Avian pathogenic escherichia coli bacterial ghost vaccine and application thereof

Abstract

The invention relates to the technical field of vaccine preparation, and particularly discloses an avian pathogenic Escherichia coli bacterial ghost vaccine and application thereof, and the bacterial ghost vaccine is obtained by loading pCAGGS-flfA plasmids into avian pathogenic Escherichia coli bacterial ghost. The pCAGGS-flfA plasmid is obtained by connecting a flfA gene to EcoRI and KPnI restriction enzyme cutting sites of a pGAGGS carrier, and the flfA gene is used as a plasmid of the pCAGGS-flfA plasmid; the preparation process of the avian pathogenic Escherichia coli ghost comprises the following steps: synthesizing a phage splitting gene E and staphylococcus aureus nuclease A into a gene E-SN, then constructing a recombinant plasmid, transferring the recombinant plasmid into an avian pathogenic Escherichia coli competent cell sensitive to ampicillin to obtain an Escherichia coli recombinant bacterium, carrying out amplification culture, and inducing co-expression of the protein E-SN to obtain the avian pathogenic Escherichia coli ghost. And centrifuging, washing, resuspending and freeze-drying to obtain the avian pathogenic escherichia coli ghost. The avian pathogenic Escherichia coli ghost vaccine prepared by the invention can effectively prevent duck source chicken bacilli infection.

Description

Technical Field

[0001] The invention relates to the technical field of vaccine preparation, and in particular to an avian pathogenic Escherichia coli ghost vaccine and application thereof. Background Art

[0002] Gallibacterium anatis (G. anatis) is a representative species of the genus Gallibacterium. As a common bacterium, it often colonizes the upper respiratory tract and lower reproductive tract of poultry. Infection with this bacterium can cause oviduct cysts, salpingitis, sepsis, oophoritis and peritonitis. Especially under certain immunosuppression and various stressors, it is more likely to cause respiratory, reproductive and systemic diseases. In addition, Gallibacterium anatis usually aggravates the infection and occurrence of other pathogenic microorganisms. Clinically, it is often mixed with infectious bronchitis, Escherichia coli and mycoplasma. It can not only cause diseases such as oviductitis and oviduct cysts in laying hens, but also seriously endanger the economic benefits of breeding.

[0003] At present, isolated strains at home and abroad have multiple drug resistance problems, resulting in poor prevention and control effects of existing vaccines and drugs, and frequent mixed infections with other pathogens. Therefore, it is urgent to develop a vaccine that can effectively prevent diseases caused by duck-derived Gallinarum infection. Summary of the invention

[0004] In order to provide a product for preventing diseases caused by duck-origin Gallobacterium infection, the present invention provides an avian pathogenic Escherichia coli ghost vaccine and an application thereof. The avian pathogenic Escherichia coli ghost vaccine prepared by the present invention can effectively prevent and treat duck-origin Gallobacterium infection. After the virus attack, the bacterial copy number in the tissues and organs of chickens immunized with the ghost vaccine was significantly lower than that after immunization with a single plasmid pCAGGS-flfA and ghosts, and the antibody level after immunization with the ghost vaccine was significantly higher than that of the group immunized with the single plasmid pCAGGS-flfA and ghosts alone.

[0005] The present invention provides a bacterial ghost vaccine, which is obtained by loading pCAGGS-flfA plasmid into the bacterial ghost of avian pathogenic Escherichia coli;

[0006] The pCAGGS-flfA plasmid is obtained by connecting the flfA gene to the EcoRI and KPnI restriction sites of the pGAGGS vector;

[0007] The preparation process of the avian pathogenic Escherichia coli ghost is as follows: the phage lysis gene E and the Staphylococcus aureus nuclease A synthesis gene E-SN are connected to a vector, Escherichia coli is transformed and screened to obtain a recombinant plasmid, and then the recombinant plasmid is transferred into avian pathogenic Escherichia coli competent cells that are sensitive to ampicillin to obtain recombinant Escherichia coli bacteria, and after expanded culture, the protein E-SN co-expression is induced, the bacteria are collected by centrifugation, washed, and then resuspended and freeze-dried to obtain the avian pathogenic Escherichia coli ghost.

[0008] The present invention uses the pili gene flfA of a clinically isolated duck-derived Gallinaceus isolate as a research object to construct a recombinant expression plasmid pCAGGS-flfA, and at the same time, co-clones the bacteriophage lysis gene E and Staphylococcus aureus nuclease A, referred to as SN, in a temperature-sensitive λpL / pR-cI857 expression system to construct a temperature-sensitive regulated recombinant plasmid pBV-E-SN for co-expression of the E gene and Staphylococcus aureus nuclease A, then transforms the temperature-controlled recombinant plasmid into an Escherichia coli isolate to prepare bacterial ghosts, and finally loads the recombinant expression plasmid pCAGGS-flfA carrying the flfA gene into the bacterial ghosts to obtain a bacterial ghost vaccine. The avian pathogenic Escherichia coli bacterial ghost vaccine prepared by the present invention can effectively prevent duck-derived Gallinaceus infection.

[0009] Furthermore, the process of loading the pCAGGS-flfA plasmid into the avian pathogenic Escherichia coli bacterial ghost is as follows: resuspending the bacterial ghost in a PBS buffer containing the pCAGGS-flfA plasmid, and the amount ratio of the bacterial ghost to the PBS buffer is: 10 6 CFU~10 10 CFU: 100μL~120μL;

[0010] The concentration of the pCAGGS-flfA plasmid in the PBS buffer is 0.4 mg / mL to 1 mg / mL.

[0011] Furthermore, the gene E-SN is connected to the pBV220 vector.

[0012] Furthermore, the recombinant plasmid is transformed into competent cells of avian pathogenic Escherichia coli sensitive to ampicillin by electroporation.

[0013] Further, the expansion culture process is as follows: the recombinant E. coli is cultured in LB liquid medium containing ampicillin at 28°C to 30°C and 200rpm to 220rpm until the OD 600 It is 0.4~0.5.

[0014] Furthermore, the process of inducing protein E-SN co-expression is: rapidly raising the temperature to 42° C. to induce protein E-SN co-expression.

[0015] Furthermore, the centrifugation condition is 7000 rpm to 8000 rpm for 10 min to 15 min.

[0016] Furthermore, before freeze-drying, the bacteria resuspended in PBS were pre-frozen at -20°C for 12 h and then at -80°C for 4 h.

[0017] Furthermore, the preparation process of the pCAGGS-flfA plasmid is as follows: amplifying a flfA gene with a length of 597 bp, and then connecting it with a pMD18-T vector to obtain a pMD18T-flfA recombinant plasmid; using restriction endonucleases KPnI and EcoRI to cut the flfA gene from the recombinant plasmid pMD18T-flfA to obtain a flfA gene fragment, and digesting the pGAGGS vector with restriction endonucleases KPnI and EcoRI to obtain a pCAGGS vector fragment; then using T4 DNA ligase to connect the flfA gene fragment and the obtained pCAGGS vector fragment to obtain a pCAGGS-flfA recombinant expression plasmid, referred to as pCAGGS-flfA plasmid.

[0018] The present invention also provides the use of the bacterial ghost vaccine in preparing a product for preventing diseases caused by duck-derived Gallobacterium infection. The product is a vaccine preparation with the bacterial ghost vaccine as the only effective ingredient.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The avian pathogenic Escherichia coli ghost vaccine prepared by the present invention can effectively prevent duck-derived Gallinaceus infection. After the virus attack, the bacterial copy number in the tissues and organs of chickens immunized with the ghost vaccine was significantly lower than that after immunization with a single plasmid pCAGGS-flfA and ghosts, and the antibody level after immunization with the ghost vaccine was significantly higher than that of the single plasmid pCAGGS-flfA and ghosts alone immunization group. The ghosts prepared by the present invention are used as loading carriers to improve the immune effect.

[0021] 2. The avian pathogenic Escherichia coli ghost vaccine obtained by the present invention has good immune effect, simple preparation process, good plasticity, low production cost, simple delivery method, relatively short production cycle, and convenient storage and transportation.

[0022] 3. The present invention uses the pili gene flfA of the clinically isolated duck-derived Gallinaceus isolate as the research object to construct a recombinant expression plasmid pCAGGS-flfA, and at the same time, the phage lysis gene E and Staphylococcus aureus nuclease A, referred to as SN, are co-cloned in the temperature-sensitive λpL / pR-cI857 expression system to construct a temperature-sensitive regulated recombinant plasmid pBV-E-SN for co-expression of the E gene and Staphylococcus aureus nuclease SN, and then the temperature-controlled recombinant plasmid is transformed into the Escherichia coli isolate to prepare bacterial ghosts, and finally the recombinant expression plasmid pCAGGS-flfA carrying the flfA gene is loaded into the bacterial ghost to obtain a bacterial ghost vaccine, which provides a basis for the application of nucleic acid vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 It is the amplified band of flfA gene of the present invention, M: DL2000 DNA marker; 1-8: target gene flfA; 9: negative control.

[0025] Figure 2 This is the PCR identification of the pMD18T-flfA plasmid of the present invention, M: DL4500 DNA marker; 1-9: G. anatis flfA gene PCR products; 10: negative control.

[0026] Figure 3 This is the enzyme digestion identification of pMD18T-flfA of the present invention, M: DL5000 DNA marker; 1: pMD18T-flfA not digested by enzyme; 2: pMD18T-flfA double digested by enzyme.

[0027] Figure 4 PCR identification of the pCAGGS-flfA plasmid of the present invention, M: DL2000 DNA marker; 1-15: G. anatis flfA gene PCR product; 16: negative control.

[0028] Figure 5 The figure shows the enzyme digestion identification of the pCAGGS-flfA plasmid of the present invention. M: DL5000 DNA marker; Lane 1: pCAGGS-flfA plasmid not digested by enzymes; Lane 2: pCAGGS-flfA plasmid digested by double enzymes; Lane 3: pCAGGS-flfA plasmid digested by single enzymes.

[0029] Figure 6 This is the Western blot result of the in vitro expression of the pCAGGS-flfA plasmid of the present invention, M: 15kDa-150kDa Marker of yamase; 1: in vitro expression of the pCAGGS-flfA plasmid; 2: in vitro expression of pCAGGS.

[0030] Figure 7 PCR identification of pBV-E-SN, M: DL4500 DNA marker; 1-6: PCR products of E-SN; 7: negative control.

[0031] Figure 8 For the restriction enzyme digestion identification of the recombinant plasmid pBV-E-SN, M: DL10000 DNA marker; 1: pBV-E-SN plasmid double-digested with EcoRI and SalI; 2: pBV-E-SN plasmid.

[0032] Fig. 9 The lysis kinetics of recombinant DH5а.

[0033] Fig.10 For PCR amplification of E-SN gene, M: DL4500 DNA marker; 1-6: PCR products of electroporated recombinant plasmid; 7: negative control.

[0034] Fig.11 The lytic kinetics of recombinant avian pathogenic Escherichia coli ZK-XC-13QG-3.

[0035] Fig.12 This is a scanning electron micrograph of bacterial shadows, and the yellow arrow points to the transmembrane channel formed in the middle.

[0036] Fig.13 This is a line graph of the level of anti-duck-derived Gallinaceus-specific IgG antibodies in the serum of chicks detected by ELISA method. In the figure, I, pCAGGS-flfA plasmid immunization group; II, BG-loaded pCAGGS-flfA plasmid immunization group; III, empty bacterial ghost (BG) immunization group; IV, PBS immunization group; V, normal feeding group.

[0037] Fig.14 This is a bar chart of the level of anti-duck Gallinaria-specific IgG antibodies in the serum of chicks detected by ELISA. In the figure, I, pCAGGS-flfA plasmid immunization group; II, BG loaded pCAGGS-flfA plasmid immunization group; III, empty bacterial shadow (BG) immunization group; IV, PBS immunization group; V, normal feeding group. The ※ on the column of each group indicates the difference between each immunization group and the Control group. ※Indicates the difference between the two comparison groups; ※※ indicates a significant difference (0.001<p<0.005), ※※※ indicates an extremely significant difference (p<0.001).

[0038] Fig.15 This is the standard curve of SYBR Green I fluorescence quantitative PCR of duck-derived Gallinaceus.

[0039] Fig.16 This is the melting curve of duck-derived Gallinaceus SYBR Green I fluorescent quantitative PCR.

[0040] Fig.17 This is an analysis of the load of duck-derived Gallinaceus in various tissues and organs, where I, pCAGGS-flfA plasmid immunization group; II, BG loaded with pCAGGS-flfA plasmid immunization group; III, empty bacterial ghost (BG) immunization group; IV, PBS immunization group; V, normal feeding group; the ※ on the column of each group indicates the difference between each immunization group and the Control group. ※ Indicates the difference between two comparison groups; ※※ indicates significant difference (0.001<p<0.005), ※※※ indicates extremely significant difference (p<0.001);

[0041] In the figure, A is the bacterial load of the spleen; B is the bacterial load of the lungs; C is the bacterial load of the liver; D is the bacterial load of the trachea; and E is the bacterial load of the palate. DETAILED DESCRIPTION

[0042] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0043] Embodiment 1:

[0044] 1. Construction and identification of recombinant plasmid pCAGGS-flfA

[0045] 1. Primer design and synthesis

[0046] According to the flfA gene sequence of GenBank G. anatis 12656-12, a pair of specific primers were designed using Premier 5.0 software for amplifying the G. anatis flfA target gene (referred to as flfA target gene). The primer pair is flfA-F and flfA-R, and the sequences are shown in Table 1. The primers used in the present invention were synthesized by Shangya Biotechnology Co., Ltd.

[0047] Using the genomic DNA of duck-derived Gallinaceus ZZ-XY-1-SLG as a template, a PCR reaction was performed according to the PCR reaction system and PCR reaction program in Tables 2 and 3 to obtain the flfA target gene with a sequence as shown in SEQ ID NO.3, and the target gene fragment length was 597 bp (excluding restriction sites).

[0048] Duck-derived Gallinaceus ZZ-XY-1-SLG has been published in a public article. The relevant public article information is as follows: Wang Kunpeng, Peng Zhifeng, Liu Panpan, et al. Cloning and functional region analysis of the flfA gene of duck-derived Gallinaceus [J]. Henan Agricultural Sciences.

[0049] Table 1 Primer sequences and lengths for PCR amplification of G. anatis flfA gene

[0050]

[0051] Note: The underlined residues are restriction sites and protected bases.

[0052] Table 2 PCR reaction system

[0053] Reagents dose DNA 1μL Primer flfA-F 0.5μL Primer flfA-R 0.5μL 2×Mix 12.5μL <![CDATA[ddH2O]]> Add to 25 μL

[0054] Table 3 PCR reaction program

[0055]

[0056] SEQ ID NO.3:

[0057] atgaaaaaattgcttttaacaactttaattgccgttggtttgggcttatcagcacaaggtgcatttgcggatgatcctagtgcagctaattcaacaaatggcggtcttattacaatcac tggtaaagtaacagataccacttgtttaattaatggaaaagaaaatggcgatttgacagtacaattaccaccagtttctacaaaagcgctagctactcagggcgcaacaacaggtgatac agcatttacaattgaattaagtggttgtcaatctgcaacagataaacttgcaaaaaaagcagcagcattcttcgtgaatgaatcagataaagtaacagctgatggtaagttaactaaata aacctgcaactcctggtgatgcagctcaaaatgtggtggtgcaattacttcacggtgatgatactccaattgatattacaaaacccttatgcggaacaaactaaagaggctcaaaaagctg gaattgattcaagcaagaaaacagccacattgaaatataaagctcgttactatgcaactaatccggcaggagcgggtgaggtgaaatctaccgtgaactatactatcgcatacgaataa.

[0058] 2. Construction of recombinant plasmid pMD18T-flfA

[0059] The flfA target gene recovered from the above PCR product gel was connected to the pMD18-T vector, and the connection reaction system was 10 μL, as shown in Table 4.

[0060] Table 4 Ligation reaction system

[0061] Components content pMD18-T vector 1μL flfA target gene 0.5μL <![CDATA[ddH2O]]> 3.5μL Solution I 5μL

[0062] After gently mixing the system, react at 16°C for 30 minutes. Add 10μL of the ligation product to 100μL of DH5α competent cells melted in an ice bath and place on ice for 30 minutes. Then heat shock in a 42°C water bath for 90 seconds, immediately place on ice for 2 minutes, then add 500μL of sterile LB liquid culture medium to each tube, mix well, and place in a 37°C shaker at 200rpm for 1 hour to allow the bacteria to recover. Take 100μL of the bacterial solution and evenly spread it on a plate containing 100μg / mL Amp +LB plates were placed in a 37°C incubator for overnight culture.

[0063] 3. Identification of recombinant plasmid pMD18T-flfA

[0064] Pick at 100μg / mL Amp + A single positive colony on the LB plate was inoculated into 5 mL of 100 μg / mL Amp + The cells were cultured overnight at 37°C in a resistant LB medium with shaking, and the positive clones were identified by PCR amplification of the flfA target gene. The PCR reaction system and reaction procedure were the same as those shown in Tables 2 and 3.

[0065] The colonies identified correctly by PCR were expanded and cultured, and plasmids were extracted using a plasmid extraction kit, and the plasmid was named pMD18T-flfA. The plasmid was digested and identified using the double enzyme digestion method. The enzyme digestion reaction system is shown in Table 5.

[0066] Table 5 Enzyme digestion reaction system

[0067] Components content KQ 1μL EcoRI 1μL pMD18T-flfA 0.5μL 10×L 1μL <![CDATA[ddH2O]]> Add to 10 μL

[0068] 4. Construction of recombinant plasmid pCAGGS-flfA

[0069] Enzyme digestion: The flfA gene was cut out from the recombinant plasmid pMD18T-flfA using restriction endonucleases EcoRI and KPnI and recovered by gel. Then the pGAGGS vector was digested with the same enzymes mentioned above and recovered by gel for later use.

[0070] The pMD18T-flfA plasmid restriction enzyme digestion reaction system was 50 μL and the restriction enzyme digestion was performed at 37°C for 3 h, as shown in Table 6.

[0071] Table 6 Enzyme digestion reaction system

[0072] Components content KQ 5μL EcoRI 5μL pMD18T-flfA 2.5μL 10×L 5μL <![CDATA[ddH2O]]> Add to 50 μL

[0073] The restriction enzyme digestion reaction system of pCAGGS vector was 50μ, 37°C for 3h, as shown in Table 7.

[0074] Table 7 Enzyme digestion system

[0075] Components content KQ 5μL EcoRI 5μL pCAGGS 5μL 10×L 5μL <![CDATA[ddH2O]]> Add to 50 μL

[0076] Ligation: After the restriction digestion was completed, the flfA gene fragment and the pCAGGS vector fragment were recovered by 1% agarose gel electrophoresis and ligated by T4 DNA ligase. The ligation reaction system was 10 μL, as shown in Table 8.

[0077] Table 8 Ligation reaction system

[0078] Components content flfA gene fragment 2μL pCAGGS 0.7μL T4 Ligase 1μL 10×Green Buffer 1μL <![CDATA[ddH2O]]> Add to 10 μL

[0079] After gentle mixing, connect overnight at 16°C. Transform the overnight connection product into DH5α competent cells, take 100 μL of bacterial solution and evenly spread it on LB plate containing 100 μg / mL ampicillin, and place it in a 37°C constant temperature incubator for overnight culture.

[0080] 5. Identification of recombinant plasmid pCAGGS-flfA

[0081] A single colony was picked from the plate and inoculated into 5 mL of 100 μg / mL Amp + LB liquid medium was added and shaken at 37°C overnight. The bacterial solution cultured overnight was used as a template for bacterial solution PCR identification to amplify the target gene flfA. The PCR reaction system and reaction procedure were the same as shown in Table 2 and Table 3. The colony identified correctly by PCR was expanded and cultured to extract the plasmid, which was named pCAGGS-flfA. The plasmid was digested and identified using the double enzyme digestion method.

[0082] 6. In vitro expression of recombinant plasmid pCAGGS-flfA

[0083] Cell recovery and culture: Take out the HD11 cells frozen in the liquid nitrogen tank, put them into a 37℃ water bath to melt, centrifuge the melted cell solution at 800rpm for 5min, discard the freezing solution, add 1mL 10% serum and 1% double-antibody 1640 culture medium, blow and mix to resuspend the cells, transfer the mixed solution into a cell culture bottle, add 5mL 10% serum and 1% double-antibody 1640 culture medium to mix, and put them into a 37℃, 5% CO2 incubator for culture and passage. After the cells have been passaged 3 times, they can be used for cell transfection.

[0084] Transfection of eukaryotic expression plasmid: The grown 4th generation cells were digested with 0.25% trypsin by mass volume ratio, and the cells were resuspended in serum-free double-antibody medium, pipetted and mixed, and the cells were counted. After counting, the cells were plated in a 6-well plate, with about 2×10 6 When the cells grow to about 90%, discard the culture medium, wash 3 times with sterile PBS buffer, and then add serum-free 1% double antibody 1640 culture medium. According to the instructions of the lipofectamine 3000 transfection kit, 2μg pCAGGS-flfA recombinant plasmid and 2μg transfection reagent were transfected into HD11 cells respectively, and the 6-well plate was placed in a cell culture incubator and cultured at 37℃ for 6h, then the culture medium was discarded and replaced with 1640 culture medium containing 2% serum and 1% double antibody for 48h.

[0085] Western blot identification: After 48 hours, remove the 6-well plate, discard the culture medium, and wash with PBS three times. Prepare cell lysis buffer on ice, add 200 μL to each well, and lyse on ice for 30 minutes. Scrape the cells with a cell scraper, centrifuge at 8000 rpm for 5 minutes, then aspirate the supernatant, dilute with 5× protein loading buffer to 1× protein loading buffer, and boil for 10 minutes.

[0086] Prepare 12% SDS-PAGE separation gel for protein electrophoresis, take an appropriate amount of sample for protein electrophoresis transfer, take out the PVDF membrane to 5% skim milk 4 ℃ blocking for 2h, and wash 3 times with PBST after blocking, each time for 5min. Use homemade rabbit polyclonal serum diluted with 5% skim milk as the primary antibody (1:1000 dilution), the rabbit polyclonal serum is prepared by immunizing rabbits with plasmid pCAGGS-flfA, after overnight incubation of the primary antibody at 4℃, wash 3 times with PBST, each time for 5min; use HRP-labeled goat anti-rabbit polyclonal antibody as the secondary antibody (1:10000 dilution), shake at room temperature for 1h, wash 3 times with PBST, each time for 5min; ECL colorimetric solution development and exposure.

[0087] 2. Preparation of avian pathogenic Escherichia coli ghosts

[0088] 1. Selection of avian pathogenic Escherichia coli sensitive to ampicillin

[0089] The ampicillin-sensitive avian pathogenic Escherichia coli ZK-XC-13QG-3 strain preserved in the laboratory was selected for electrotransformation. The ZK-XC-13QG-3 strain was publicly recorded in the Chinese Journal of Veterinary Medicine "Effects of Duck-derived Gallinaria on Chicken Primary Oviduct Epithelial Cells".

[0090] 2. Construction of recombinant plasmid pBV-E-SN

[0091] According to the gene sequence encoded by the phage PhiX174 lytic gene E and the gene sequence encoded by Staphylococcus aureus nuclease A (SN) published in GenBank, the E gene and the SN gene were connected using three repeating sequences of (Gly-4-Ser), a total of 15 amino acids, as a linker to synthesize the gene E-SN and connect it to the pBV220 vector to construct the recombinant plasmid pBV-E-SN. The synthesis of the E-SN tandem gene and its connection with the pBV220 vector were completed by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0092] The three repeating sequences of (Gly-4-Ser), i.e. the sequence of the Linker, are shown in SEQ ID NO.4:

[0093] SEQ ID NO. 4: ggtggtggtggttctggtggtggtggttctggtggtggtggttct.

[0094] 3. Lytic kinetics test of recombinant bacteria DH5а

[0095] In order to preliminarily verify whether pBV-E-SN can normally express its lytic function in bacteria, the recombinant bacteria synthesized, connected and transformed into Escherichia coli DH5а by the above-mentioned company were induced to measure its lytic kinetics and lysis rate. The specific steps are as follows:

[0096] The E. coli DH5а recombinant bacteria containing pBV-E-SN were streaked and inoculated. After overnight culture, a single colony was picked and inoculated into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and cultured at 28°C and 200 rpm overnight. The next day, the colony was inoculated into 100 mL of LB liquid medium containing 100 μg / mL ampicillin at a ratio of 1:100, and cultured at 28°C and 200 rpm until the OD 600 The concentration of 1 μg / mL ampicillin was 0.4, and 100 μL of bacterial solution was taken. After multiple dilution, 100 μL was evenly spread on a solid LB plate containing 100 μg / mL ampicillin, and cultured at 28°C to determine the CFU of bacteria before induction.

[0097] Then, the remaining bacterial solution was divided into two bottles in equal amounts. One bottle was continued to be cultured at 28°C and 200 rpm, and the other bottle was quickly heated to 42°C in a water bath and cultured at 200 rpm. Samples were taken every 30 minutes to measure the OD 600 , until OD 600 When the lysis is over, the same amount of bacterial solution as before induction is taken from the culture bottle cultured at 42°C and diluted in multiples for colony counting. The lysis rate is calculated based on the colony counting results before and after induction: lysis rate = (1-CFU after induction / CFU before induction) × 100%.

[0098] 4. Preparation of electroporation competent cells of avian pathogenic Escherichia coli

[0099] Step 1: Resuscitate the avian pathogenic Escherichia coli ZK-XC-13QG-3 that is sensitive to ampicillin, pick a single colony that grows well on the LB plate and inoculate it into 5 mL of LB liquid culture medium, and culture it at 37°C and 200 rpm overnight;

[0100] Step 2: Aseptically inoculate 1 mL of overnight culture into 100 mL of autoclaved LB medium and culture at 37°C with shaking at 200 rpm until OD 600 About 0.4;

[0101] Step 3: Place the bacterial solution on ice for 30 min, then transfer it to a pre-cooled 50 mL centrifuge tube and centrifuge at 4°C, 3000 rpm for 20 min.

[0102] Step 4: Discard the supernatant and place on ice, and suspend the cells with 10 mL of ultrapure water that has been thawed after freezing;

[0103] Step 5, repeat steps 3 and 4 to centrifuge, wash with ultrapure water three times, and then wash with deionized water once with 10% sterile glycerol;

[0104] Step 6. Finally, add 500 μL of 10% sterilized glycerol, gently suspend the bacteria, and dispense into pre-cooled autoclaved EP tubes, about 100 μL per tube. If not used immediately, store in a -80℃ refrigerator for later use.

[0105] 5. Electrotransformation of avian pathogenic Escherichia coli ZK-XC-13QG-3 competent cells

[0106] Preparation: Add 75% ethanol to the cleaned electroporation cup, sterilize and blow dry on a clean bench, and desalt the extracted recombinant plasmid pBV-E-SN;

[0107] The electroconversion parameters were resistance 200Ω, capacitance 25μF, and voltage 1.8kV;

[0108] Take 10 μL of the desalted recombinant plasmid pBV-E-SN and add it to the prepared avian pathogenic Escherichia coli ZK-XC-13QG-3 competent cells sensitive to ampicillin, and place them on ice for 10 minutes;

[0109] Pour the above mixture into the pre-cooled electric rotating cup, and be sure to wipe off the moisture on the surface of the electric rotating cup, and then put the electric rotating cup into the sample tank;

[0110] After pulse electroporation, remove the electroporation cup, quickly add 800 mL of LB medium to the mixture in the electroporation cup and mix well, then transfer to a sterile EP tube and culture at 28°C, 200 rpm for 3-4 hours. Spread on an LB plate containing 100 μg / mL ampicillin and culture at 28°C for 24 hours until colonies appear.

[0111] 6. Identification of transformants

[0112] A single colony on the LB plate containing 100 μg / mL ampicillin was picked and inoculated into 5 mL of LB liquid culture medium containing 100 μg / mL ampicillin, and cultured at 28°C and 200 rpm for 14 h for bacterial liquid PCR identification.

[0113] 7. Determination of lysis kinetics and lysis rate of avian pathogenic Escherichia coli ghosts

[0114] The avian pathogenic Escherichia coli recombinant bacteria containing pBV-E-SN that were identified as positive were streaked and inoculated. After overnight culture, the lysis kinetics of the avian pathogenic Escherichia coli shadows were measured and the lysis rate was calculated (the method was the same as the lysis kinetics test of the recombinant bacteria DH5а).

[0115] 8. Scanning electron microscopic observation of avian pathogenic Escherichia coli

[0116] The prepared avian pathogenic Escherichia coli bacterial shadows were centrifuged and fixed with a 2.5% glutaraldehyde solution at room temperature for 2 hours. After a series of treatments, the bacterial shadows were observed under a scanning electron microscope.

[0117] 3. Preparation of bacterial ghost vaccine and its immune protection effect on chickens

[0118] 1. Primer design and synthesis

[0119] Primers were designed based on the G. anatis flfA gene to detect swab bacterial excretion and tissue bacterial load. The primers for determining bacterial excretion were flfA-F1 and flfA-R1, and the primers for detecting G. anatis load in various organs and tissues were flfA-qF and flfA-qR (Table 9).

[0120] Table 9 List of sequences used in this experiment

[0121]

[0122] 2. Preparation of bacterial ghost vaccine

[0123] Preparation of bacterial shadows: a. Resuscitate the avian pathogenic E. coli recombinant bacteria containing pBV-E-SN on an LB plate containing 100 μg / mL ampicillin, pick a single clone and culture it in 5 mL LB liquid medium containing 100 μg / mL ampicillin at 28°C, 200 rpm for 16 h; b. Inoculate the bacterial solution from the previous step 1:100 into 100 mL LB liquid medium containing 100 μg / mL ampicillin for expansion culture, and culture it at 28°C, 200 rpm until OD 600 When the p-value reaches about 0.4, the temperature is rapidly raised to 42°C to induce protein E-SN co-expression, and then cultured at 200 rpm for 4 hours; c. Centrifuge the induced bacterial solution at 8000 rpm for 15 minutes, and discard the supernatant; d. Wash the collected bacterial cells with 5 mL of sterile PBS, and then centrifuge again at 8000 rpm for 15 minutes, and discard the supernatant; e. Repeat step d once; f. Resuspend the collected bacterial cells in 3 mL of sterile PBS, then transfer to an ampicillin bottle, pre-freeze at -20°C for 12 hours, and then pre-freeze at -80°C for 4 hours; g. Place the pre-frozen sample in a freeze dryer for 24 hours to obtain freeze-dried bacterial powder, which is stored in a -80°C refrigerator for later use.

[0124] The concentration of the PBS is 0.01 M and the pH is 7.2. The concentration and pH of the PBS used in the present invention are the same.

[0125] Sterility test: resuspend 5 mg of bacterial shadow lyophilized powder in sterile 0.01 mol / mL PBS and adjust the concentration to 1.0×10 8 CFU / mL, spread on LB solid culture plates containing 100 μg / mL ampicillin, and culture at 37°C for 48 hours. If no colonies grow, it means that the bacteria are completely inactivated, and repeat three times.

[0126] Loading plasmid: Load the pCAGGS-flfA plasmid into the avian pathogenic Escherichia coli ghost to prepare the ghost vaccine. The specific steps are as follows: 5 mg (containing 10 8 The lyophilized powder (CFU bacterial shadow) was resuspended in 100 μL PBS buffer containing pCAGGS-flfA plasmid (concentration 1 mg / mL), CaCl2 was added to a final concentration of 50 mM, and incubated at 37°C for 30 min. The precipitate and supernatant were collected by centrifugation at 8000 rpm for 5 min, and the precipitate was resuspended in PBS buffer and stored at -20°C. The concentration of plasmid DNA in the supernatant was measured to calculate the loading rate. Loading rate = (1-DNA concentration in supernatant / plasmid concentration before loading) × 100%.

[0127] Sterility test of bacterial ghost-loaded DNA vaccine: Spread 200 μL of the prepared bacterial ghost-loaded nucleic acid vaccine onto an LB solid culture plate containing 100 μg / mL ampicillin, and culture at 37°C for 48 h to detect the presence of bacterial growth.

[0128] 3. The immune protection effect of bacterial ghost vaccine on chickens

[0129] (1) Animal grouping, immunization and challenge procedures

[0130] After 50 one-day-old chicks were adaptively raised to one week old, they were randomly divided into 5 groups. The specific grouping is as follows: Group I to Group IV each had 10 chickens / group, which were immunized with pCAGGS-flfA plasmid, BG loaded with pCAGGS-flfA plasmid, BG control group, and PBS as the non-immunized challenge group; the Control group was a normal feeding group and was immunized by intramuscular injection. The specific immunization procedure and dose are shown in Table 10. The second booster immunization was performed 2 weeks after the first immunization, and the chickens were challenged 4 weeks after the first immunization. The challenge was carried out with a duck-derived Gallinaceus strain. The duck-derived Gallinaceus PDS-RZ-1-SLG strain was slightly modified according to our previous research model. The duck-derived Gallinaceus PDS-RZ-1-SLG strain was injected intramuscularly at a dose of 1×10 9 The disease development of the chickens was observed within 7 days, and the protective effect was evaluated by bacterial excretion and bacterial load rate in organs.

[0131] The duck-derived Gallinaceus PDS-RZ-1-SLG strain was publicly published in the journal "Cloning and Structural and Functional Analysis of Outer Membrane Protein W Gene of Duck-derived Gallinaceus" in the "Chinese Journal of Veterinary Medicine".

[0132] Table 10 Animal immunization and challenge grouping scheme

[0133]

[0134] Note: flfA plasmid refers to the pCAGGS-flfA recombinant expression plasmid, also known as pCAGGS-flfA plasmid; BG loaded with pCAGGS-flfA plasmid refers to the vaccine loaded with the recombinant plasmid pCAGGS-flfA by bacterial ghosts (bacterial ghost vaccine); empty bacterial ghosts (BG) refers to bacterial ghost freeze-dried powder.

[0135] (2) Bacteria detection

[0136] The chickens were challenged with the virus 4 weeks after the first vaccination, and then the throat swabs and cloacal swabs of each group were collected every 24 hours. 500 μL of sterile 30% glycerol in PBS was added to each swab, which was thoroughly vortexed and frozen at -80°C. PCR was used later to detect the virus excretion. The primers used for PCR are shown in Table 9.

[0137] (3) ELISA to detect antibody levels

[0138] Blood was collected from the wing vein before the first immunization and every week after immunization, and the serum was separated to measure the anti-G. anatis serum antibody level as follows:

[0139] Use purified pET32a-FlfA protein as coating antigen (100ng / well), incubate at 37℃ for 4h, then overnight at 4℃, and wash 3 times with PBST. Then block with 5% skim milk (200μL / well) at 37℃ for 1h. After washing 3 times with PBST, add 100μL of test serum (1:80 dilution) to the reaction well, set up 3 replicate wells, and incubate at 37℃ for 1h; after washing 3 times with PBST, add 100μL HRP-labeled rabbit anti-chicken IgG secondary antibody (1:8000 dilution) to each well and incubate at 37℃ for 1h; after washing 3 times with PBST, add 100μL TMB single-component colorimetric solution to each reaction well, and color at 37℃ for 15min; finally, add stop solution to each well to terminate the reaction, and measure OD on the microplate reader. 450 OD value at nm.

[0140] (4) Detection of bacterial load in tissues and organs

[0141] All surviving chickens were euthanized 7 days after the challenge, and all experimental chickens were dissected to observe and record clinical necropsy lesions. The palate, trachea, lungs, spleen, and liver of the G. anatis-challenged experimental chickens in each group and the Control group were collected to measure the bacterial load in each tissue. The specific steps are as follows:

[0142] Establishment of a fluorescent quantitative PCR method for flfA gene of Gallinaceus from duck:

[0143] a. Preparation of standard plasmid

[0144] According to the instructions of the DNA extraction kit, the duck-derived Gallinaceus genomic DNA was extracted as a template, and the flfA gene was amplified using the flfA-qF and flfA-qR primers in Table 9. The PCR reaction system is shown in Table 11, and the PCR reaction program is shown in Table 12.

[0145] Table 11 PCR reaction system

[0146] Reagents dose cDNA 2μL Primer flfA-qF 1μL Primer flfA-qR 1μL 2×Mix 25μL <![CDATA[ddH2O]]> Up to 50μL

[0147] Table 12 PCR reaction program

[0148]

[0149] The 109 bp product was recovered from the gel and cloned using the pMD18T vector kit. The ligation system was as shown in Table 13 and the ligation was performed at 16°C for 3 h.

[0150] Table 13 Ligation system of pMD18T vector cloning products

[0151] pMD18-T vector 1μL flfA gene 1μL <![CDATA[ddH2O]]> 3μL Solution I 5μL

[0152] The recombinant plasmid that was successfully constructed was named pMD18T-flfAq. The constructed pMD18T-flfAq recombinant plasmid was extracted and the plasmid concentration was determined to be 66 ng / μL. The copy number of the recombinant plasmid was calculated according to the conversion formula:

[0153] Number of copies = (plasmid concentration ng / μL × 6.02 × 10 23 ) / (DNA length×10 9 ×660Da / bp), the quasi-plasmid copy number was calculated to be 2.7×10 10 copies / μL.

[0154] b. Drawing of standard curve

[0155] The pMD18-T-flfAq plasmid standard was diluted 10-fold to 1.0×10 4copies / μL~1.0×10 8 The optimal reaction conditions were used to establish the standard curve of fluorescent quantitative PCR for detecting the number of copies of the flfA gene of Gallinaceus from ducks. According to the instructions of 2×ChamQ Universal SYBR qPCR Master Mix, the system was set up with 20μL, including 10μL of 2×TaqDNA Master Mix, 1μL of upstream and downstream primers (10μmol / L), 2μL of diluted pMD18T-flfAq template, and 20μL of dd H2O. The reaction procedure was as follows: pre-denaturation at 95℃ for 1min; followed by 40 cycles of 95℃ for 10s, annealing temperature at 53℃ for 15s, and 72℃ for 10s; 95℃ for 15s, 60℃ for 30s, and 95℃ for 15s to collect the fluorescence signal to obtain the melting curve of the amplified product. The logarithm of the plasmid copy number was used as the horizontal axis and the corresponding cycle threshold (Cq) was used as the vertical axis to establish the standard curve. The diluted standard plasmid was used as the template and the optimized reaction conditions were used for fluorescent quantitative PCR amplification. Each dilution was repeated 3 times, and the fluorescent quantitative standard curve was drawn.

[0156] Bacterial load determination:

[0157] In order to determine the load of duck-derived Gallinaceus in each tissue and organ, 0.1 g of tissue was weighed and total DNA was extracted using a DNA extraction kit, and the real-time fluorescence quantitative PCR method was used to determine the bacterial copy number in each organ.

[0158] 4. Data statistical analysis: The experimental data of the present invention were analyzed and plotted using the statistical software Graphpad Prism 9. The data statistics were expressed as Mean ± SD. The data were analyzed using t-test and one-way analysis of variance. P < 0.05 was considered statistically significant (significant difference).

[0159] IV. Experimental Results

[0160] 1. Construction and identification of recombinant plasmid pCAGGS-flfA

[0161] (1) PCR amplification of flfA gene

[0162] The results are as follows Figure 1 As shown, the flfA gene of duck-derived Gallinaceus was amplified by PCR, and the target gene fragment length was 597 bp amplification product.

[0163] (2) Identification of recombinant plasmid pMD18T-flfA

[0164] The flfA target gene fragment was successfully ligated to pMD18-T after gel recovery. Figure 2As shown, the PCR amplification results of pMD18T-flfA positive clones amplified the target gene, and the length of the target gene fragment was 597bp.

[0165] The pMD18T-flfA plasmid identified by PCR was digested with EcoRI and KPnI, and the pMD18T-flfA plasmid was cut into two fragments of about 2692 bp and 597 bp, which was consistent with expectations (such as Figure 3 ), and the sequencing results were also consistent with the target sequence, proving that the recombinant plasmid pMD18T-flfA was successfully constructed.

[0166] (3) Identification of recombinant plasmid pCAGGS-flfA

[0167] The constructed pCAGGS-flfA was identified by PCR. The target gene was amplified in lanes 1-3 and 5-15. The fragment length was 597 bp, which was consistent with the expected size ( Figure 4 ).

[0168] The pCAGGS-flfA plasmid identified by PCR was digested with EcoRI and KPnI, and the recombinant plasmid was cut into two fragments of about 4807 bp and 597 bp ( Figure 5 ), the size of the restriction fragments and the sequencing results were consistent with expectations, indicating that the recombinant plasmid pCAGGS-flfA was successfully constructed.

[0169] (4) In vitro expression of recombinant plasmid pCAGGS-flfA

[0170] To verify whether the recombinant plasmid pCAGGS-flfA can correctly express the duck-derived Gallinaceus FlfA protein, the plasmid pCAGGS-flfA was transfected into HD11 cells, lysed, and the supernatant was collected. Western blot was performed using a homemade anti-duck-derived Gallinaceus polyclonal antibody as the first antibody and HRP-labeled goat anti-rabbit IgG as the second antibody. The results showed that a 22kDa protein band consistent with the molecular weight of the duck-derived Gallinaceus FlfA protein was detected ( Figure 6 ). This proves that the recombinant plasmid pCAGGS-flfA correctly expresses the duck-derived Gallinaceus FlfA protein.

[0171] 2. Preparation of avian pathogenic Escherichia coli ghosts

[0172] (1) Synthesis and construction of pBV-E-SN

[0173] The E gene and the SNA gene were connected by a 15-amino acid (Gly-4-Ser) linker to synthesize the gene E-SN and connect it to the pBV220 vector. At the same time, the recombinant plasmid pBV-E-SN was obtained by transformation of Escherichia coli DH5а and screening. It was further identified by liquid PCR ( Figure 7 ) and double digestion with EcoRI and SalI for identification ( Figure 8 ), the target fragments were about 3650bp and 770bp in size, both of which were consistent with the expected fragment sizes.

[0174] The sequencing results were further compared with the synthetic gene E-SN, and the comparison results showed 100% consistency.

[0175] (2) Lysis kinetics and lysis rate of recombinant DH5а

[0176] Lysis kinetic curve drawing: at 28℃, the bacterial solution was cultured to OD 600 After the temperature was 0.4, it was quickly raised to 42℃ to induce bacterial lysis. Within 30 minutes of induction, OD 600 The absorbance value increased briefly and then began to decrease. OD 600 The absorbance value remained basically unchanged. During the culture at 28℃ in the uninduced control group, the OD 600 The absorbance value continued to rise ( Fig. 9 ).

[0177] Lysis rate determination and results: The live bacterial colonies were counted before and after induction. The live bacterial count of the bacterial solution before induction was 4.1×10 8 The number of viable bacteria in the bacterial culture after CFU / mL induction was 2.0×10 5 CFU / mL, after temperature induction, 99.95% of the recombinant DH5а bacteria were successfully lysed.

[0178] (3) Electroporation of recombinant plasmids and identification of transformants Identification of recombinant plasmids

[0179] After the recombinant plasmid was electroporated into competent cells of avian pathogenic Escherichia coli, the suspected single clone was selected for expansion culture and the plasmid was extracted for PCR identification. The results showed that the target band was amplified and the band size was 780 bp, which was consistent with the expectation ( Fig.10 ).

[0180] (4) Lysis kinetics and lysis rate of recombinant avian pathogenic Escherichia coli

[0181] Lysis kinetic curve drawing: at 28℃, the bacterial solution was cultured to OD 600 When the absorbance value reached 0.4, the temperature was quickly raised to 42°C to start induction. Within 30 minutes of induction, OD600 The absorbance value increased briefly and then began to decrease. At 210 min after induction, the OD 600 The absorbance value reached the lowest. During the culture process of the uninduced control group, OD 600 The absorbance value continued to rise ( Fig.11 ).

[0182] Lysis rate determination results: The live bacterial colonies were counted before and after induction. The live bacterial count of the bacterial solution before induction was 3.4×10 8 CFU / mL, the number of viable bacteria in the bacterial solution after induction was 2.0×10 5 CFU / mL, 99.94% of the avian pathogenic Escherichia coli electroporated into pBV-E-SN were successfully lysed after temperature induction.

[0183] (5) Scanning electron microscopy observation of bacterial shadow morphology

[0184] The results of scanning electron microscopy of bacterial shadows prepared after induction culture at 42°C are as follows Fig.12 As shown, a transmembrane pore structure formed in the center of the bacteria can be observed. The surface of the bacteria is wrinkled, but the morphology has not changed significantly and remains in a complete rod shape.

[0185] 3. Preparation of bacterial ghost vaccine and its immune protection effect on chickens

[0186] (1) Sterility testing of bacterial ghost freeze-dried powder and bacterial ghost loaded DNA vaccine

[0187] The diluted solution of freeze-dried powder of avian pathogenic Escherichia coli ghosts and the DNA vaccine loaded with the ghosts were evenly spread on LB solid culture medium for culture. The plates were inverted and cultured in a 37°C incubator overnight. No live bacteria grew on the plates, indicating that the sterility test of the ghosts and the plasmids loaded with them was qualified.

[0188] (2) Loading rate of bacterial ghost loading plasmid

[0189] Before the pCAGGS-flfA plasmid was loaded into the ghosts of avian pathogenic Escherichia coli, the plasmid concentration was 1 mg / mL. After the ghosts were loaded with the plasmid, the DNA concentration in the supernatant was measured to be 310 μg / mL, and the loading rate was calculated to be 69%.

[0190] (3) Clinical symptoms

[0191] 14 days after the second immunization, the four groups were challenged with duck-derived Gallinaceus. There was no death in any group within 7 days after the challenge, but some chickens in Group III (empty bacteria group) and Group IV (PBS challenge group) had ruffled feathers, lack of energy, and diarrhea on the second day after the challenge with duck-derived Gallinaceus. The chickens gradually returned to normal on the fourth day. There was no obvious clinical difference between the other groups and the normal control group.

[0192] (4) Bacteria excretion assay

[0193] Cloacal swabs and pharyngeal swabs were collected from each group of chickens every 24 hours within 1-7 days after the challenge to detect the excretion of the chickens in each group. The excretion of the chickens in the group challenged with duck-derived Gallinaria is shown in Tables 14 and 15. The chickens in the immunized group stopped excreting bacteria 2 and 3 days after the challenge, respectively. All chickens in the non-immunized challenge group continued to excrete bacteria until the end of the experiment. All swab samples in the control group (non-immunized and non-challenged group) were negative.

[0194] Table 14 Detection of G. anatis in cloacal swabs

[0195]

[0196]

[0197] Table 15 Detection of G. anatis in throat swabs

[0198]

[0199] (5) Monitoring of specific antibody levels after immunization

[0200] After immunization of one-week-old chickens, serum was collected by blood sampling from the subwing vein, and the specific antibody response induced after immunization was measured by indirect ELISA method.

[0201] The results are as follows Fig.13 and 14 As shown, 7 days after the first immunization, the antibodies in group III (empty bacterial shadow group) and group IV (PBS group) did not increase significantly, and there was no difference from the Control group; the antibody levels in the other two immune groups gradually increased, and the differences in antibody levels compared with the Control group were extremely significant, but there was no significant difference between the two immune groups; after the second immunization, the antibody levels in group I and group II increased rapidly, and as time went on, the antibody level in group II was significantly higher than that in group I, indicating that the antibody level in the immune plasmid group was significantly lower than that in the bacterial shadow loaded plasmid group.

[0202] (6) Establishment of standard curve for fluorescence quantitative PCR

[0203] Select 1×10 3 -1×10 8 The pMD18T-FflA plasmid with a dilution of 10 copies / μL was used as a template for SYBR GreenI fluorescence quantitative PCR. The results were analyzed using Bio-Rad CFX Maestro software. The slope of the standard curve was -3.063 and the vertical intercept was 37.947. The standard curve equation established with the copy number as X and the Cq value as Y was Y = -3.063x + 37.947, and the correlation coefficient R 2 The amplification efficiency Eff is 112.1%, and the standard curve and melting curve are shown below. Fig.15 and Fig.16 .

[0204] (7) Tissue and organ bacterial load results

[0205] The bacterial load in spleen, liver, trachea, palate cleft and lung was measured by fluorescent quantitative PCR method of Gallinarum from duck. The results are as follows Fig.17 As shown, after challenge, the bacterial copy numbers in the liver, trachea, palatal cleft and lung tissues of the chickens in group I (pCAGGS-flfA plasmid) and group II (BG loaded with pCAGGS-flfA plasmid) immunized groups were significantly lower than those in group III (empty bacterial shadow group) and group IV that was not immunized, and the bacterial copy number in the bacterial shadow loaded plasmid group (group II) was significantly lower than that in the plasmid immunized group (group I).

[0206] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0207] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A bacterial ghost vaccine, It is characterized in that The bacterial ghost vaccine is obtained by loading the pCAGGS-flfA plasmid into the bacterial ghost of avian pathogenic Escherichia coli; The pCAGGS-flfA plasmid is obtained by connecting the flfA gene to the EcoRI and KPnI restriction sites of the pGAGGS vector; The preparation process of the avian pathogenic Escherichia coli ghost is as follows: the phage lysis gene E and the Staphylococcus aureus nuclease A synthesis gene E-SN are connected to a vector, Escherichia coli is transformed and screened to obtain a recombinant plasmid, and then the recombinant plasmid is transferred into avian pathogenic Escherichia coli competent cells that are sensitive to ampicillin to obtain recombinant Escherichia coli bacteria, and after expanded culture, the protein E-SN co-expression is induced, the bacteria are collected by centrifugation, washed, and then resuspended and freeze-dried to obtain the avian pathogenic Escherichia coli ghost.

2. The bacterial ghost vaccine according to claim 1, It is characterized in that The process of loading the pCAGGS-flfA plasmid into the avian pathogenic Escherichia coli bacterial ghost is as follows: resuspending the bacterial ghost in a PBS buffer containing the pCAGGS-flfA plasmid, and the usage ratio of the bacterial ghost to the PBS buffer is: 10 6 CFU~10 10 CFU: 100μL~120μL; The concentration of the pCAGGS-flfA plasmid in the PBS buffer is 0.4 mg / mL to 1 mg / mL.

3. The bacterial ghost vaccine according to claim 1, It is characterized in that The gene E-SN was connected to the pBV220 vector.

4. The bacterial ghost vaccine according to claim 1, It is characterized in that The recombinant plasmid was transformed into competent cells of avian pathogenic Escherichia coli sensitive to ampicillin by electroporation.

5. The bacterial ghost vaccine according to claim 1, It is characterized in that The expansion culture process is as follows: the recombinant E. coli is cultured in LB liquid medium containing ampicillin at 28°C to 30°C and 200rpm to 220rpm until the OD 600 It is 0.4~0.

5.

6. The bacterial ghost vaccine according to claim 1, It is characterized in that The process of inducing protein E-SN co-expression is: rapidly raising the temperature to 42°C to induce protein E-SN co-expression.

7. The bacterial ghost vaccine according to claim 1, It is characterized in that The centrifugation condition is 7000 rpm to 8000 rpm for 10 min to 15 min.

8. The bacterial ghost vaccine according to claim 1, It is characterized in that Before freeze-drying, pre-freeze the bacteria resuspended in PBS at -20℃ for 12h and then at -80℃ for 4h.

9. The bacterial ghost vaccine according to claim 1, It is characterized in that The preparation process of the pCAGGS-flfA plasmid is as follows: amplifying a flfA gene with a length of 597 bp, and then connecting it with a pMD18-T vector to obtain a pMD18T-flfA recombinant plasmid; using restriction endonucleases KPnI and EcoRI to cut the flfA gene from the recombinant plasmid pMD18T-flfA to obtain a flfA gene fragment, and using restriction endonucleases KPnI and EcoRI to digest the pGAGGS vector to obtain a pCAGGS vector fragment; and then using T 4 DNA ligase was used to connect the flfA gene fragment and the obtained pCAGGS vector fragment to obtain the pCAGGS-flfA recombinant expression plasmid, referred to as pCAGGS-flfA plasmid.

10. Use of the bacterial ghost vaccine according to any one of claims 1 to 9 in the preparation of a product for preventing diseases caused by Gallobacterium infection in ducks, It is characterized in that The product is a vaccine preparation with the bacterial ghost vaccine as the only active ingredient.

Images