Vietnamese sophora root copper amine oxidase, gene and application of vietnamese sophora root copper amine oxidase in increasing content of matrine and oxymatrine in plants

Abstract

The invention belongs to the field of crop genetic breeding, relates to cultivation of vietnamese sophora root with high matrine and oxymatrine content, and in particular relates to a vietnamese sophora root copper amine oxidase, a gene and an application of the vietnamese sophora root copper amine oxidase in increasing the matrine and oxymatrine content of plants. According to the application, copper amine oxidase (CAO) of subprostrate sophora is found, and the biosynthesis of matrine and oxymatrine of the subprostrate sophora is improved by utilizing a CAO gene. According to the invention, a tobacco plant with a transgenic subprostrate sophora StCAO gene is obtained through a transgenic technology, and it is found that the expression of StCAO can positively regulate and control biosynthesis of matrine and oxymatrine of subprostrate sophora. The invention provides a new thought for cultivating and producing plants with high matrine and oxymatrine content, especially vietnamese sophora root.

Description

Technical Field

[0001] The invention belongs to the field of crop genetic breeding, relates to the cultivation of Sophora flavescens with high matrine and oxymatrine content, and particularly refers to a Sophora flavescens copperamine oxidase, a gene and an application in improving the matrine and oxymatrine content of plants. Background Art

[0002] Sophora vietnamese Sophoratonkinensis Gagnep.) is the original plant of the commonly used bulk medicinal material and the authentic medicinal material of Guangxi "Gui Shiwei". People are accustomed to calling it Sophora flavescens. Because its seeds are strong in shattering and difficult to reproduce naturally, and it is mostly grown in subtropical or temperate rocky mountains or limestone mountain shrub forests, it is a national second-level protected endangered wild plant. Sophora flavescens has the effects of clearing away heat and detoxifying, relieving swelling and relieving sore throat. The "Pharmacopoeia of the People's Republic of China" (2020 edition) records that the ingredients for the quality evaluation of Sophora flavescens medicinal materials are the total content of alkaloid substances-matrine and oxymatrine. Matrine and oxymatrine belong to quinolizidine alkaloids. Lysine decarboxylase (LDC) is the first key enzyme in the Sophora flavescens quinolizidine alkaloid pathway, converting lysine into cadaverine, which is oxidatively deaminated by copperamine oxidase (CAO), and then reacted under the catalysis of a series of enzymes to form quinolizidine alkaloids. Application with publication number CN115820764A discloses a method for increasing the production of matrine by Sophora japonica by using endophytic fungus TRXY-59-2; Application with publication number CN112005884A discloses the purpose of increasing the content of alkaloids in Sophora japonica by using selenium fertilizer; however, in the era of biological science, there has been no research report on increasing the alkaloid content in Sophora japonica by using key genes. Summary of the invention

[0003] The present invention proposes a sophora flavescens copperamine oxidase, a gene and an application in increasing the content of matrine and oxymatrine in plants, which solves the problem of low yield of matrine and oxymatrine in sophora flavescens and provides a new idea for cultivating sophora flavescens with high matrine and oxymatrine content.

[0004] The technical solution of the present invention is achieved in this way: The present application provides a Sophora flavescens copper amine oxidase, the amino acid sequence of which is shown in any of the following: (1) The amino acid sequence shown in SEQ ID No. 2; (2) The amino acid sequence shown in SEQ ID No. 2 has one or more amino acids inserted, deleted or mutated and still has the amino acid function of (1); (3) A protein consisting of a protein having an amino acid sequence as shown in SEQ ID No. 2 and a protein that promotes the expression, extracellular secretion or purification of the protein.

[0005] The nucleotide sequence of the gene encoding the above-mentioned Sophora flavescens copper amine oxidase is shown in any one of the following: 1) A nucleic acid sequence encoding the Sophora flavescens copperamine oxidase according to claim 1; 2) A nucleic acid sequence that is the reverse complement of the nucleic acid sequence in 1).

[0006] Furthermore, the above nucleic acid sequence has a similarity of more than 90% with the sequence described in SEQ ID No.1.

[0007] Preferably, the above nucleic acid sequence is shown as SEQ ID No.1.

[0008] Application of the above-mentioned Sophora flavescens copperamine oxidase or the above-mentioned gene in regulating the content of matrine and oxymatrine in plants.

[0009] The above application can improve the content of matrine and oxymatrine in plants by increasing the content of copperamine oxidase in Sophora flavescens.

[0010] The above application can also improve the content of matrine and oxymatrine in plants by overexpressing the gene encoding Sophora tonkinensis copperamine oxidase.

[0011] A method for increasing the content of matrine and oxymatrine in plants comprises the following steps: constructing an overexpression vector of a Sophora flavescens copperamine oxidase gene, genetically transforming the vector into a plant to be improved, and obtaining a plant with high matrine and oxymatrine content.

[0012] The nucleotide sequence of the Sophora tonkinensis copper amine oxidase gene is shown in SEQ ID No. 1, and the plant is Sophora tonkinensis or Nicotiana tabacum.

[0013] The primer pair used in the above overexpression vector is CAO(+) and CAO(-): CAO(+) (SEQ ID No.3): AACACGGGGGACTTTGCAACatgaagatcttgatcttctttgtcctcacgatc; CAO(-) (SEQ ID No. 4): TGAAGACAGAGCTAGTTACActaatgttgagaagtgcagttaggccag.

[0014] The system for overexpression amplification of the target gene is as follows: a 50 μl reaction system is designed: 20 μL of nuclease-free water, 25 μL of high-fidelity enzyme 2×Biorun PfuPCRMix, 2 μL of CAO(+), 2 μL of CAO(-), and 1 μL of cDNA.

[0015] The PCR amplification program was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 sec, 50°C annealing for 45 sec, 72°C extension for 120 sec, for a total of 30 cycles, 72°C extension for another 10 min, and finally storage at 16°C.

[0016] The present invention has the following beneficial effects: 1. This application discovered copperamineoxidase (CAO) from Radix Sophorae Tonkinensis and used it to CAO The gene improves the biosynthesis of matrine and oxymatrine in Sophora flavescens. The invention obtains the transgenic Sophora flavescens by genetic engineering technology. StCAO Gene found in tobacco plants StCAO The expression of can positively regulate the biosynthesis of matrine and oxymatrine in Sophora flavescens. This provides a new idea for cultivating plants with high matrine and oxymatrine content, especially Sophora flavescens.

[0017] 2. The present invention constructs Sophora flavescens StCAO Gene overexpression vector was used to transform the gene and confirm StCAO The gene can positively regulate the biosynthesis of quinolizidine alkaloids in plants. Compared with the wild-type plant (WT), StCAO The transgenic tobacco OE-2, OE-3, OE-4, and OE-7 increased by 160.19%, 236%, 12.96%, and 84.72%, respectively, and the oxymatrine content increased by 65.00%, 88.91%, 7.64%, and 18.54%, respectively, compared with the wild-type plants (WT). StCAO The gene can increase the content of matrine and oxymatrine in plants, providing a theoretical basis for breeding and producing plants with high matrine and oxymatrine content. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 is pBWA(V)HS-O- sCAOVector map; the vector eukaryotic resistance: Hygromycin, the prokaryotic resistance: Kanamycin.

[0020] Figure 2 For transfer StCAO PCR detection of gene plants; Lane M: Marker 2000, 1500, 1000, 750, 500, 250, 100 bp, Lane 1: positive control (vector plasmid) PCR product, Lane 2: negative control (wild-type tobacco) PCR product, Lane 3: negative control (water) PCR product, Lanes 4-10: positive transformant PCR products.

[0021] Figure 3 Analysis of target gene expression levels in transgenic tobacco.

[0022] Figure 4 This is a growth comparison chart between wild-type tobacco and transgenic tobacco. DETAILED DESCRIPTION

[0023] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0025] The present application provides a Sophora flavescens copper amine oxidase, the amino acid sequence of which is shown in any of the following: (1) The amino acid sequence shown in SEQ ID No. 2; (2) The amino acid sequence shown in SEQ ID No. 2 has one or more amino acids inserted, deleted or mutated and still has the amino acid function of (1); (3) A protein consisting of a protein having an amino acid sequence as shown in SEQ ID No. 2 and a protein that promotes the expression, extracellular secretion or purification of the protein.

[0026] The nucleotide sequence of the gene encoding the above-mentioned Sophora flavescens copper amine oxidase is shown in any one of the following: 1) A nucleic acid sequence encoding the above-mentioned Sophora flavescens copperamine oxidase; 2) A nucleic acid sequence that is the reverse complement of the nucleic acid sequence in 1).

[0027] Furthermore, the above nucleic acid sequence has a similarity of more than 90% with the sequence described in SEQ ID No.1.

[0028] Preferably, the above nucleic acid sequence is shown as SEQ ID No.1.

[0029] Application of the above-mentioned Sophora flavescens copperamine oxidase or the above-mentioned gene in regulating the content of matrine and oxymatrine in plants.

[0030] The above application can improve the content of matrine and oxymatrine in plants by increasing the content of copperamine oxidase in Sophora flavescens.

[0031] The above application can also improve the content of matrine and oxymatrine in plants by overexpressing the gene encoding Sophora tonkinensis copperamine oxidase.

[0032] A method for increasing the content of matrine and oxymatrine in plants comprises the following steps: constructing an overexpression vector of a Sophora flavescens copperamine oxidase gene, genetically transforming the vector into a plant to be improved, and obtaining a plant with high matrine and oxymatrine content.

[0033] The nucleotide sequence of the Sophora tonkinensis copper amine oxidase gene is shown in SEQ ID No. 1, and the plant is Sophora tonkinensis or Nicotiana tabacum.

[0034] The invention obtains the transgenic Sophora flavescens by genetically modifying technology StCAO Tobacco plants with the gene were cloned and the total DNA of Sophora tonkinensis was used as a template. StCAO Gene-specific primers were used for amplification, and the PCR product was recovered after the size of the target gene fragment was detected by electrophoresis, and then connected with the overexpression vector pBWA(V)HS-ccdB and transformed into Escherichia coli DH5a. Single clone transformants were selected for PCR detection. The target band detected was consistent with the expected size, which was a positive clone. StCAO The expression of can positively regulate the biosynthesis of matrine and oxymatrine in Sophora flavescens. This provides a new idea for cultivating plants with high matrine and oxymatrine content, especially Sophora flavescens.

[0035] Specifically, the following embodiments are used as examples for detailed description: Example

[0036] 1. According to the Sophora flavescens StCAO Gene sequence (SEQ ID NO: 1), construct pBWA(V)HS-O- StCAO Overexpression vector 1) Design and synthesize primers: CAO(+):AACACGGGGGACTTTGCAACatgaagatcttgatcttctttgtcctcacgatc; CAO(-): TGAAGACAGAGCTAGTTACActaatgttgagaagtgcagttaggccag; 2) Amplify candidate gene sequences Design a 50μl reaction system: 20μL of nuclease-free water, 25μL of high-fidelity enzyme 2×Biorun Pfu PCR Mix, 2μL of CAO(+), 2μL of CAO(-), and 1μL of cDNA.

[0037] The PCR amplification program was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 sec, 50°C annealing for 45 sec, 72°C extension for 120 sec, for a total of 30 cycles, 72°C extension for another 10 min, and finally storage at 16°C.

[0038] The samples were electrophoresed on 1% agarose gel at 5 v / cm for 20 min. StCAO The electrophoresis fragment (2007bp) was cut out under ultraviolet light, placed in a system for sol recovery, and the DNA was dissolved and recovered with a total volume of 40uL of water. The recovered product was marked as: rDNAS, and after testing, it was recombined with the vector.

[0039] 3) Enzyme digestion, ligation and recombination reaction Enzyme digestion and ligation system: nuclease-free water 13μL, 10*Buffer 2μL, BsaI / Eco31I 1μL, pBWA(V)HS-ccdB 4μL.

[0040] Reaction conditions for enzyme digestion and ligation: 37℃ for 1hours.

[0041] Recombination reaction components: Biorun 2*EasyClone Mix 10μL, rDNAs 5μL, pBWA(V)HS-ccdB 5μL.

[0042] Recombination reaction conditions: 37°C 30min.

[0043] 4) Transformation and plaque PCR identification The ligation product was transformed into competent E. coli DH5a, the plaques were cultured and identified by PCR.

[0044] A single plaque was picked and inoculated with 1.5 ml EP tube and PCR was performed simultaneously. The primers were pBWA(V)HS- StCAO, forward primer HS)35seq: tTCATTTGGAGAGAACACGGGggac, reverse primer: gaaccacaaacctatcagagtaatc. Take 1-3 positive bands corresponding to the bacterial solution, take 100 μL sample for sequencing.

[0045] The positive clone was sequenced and the sequencing result was 2007bp. The overexpression recombinant plasmid containing the target gene obtained after correct sequencing was named pBWA(V)HS-O- StCAO , vector construction schematic diagram see Figure 1 .

[0046] 2. Plasmid Transformation Add 1µL plasmid to 50µL GV3101 Agrobacterium competent cells; mix thoroughly and transfer to an electroporation cup for electroporation. After electroporation, add 1mL LB liquid culture medium, mix thoroughly and transfer to a 1.5mL Eppendorf tube. Incubate in a shaker at 30°C and 180rpm for 30 minutes. Pipette 50µL of the activated Agrobacterium culture solution and inoculate it on LB solid culture medium. Incubate in the dark at 30°C for 48 hours.

[0047] 3. Agrobacterium tumefaciens detection Select a single clone to detect whether the transformation is successful.

[0048] Design a 20 µL PCR reaction system: use pBWA(V)HS-O- StCAO Primers (481 bp) for the hygromycin resistance marker gene in the vector, forward primer (CTGCCCGCTGTTCTACAACCGG) (10µM) 1µL, reverse primer (GGAGCATATACGCCCGGAGTC) (10µM) 1µL, 2×TaqPCRMix 10µL, ddH2O 7µL, template 1µL. Gel electrophoresis was performed to check the PCR amplification results.

[0049] 4. Agrobacterium transformation of Nicotiana benthamiana Tobacco was transformed by the Agrobacterium-mediated leaf disc method, and the mature genetic transformation system of tobacco was used. Sterile Nicotiana benthamiana seedlings grown for about 30 days were used as materials for transgenic experiments. Tobacco leaves were transformed by the Agrobacterium-mediated leaf disc method. The tobacco leaves were placed on the pre-culture medium for 2 days, and then the sterile tobacco leaves were cut into small pieces, infected in the Agrobacterium suspension, placed on filter paper to dry and moved to the co-culture medium for dark culture for 2-3 days. Callus tissue was induced in the tobacco leaves after dark culture. After the vigorous callus tissue grew out, it was transferred to the screening culture medium for differentiation and tiny buds grew out. After the seedlings were formed, they were cut off and transferred to the root induction culture medium for culture. When the transgenic tobacco grows a dense and strong root system, open the bottle cap for 2-3 days of seedling training, then transplant and wait for flowering and fruiting. This is the T0 generation of transgenic tobacco. The specific steps are as follows: 1) Pre-cultivation of leaf discs Soak tobacco seeds in sterilized distilled water for 2 hours, wash twice with sterile distilled water, 1-2 minutes each time, then soak the tobacco seeds in 75% alcohol for 30 seconds for disinfection, wash 3-5 times with sterile water, 1 minute each time; then soak the seeds in 84 disinfectant for 3-5 minutes, wash 3-5 times with sterile water, 1 minute each time; sow the disinfected tobacco seeds on MS culture medium, place them in a 23℃ light incubator for 4-5 weeks (16 hours light / 8 hours dark), cut the sterile tobacco leaves into small pieces with a scalpel and inoculate them on the pre-cultured culture medium (MS+7% agar+2.5% sucrose+0.2 mg / LNAA+1 mg / L6-BA), with the front of the leaves facing down during inoculation, and place about 10 leaf discs in each bottle.

[0050] 2) Agrobacterium infection and co-cultivation Pick Agrobacterium in the infection solution and prepare OD 600 = 0.2 of Agrobacterium resuspension, inoculate tobacco leaves pre-cultured for 2 to 3 days in the Agrobacterium suspension for infection for 10 to 15 minutes, dry the infected tobacco leaves on filter paper, inoculate on co-culture medium (MS + 7% agar + 2.5% sucrose + 0.2 mg / L NAA + 1 mg / L 6-BA + 100 μM acetosyringone), and culture in the dark for 48 to 72 hours.

[0051] 3) Induction The co-cultivated leaves were transferred to induction medium to induce callus for about 10 days.

[0052] 4) Screening Select effective callus tissue and transfer it to the screening medium corresponding to the resistance. The culture time is 15 to 30 days and the temperature is 23±2℃. 5) Differentiation and rooting The positive callus tissue after screening was transferred to differentiation medium (MS+7% agar+2.5% sucrose+1mg / L6-BA+0.2mg / LNAA+500mg / LCef+100mg / LKan), with 4-5 callus tissues in each culture dish, and cultured at 23℃ light for 15-30 days; during the differentiation process, if seedlings are formed in the callus, they will be inoculated into root induction medium (MS+7% agar+2.5% sucrose+0.2mg / LNAA+500mg / LCef+100mg / LKan) for growth.

[0053] 6) Seedling training and transplanting After the tissue culture seedlings grow stably and have roots, open the bottle mouth to harden the plants (2 days). After that, carefully remove the browned tissue, carefully rinse the roots of the transgenic seedlings with tap water, and then transplant them into the prepared seedling culture medium (peat soil and vermiculite in a ratio of 3:1).

[0054] 5. Harvest positive plants Subsequently, the mature transgenic seeds were harvested and sown on a solid medium containing hygromycin for further screening. After germination, the seedlings were transplanted. The transgenic seeds contained recombinant plasmids and could germinate and grow normally in a medium containing antibiotics because of their hygromycin resistance. In contrast, the presence of antibiotics inhibited the growth of non-transgenic plants and even prevented them from germinating. This method was used to finally screen out transgenic plants. StCAO T2 generation transgenic tobacco with genes.

[0055] Using genomic DNA as template, pBWA(V)HS-O- StCAO The primers for the hygromycin resistance marker gene in the vector (forward primer: CTGCCCGCTGTTCTACAACCGG, reverse primer: GGAGCATATACGCCCGGAGTC) were used to detect transgenic plants. The results were as follows Figure 2 As shown, it is determined whether the constructed vector has been transferred into tobacco (T0). The seeds of the positive plants are further screened with hygromycin. After the positive plants to be screened gradually grow up and have a well-developed root system, they can be moved to the greenhouse for conventional culture to obtain T1 generation seeds. The harvested seeds (T1) are screened with MS culture medium to obtain positive plants (T2).

[0056] 6. Genetically modified tobacco StCAO Expression level determination 1) The RNA of different transgenic tobacco strains and control Nicotiana benthamiana seedlings was extracted using the Trizol method.

[0057] 2) Nicotiana benthamiana ( Nicotiana benthamiana) elongation factor gene (NbEF1α) was used as the internal reference gene. Primers (forward primer: TCACTTCAGCCTTTGACCGATTG; reverse primer: ACGCCACATAATATCACCAGCATAC) were used to detect the target gene in different tobacco strains and control Nicotiana benthamiana seedlings by real-time fluorescence quantitative PCR. StCAO expression level.

[0058] To detect StCAO Overexpression in transgenic tobacco. Select T2 transgenic tobacco with positive PCR test results. Use the Nicotiana benthamiana elongation factor gene (NbEF1α) as the internal reference gene for real-time fluorescence quantitative PCR. Use wild-type tobacco (WT) as the control and repeat three times. Results ( Figure 3 ) showed that the exogenous gene in the transgenic plants was successfully expressed, but the expression levels were different. StCAO Positive plants StCAO The expression level was 0.83 to 22690 times that of the control.

[0059] After antibiotic screening, PCR detection and qRT-PCR detection, transgenic tobacco with stable exogenous genes and successful expression was finally obtained.

[0060] VII. Determination of alkaloid content in transgenic tobacco The ESI-HPLC-MS / MS method was used to quantitatively analyze the contents of tobacco matrine and oxymatrine. The contents of tobacco matrine and oxymatrine were determined by Shimadzu LC-30AD high performance liquid chromatograph connected to AB Qtrap6500 mass spectrometer. All samples were repeated 3 times.

[0061] Select the 4 genes with the highest expression level StCAO The matrine and oxymatrine contents of the overexpression lines OE-2, OE-3, OE-4 and OE-7, and wild-type tobacco (WT) were determined, and the results are shown in Table 1 .

[0062] Table 1 Analysis of matrine and oxymatrine content in transgenic tobacco As shown in Table 1, compared with the matrine content of wild-type plants (WT), StCAO The transgenic tobacco OE-2, OE-3, OE-4, and OE-7 increased by 160.19%, 236%, 12.96%, and 84.72%, respectively. Figure 4 As shown: the content of oxymatrine increased by 65.00%, 88.91%, 7.64% and 18.54% respectively compared with the wild type plant (WT). StCAO Genes can increase the content of matrine and oxymatrine in plants.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A Sophora tonkinensis copperamine oxidase, the amino acid sequence of which is shown in any one of the following: (1) The amino acid sequence shown in SEQ ID No. 2; (2) The amino acid sequence shown in SEQ ID No. 2 has one or more amino acids inserted, deleted or mutated and still has the amino acid function of (1); (3) A protein consisting of a protein having an amino acid sequence as shown in SEQ ID No. 2 and a protein that promotes the expression, extracellular secretion or purification of the protein.

2. The gene encoding the Sophora tonkinensis copperamine oxidase according to claim 1, wherein the nucleotide sequence is as shown in any one of the following: 1) A nucleic acid sequence encoding the Sophora flavescens copperamine oxidase according to claim 1; 2) A nucleic acid sequence that is the reverse complement of the nucleic acid sequence in 1).

3. The gene encoding Sophora tonkinensis copperamine oxidase according to claim 2, Features: The nucleic acid sequence has a similarity of more than 90% with the sequence described in SEQ ID No.

1.

4. The gene encoding Sophora tonkinensis copperamine oxidase according to claim 3, Features: The nucleic acid sequence is shown as SEQ ID No.

1.

5. Use of the Sophora flavescens copperamine oxidase according to claim 1 or the gene according to any one of claims 2 to 4 in regulating the content of matrine and oxymatrine in plants.

6. The use according to claim 5, Features: By increasing the content of copperamine oxidase in Sophora flavescens, the content of matrine and oxymatrine in plants can be increased.

7. The use according to claim 5, Features: By overexpressing the gene encoding copperamine oxidase from Sophora flavescens, the content of matrine and oxymatrine in the plant can be increased.

8. A method for increasing the content of matrine and oxymatrine in plants, It is characterized in that The steps are: constructing an overexpression vector of the copperamine oxidase gene of the Radix Sophorae Tonkinensis, genetically transforming it into plants to be improved, and obtaining plants with high matrine and oxymatrine contents.

9. The method for increasing the content of matrine and oxymatrine in Radix Sophorae Tonkinensis according to claim 8, Features: The nucleotide sequence of the Sophora tonkinensis copper amine oxidase gene is shown in SEQ ID No. 1, and the plant is Sophora tonkinensis or Nicotiana tabacum.

10. The method for increasing the content of matrine and oxymatrine in Radix Sophorae Tonkinensis according to claim 8, Features: The primer pair used in the overexpression vector is CAO(+) and CAO(-), wherein the nucleotide sequence of LDC(+) is shown in SEQ ID No.3, and the nucleotide sequence of LDC(-) is shown in SEQ ID No.4.

Images