus sp.C159, and the bacterial strain C159 is named as Pseudoneobibacillus sp.C159; the bacillus pseudoneobibacillus disclosed by the invention can produce IAA (Indoleacetic Acid), mineralize insoluble organophosphorus, remarkably reduce the attack degree of tomato bacterial wilt (the disease-resistant efficiency is as high as 89.29%) and remarkably promote the plant growth of tomatoes (the growth promoting efficiency is as high as 22.68%). Therefore, the bacillus pseudoneobisius C159 disclosed by the invention has important research value and application potential in the aspects of improving the bacterial wilt resistance of the crops and promoting the growth of the crops.

Description

Technical Field

[0001] The invention relates to the technical field of agricultural microorganisms, and in particular to a pseudoneobacillus strain capable of effectively preventing and controlling tomato bacterial wilt and promoting tomato growth, and application thereof. Background Art

[0002] As one of the important vegetable crops in the world, tomato (Solanum lycopersicum) has extremely high economic and nutritional value. According to statistics from the Food and Agriculture Organization of the United Nations, the global tomato planting area in 2020 was approximately 5.055 million hectares, with an annual output of 182 million tons, making it one of the most widely consumed horticultural crops in the world. Tomatoes are rich in vitamin C, vitamin A and a variety of antioxidants (such as lycopene), which play a significant role in preventing cardiovascular disease, certain cancers and other chronic diseases. However, tomatoes face many challenges in the production process, especially disease invasion, and tomato bacterial wilt is particularly serious. The disease is caused by Ralstonia solanacearum, which can cause tomato plants to wilt. In severe cases, the yield loss can reach more than 80%, or even a total loss, which has brought huge losses to farmers and the agricultural industry.

[0003] Faced with the increasingly serious problem of crop diseases, although traditional chemical pesticide control methods have achieved results in the short term, their sustainability has been questioned due to the negative effects of long-term use, such as soil and water pollution, food safety hazards, and ecological imbalance. Modern agriculture urgently needs to find alternative protection measures, and microbial technology has become a solution. Microorganisms, especially disease-resistant microorganisms and plant growth-promoting microorganisms, can not only improve plant disease resistance by secreting antibacterial compounds or enhancing plant immune responses, but also promote plant growth by producing siderophores, IAA, or dissolving / mineralizing insoluble phosphorus in the soil. The application of these microorganisms can improve plant disease resistance, increase crop yields, improve crop quality, and significantly reduce the use of pesticides, thereby achieving environmental friendliness and economic sustainability in agriculture.

[0004] As microbial agents become increasingly popular in the market, existing products are highly homogenized and have poor functional stability, resulting in unsatisfactory practical application results. Based on these circumstances, it is particularly important to develop new microbial products, and the key lies in finding efficient new microbial resources. By screening and utilizing new microbial resources with disease resistance and plant growth promotion functions, a more effective material basis can be provided for crops, and the drawbacks of existing microbial agent products can be avoided as much as possible, which is in line with the requirements of sustainable agricultural development. Summary of the invention

[0005] The purpose of the present invention is to provide a new species of Pseudoneobacillus sp. C159 with disease resistance and growth promotion, so as to provide a new microbial resource for improving the ability of crops to resist bacterial wilt and promoting crop growth.

[0006] To achieve the above purpose, the new species C159 of the genus Pseudoneobacillus provided by the present invention is isolated from tomato rhizosphere soil and named Pseudoneobacillus sp. C159. The strain is deposited in Guangdong Microbiological Culture Collection Center (GDMCC), the address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, the deposit number is GDMCC No: 65250, and the deposit date is October 14, 2024.

[0007] The identification characteristics of the pseudoneobacillus are:

[0008] Strain C159 is a Gram-positive bacterium. On TSA medium, the single colony is approximately round, off-white in the middle, surrounded by a white circle, matte on the surface, and with irregular edges. The 16S rRNA gene sequence of strain C159 is 1550bp long. Through sequence comparison analysis, this strain is similar to Pseudoneobacillus rhizosphaerae JJ-79 T The strain C159 has the highest similarity of 98.70%. Based on the results of comparative genome analysis, strain C159 is the only model species of the genus Pseudoneobacillus rhizosphaerae JJ-79. T The average nucleotide identity was 75.31% and the digital DNA-DNA hybridization value was 19.60%. The results showed that strain C159 represented a new species of the genus Pseudomonas.

[0009] The present invention found that strain C159 has the ability to produce IAA, which is 33.72 mg·L -1 .

[0010] The present invention found that strain C159 can mineralize insoluble organic phosphorus.

[0011] The present invention finds that inoculating strain C159 into tomato root system can significantly reduce the incidence of tomato bacterial wilt, and the disease resistance efficiency is 89.29%.

[0012] The present invention finds that inoculating strain C159 into tomato root system can significantly promote the growth of tomato plants, with the growth-promoting effect of the aboveground part being 10.45%, the root system being 51.64%, and the whole plant being 22.68%.

[0013] The present invention also provides a microbial fertilizer and / or microbial preparation, characterized in that it contains the pseudoneobacillus C159, or its fermentation liquid, or the supernatant of its fermentation liquid as an active ingredient.

[0014] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159 or the above-mentioned microbial fertilizer and / or microbial preparation in producing IAA.

[0015] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159 or the above-mentioned microbial fertilizer and / or microbial preparation in mineralizing insoluble organic phosphorus.

[0016] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159, or its fermentation liquid, or the supernatant of its fermentation liquid, or the above-mentioned microbial fertilizer and / or microbial preparation in biological control of tomato bacterial wilt.

[0017] The present invention also provides the use of the above-mentioned pseudoneobacillus C159, or its fermentation liquid, or the supernatant of its fermentation liquid, or the above-mentioned microbial fertilizer and / or microbial preparation in promoting the growth of tomatoes.

[0018] Preferably, the crop is tomato.

[0019] The present invention has the following advantages over the prior art:

[0020] 1) Pseudoneobacillus C159 is a new species that is different from other Pseudoneobacillus bacteria. In addition, only one species of Pseudoneobacillus has been reported so far.

[0021] 2) Pseudomonas aeruginosa C159 can not only produce IAA (33.72 mg·L -1 ), and can also mineralize insoluble organic phosphorus.

[0022] 4) Pseudomonas aeruginosa C159 can significantly reduce the incidence of tomato bacterial wilt, with an anti-disease efficiency of up to 89.29%.

[0023] 5) Pseudomonas aeruginosa C159 can significantly promote the growth of tomato plants, with the growth-promoting effects on the aboveground part, root system and the whole plant reaching 10.45%, 51.64% and 22.68%, respectively.

[0024] Therefore, the pseudoneobacillus C159 disclosed in the present invention can improve the resistance of crops to bacterial wilt and promote crop growth, and has broad application prospects in the preparation of crop microbial fertilizers and microbial preparations.

[0025] Pseudoneobacillus sp.C159 is deposited in Guangdong Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, the deposit number is GDMCC No: 65250, and the deposit date is October 14, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the colony morphology of Bacillus pseudoneocolon C159 on TSA medium.

[0027] Figure 2 is the phylogenetic tree of the genome of Bacillus pseudoneocolon C159.

[0028] Figure 3 It is the mineralization of insoluble organic phosphorus by Bacillus pseudoneoplasticus.

[0029] Figure 4 The effect of inoculation with Bacillus pseudoneoplasticus C159 on tomato bacterial wilt and plant growth.

[0030] Figure 5 It is the effect of Bacillus pseudoneocolon C159 on the disease grade, plant biomass, aboveground biomass and root biomass of plants. DETAILED DESCRIPTION

[0031] The following are specific implementation examples of the present invention. It should be noted that these embodiments are only examples and do not constitute any limitation to the scope of the present invention. Modifications and replacements made to the details and forms of the implementation scheme within the scope of the present invention fall within the protection scope of the present invention.

[0032] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The experimental reagents used in the following examples are all conventional biochemical reagents unless otherwise specified.

[0033] Example 1: Isolation of strain C159

[0034] The soil used to isolate strain C159 was tomato soil collected from Jintang Town, Maonan District, Maoming City, Guangdong Province. Soil bacteria were isolated according to the high-throughput isolation, culture and identification technology of bacteria. The specific operation is as follows: Take 1g of fresh soil, dilute it 5000 times and then 2000 times with sterile magnesium chloride solution and 10% TSB liquid culture medium in turn. Take 160μL of the dilution and add it to 48 96-well cell culture plates and culture them in the dark at 30℃ for 2 weeks. Evenly aspirate 10μL of bacterial solution from the wells of the culture plate to extract bacterial DNA by alkaline lysis method. Take 140μL of 80% (v / v) glycerol and add it to the remaining bacterial solution, which is preserved as a bacterial glycerol seed for subsequent bacterial activation. PCR amplification was performed using primers 799F / 1193R (V5-V7 region of 16S rRNA gene) and Green Taq Mix of Novazon. The product was diluted 120 times and used as a template, and PCR amplification was performed using 799F and 1193R primers with sequencing adapters (Illumina adapter) and barcodes (Barcode). The second round of PCR products was electrophoresed, and the approximately 550bp band was cut out for purification and the product concentration was determined. Each 96-well plate was prepared according to 100ng, and the mixed library of 48 plates totaled 4800ng. High-throughput sequencing was performed at Beijing Novogene Technology Co., Ltd. The sequencing data was analyzed using the analysis process Culturome (https: / / github.com / YongxinLiu / Culturome) to determine the position of the cultured bacteria in the 96-well plate. 25μL of bacterial solution was drawn from the wells of the corresponding 96-well cell culture plate and activated on 1 / 2TSA medium. The bacteria were purified by multiple streaking method, and the purified bacterial strains were mixed with 25% glycerol (v / v) and stored in a -20℃ refrigerator.

[0035] The strain C159 was identified as a Gram-positive bacterium. The single colony on TSA medium was approximately round, off-white in the middle, surrounded by a white circle, with a dull surface and irregular edges ( Figure 1 ).

[0036] Example 2: 16S rRNA gene sequence analysis of strain C159

[0037] The genomic DNA of strain C159 was extracted using the HiPure Bacterial DNA Kit (Cat. No. D3146-02) of Guangzhou Meiji Biotechnology Co., Ltd., and the full length of the 16S rRNA gene was amplified using the bacterial universal primers 27F / 1492R. The PCR product was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing, and its sequence is shown in SEQ ID NO.1, with a length of 1550bp. The sequences obtained by sequencing were compared on the EzBioCloud (https: / / www.ezbiocloud.net / identify) website. The results showed that strain C159 and the model species Pseudoneobacillus rhizosphaerae JJ-79 T The strain C159 has the highest similarity of 98.70%. It is worth noting that only one species of Pseudoneobacillus has been reported so far, namely Pseudoneobacillus rhizosphaerae. Based on the 16S rRNA gene sequence similarity results, strain C159 belongs to the genus Pseudoneobacillus, but its taxonomic status cannot be accurately determined.

[0038] Example 3: Full gene sequence analysis of strain C159

[0039] Strain C159 was sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for genome sequencing using the Illumina Novaseq platform. SPAdes v3.15.3 software was used to assemble the bacterial genome sequence and remove contig sequences of low quality and less than 500bp in length. CheckM v1.1.3 software was used to perform quality analysis on the integrity and contamination of the bacterial genome. The genome is considered to be of high quality if the integrity of the genome is not less than 95% and the contamination is not more than 5%. The analysis results showed that the genome integrity of strain C159 was 97.44% and the contamination was 0.87%, so the genome was a high-quality genome. The bacterial genome was analyzed using QUAST v5.0.2. The results showed that the total genome length of strain C159 was 4.65Mbp, the length of N50 was 160740bp, and the G+C content of genomic DNA was 38.65%.

[0040] The genome of the model species of the genus Pseudoneobacillus was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / datasets / genome / ?taxon=2946549). Since only one species of the genus Pseudoneobacillus has been reported so far, for the reliability of the results, other model species were downloaded from the closest relative Neobacillus genus (https: / / www.ncbi.nlm.nih.gov / datasets / genome / ?taxon=2675232) to construct the genome evolution tree. In addition, in order to further clarify the relationship between strain C159 and Pseudoneobacillus rhizosphaeraeJJ-79 T The differences between strain C159 and the model strain Pseudoneobacillus rhizosphaerae JJ-79 were calculated using ANI Calculator (http: / / www.ezbiocloud.net / tools / ani) and Genome-to-Genome Distance Calculator v3.0 (https: / / ggdc.dsmz.de / ggdc.php#), respectively. T The average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values ​​between genome sequences showed that strain C159 had similarity to the model strain Pseudoneobacillus rhizosphaerae JJ-79. T The ANI value between the two bacterial genomes was 75.31%, and the dDDH value was 19.60%. When the ANI value of two bacterial genomes is less than 95%, they are different species. The whole genome DNA-DNA hybridization value of 70% is the gold standard for prokaryotic species division. In addition, UBCG v3.0 was used to construct strain C159 and Pseudoneobacillus rhizosphaerae JJ-79 T The results showed that strain C159 and the model strain Pseudoneobacillus rhizosphaerae JJ-79 T Formed an independent phylogenetic branch with a bootstrap value of 100 ( Figure 2), indicating that strain C159 has an independent taxonomic status. Based on the above results, strain C159 is a potential new species of the genus Pseudoneobacillus, named Pseudoneobacillus sp. C159. The strain is deposited in Guangdong Microbiological Culture Collection Center (GDMCC), the address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, the deposit number is GDMCC No: 65250, and the deposit date is October 14, 2024.

[0041] Example 4: Identification of IAA production ability of Bacillus pseudoneocolon C159

[0042] The activated single colony of Bacillus pseudoneocolony C159 was inoculated into a solution containing 200 mg·L -1 The cells were cultured in R2A liquid medium containing L-tryptophan at 30°C and 200 rpm for 2 days with 3 biological replicates. 1 mL of bacterial culture was taken and the supernatant was collected by centrifugation at 12000 rpm for 5 min. The IAA production was determined by the Salkowski colorimetric method. 100 μL of supernatant was mixed with an equal volume of Salkowski colorimetric solution (50 mL 35% HClO4 + 1 mL 0.5 mol·L -1 FeCl3) was mixed. After standing for 0.5 h in dark conditions, the absorbance at 530 nm was measured using an ELISA instrument. Sterile R2A liquid culture medium was used as a control. -1 The IAA standard solution was diluted in a gradient manner and the OD at the corresponding concentration was measured. 530 The absorbance value was used to draw a standard curve and calculate the IAA production capacity of Bacillus pseudoneocolon C159.

[0043] The results showed that the IAA production capacity of Bacillus pseudoneocolon C159 was 33.72 mg·L -1 .

[0044] Example 5: Identification of the ability of Bacillus pseudoneocolonus C159 to mineralize insoluble organophosphate

[0045] Inoculate a single colony of the activated Bacillus pseudoneosubtilisin C159 into TSB liquid culture medium, culture it at 30°C and 200rpm for 2 days, aspirate 10μL of the bacterial solution and add it to the insoluble organophosphorus culture medium, then invert the plate and culture it at 30°C for 5 days. Determine whether the strain C159 has the ability to solubilize phosphate by observing the phosphate solubilization circle on the plate.

[0046] Insoluble organic phosphorus culture medium: glucose 10 g·L -1 , ammonium sulfate 0.5 g·L -1 , yeast extract powder 0.5g·L-1 , sodium chloride 0.3 g·L -1 , potassium chloride 0.3 g·L -1 , magnesium sulfate 0.3 g·L -1 , ferrous sulfate 0.03 g·L -1 , manganese sulfate 0.03g·L -1 , lecithin 0.2 g·L -1 , calcium carbonate 1.0 g·L -1 , agar 15 g·L -1 The culture medium was purchased from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd., with the catalog number HB8673-1.

[0047] The results showed that Bacillus pseudoneocolon C159 could mineralize insoluble organic phosphorus ( Figure 3 ).

[0048] Example 6: Evaluation of the ability of Bacillus pseudoneosubtilis C159 to resist tomato bacterial wilt and promote growth

[0049] The soil from which Pseudoneobacillus C159 was isolated was used as the test soil. After air drying, the soil was sieved with a 2 mm sieve and then sterilized with high temperature and high pressure steam (sterilized at 121 ° C for 1 h). This experiment was a potted experiment with a total of 4 treatments, namely CK (control group, i.e., only inoculated with water), P (only inoculated with the pathogen Ralstonia solanacearum QL-Rs1115), C159 (only inoculated with Pseudoneobacillus C159) and C159-P (first inoculated with the pathogen, then inoculated with Pseudoneobacillus C159), and 6 biological replicates were set for each treatment.

[0050] After germination of Xinzhongshu No. 4 tomato seeds, the germinated seeds were selected and sown into pots. After 14 days of growth, tomato seedlings with uniform growth were selected and inoculated with 5 mL of bacterial suspension of Bacillus pseudoneosubtilis C159 (resuspended in sterile water, OD 600 =1.0), 5 mL of sterile water was inoculated into the CK and P groups. After 7 days, 5 mL of Ralstonia solanacearum QL-Rs1115 bacterial suspension (OD 600 =1.0), and 5 mL of sterile water was inoculated into the CK and C159 groups. After 10 days, the incidence of bacterial wilt of tomatoes was counted. The incidence of bacterial wilt of tomatoes is divided into 0 to 5 levels, representing no symptoms (level 0), 20% (level 1), 40% (level 2), 60% (level 3), 80% (level 4) and 100% (level 5) of leaves showing symptoms. The aboveground parts and roots of tomatoes were then dried separately, and their biomass was measured.

[0051] The results showed that the tomato seedlings in the CK and C159 groups did not show symptoms of bacterial wilt, while the tomato seedlings in the P and C159-P groups showed typical symptoms of bacterial wilt ( Figure 4 Compared with the P group, the incidence of tomato bacterial wilt in the C159-P group was significantly reduced (P<0.001, n=6), and the disease resistance efficiency of the inoculated Bacillus pseudoneoplasticus C159 was as high as 89.29% ( Figure 5 Compared with the CK group, the aboveground biomass, root biomass (P<0.01, n=6) and plant biomass (P<0.01, n=6) of the C159 group were significantly increased, and the growth promotion efficiency of inoculation with Bacillus pseudoneoplasticus C159 was as high as 10.45%, 51.64% and 22.68%, respectively ( Figure 5 ). Compared with the P group, the aboveground biomass (P<0.05, n=6), root biomass (P<0.05, n=6) and plant biomass (P<0.05, n=6) of the C159-P group were significantly increased. The growth promotion efficiency of inoculation with Bacillus pseudoneoplasticus C159 on tomato infected by pathogens was as high as 42.04%, 50.79% and 44.49%, respectively ( Figure 5 ). Combining these results, we can see that (1) compared with the aboveground part of tomatoes, Pseudomonas aeruginosa C159 has a greater growth-promoting effect on tomato roots; (2) when pathogens are present, Pseudomonas aeruginosa C159 has a greater promoting effect on the aboveground biomass and plant biomass of tomatoes. In summary, Pseudomonas aeruginosa C159 is a multifunctional bacterium that is highly resistant to tomato bacterial wilt and can effectively promote the growth of tomato plants (especially tomato roots).

[0052] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

[0053] Full-length sequence of 16S rRNA gene of Bacillus pseudoneosubtilis C159 (SEQ ID NO.1)

[0054] TTATTGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGC

[0055] AAGTCGAGCGAATCACTGGGTGCTTGCACCCTTTGGTTAGCGGCGGACGGGTGAGTAA

[0056] CACGTGGGCAACCTGCCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCG

[0057] GATAATCCTTTTCCACTCATGTGGAGAAGTTGAAAGACGGTTTCGGCTGTCACTTATAG

[0058] ATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACGATGC

[0059] GTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCT

[0060] ACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGC

[0061] CGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTA

[0062] CCGGAGTAACTGCCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGT

[0063] GCCAGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAA

[0064] GCGCGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGG

[0065] TCATTGGAAACTGGGGAACTTGAGTACTGAAGAGGAAAGCGGAATTCCACGTGTAGCG

[0066] GTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGGCTTTCTGGTCAGTA

[0067] ACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTC

[0068] CACGCCGTAAACGATGAGTGCTAAGTGTTAGAGGGTTTCCGCCCTTTAGTGCTGCAGC

[0069] AAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAAT

[0070] TGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGA

[0071] ACCTTACCAGGTCTTGACATCCTTTGACCACCCTAGAGATAGGGCTTTCCCCTTCGGGG

[0072] GACAAAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTA

[0073] AGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACTCTAA

[0074] GGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCC

[0075] TTATGACCTGGGCTACACACGTGCTACAATGGATGGTACAAAGGGCTGCAAAACCGCG

[0076] AGGTTGAGCCAATCCCATAAAACCATTCTCAGTTCGGATTGCAGGCTGCAACTCGCCTG

[0077] CATGAAGCCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCG

[0078] GGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGGG

[0079] GTAACCGTAAGGAGCCAGCCGCCTAAGGTGGGACAGATGATTGGGGTGAAGTCGTAA

[0080] CAAGGTAGCCGTATCGGAAGGTGCGGCTGGATCACCTCCTTT

Claims

1. Pseudoneobacillus sp. C159, deposited with GDMCC No: 65250.

2. A microbial fertilizer and / or microbial preparation, characterized in that: Contains the pseudoneobacillus C159 according to claim 1, or its fermentation liquid, or the supernatant of its fermentation liquid as an active ingredient.

3. Use of the pseudoneobacillus C159 described in claim 1 or the microbial fertilizer and / or microbial preparation described in claim 2 in producing IAA.

4. Use of the pseudoneobacillus C159 according to claim 1 or the microbial fertilizer and / or microbial preparation according to claim 2 in mineralizing sparingly soluble organic phosphorus.

5. Use of the pseudoneobacillus C159 according to claim 1, or its fermentation liquid, or the supernatant of its fermentation liquid, or the microbial fertilizer and / or microbial preparation according to claim 2 in biological control of crop bacterial wilt.

6. Use of the pseudoneobacillus C159 according to claim 1, or its fermentation liquid, or the supernatant of its fermentation liquid, or the microbial fertilizer and / or microbial preparation according to claim 2 in promoting crop growth.

7. The use according to claim 5 or 6, characterized in that: The crop is tomato.

Images