Acid-resistant alpha-amylase mutant and preparation method thereof

Abstract

The invention discloses an acid-resistant alpha-amylase mutant and a preparation method thereof, and the acid-resistant alpha-amylase mutant is characterized in that alpha-amylase from bacillus velezensis is subjected to site-directed mutagenesis, and the mutagenesis is at least one of S242E, N569E and N605D. The alpha-amylase mutant provided by the invention has good acid stability, when the pH value is 1.9-4.0, the starch hydrolysis catalysis capability of the alpha-amylase mutant provided by the invention is obviously improved, the availability of the alpha-amylase under a wider pH value condition is improved, and the problem of limited application caused by poor acid resistance of the existing alpha-amylase is solved. The method has remarkable effects of improving the raw material utilization rate and the product quality in the starch processing industry and reducing the production cost, meets the requirements of the acid-resistant alpha-amylase in the fields of energy, food, feed and the like, has important social and economic benefits, and is wide in application prospect.

Description

Technical Field

[0001] The invention relates to an alpha-amylase mutant, in particular to an alpha-amylase mutant with enhanced pH tolerance, and belongs to the field of bioengineering. Background Art

[0002] α-Amylase (α-1,4-glucan-4-glucoside hydrolase, EC 3.2.1.1) is an endoglycoside hydrolase that can hydrolyze the α-1,4 glycosidic bonds inside starch molecules to produce dextrins, oligosaccharides, maltotriose, maltose and a small amount of glucose. Under the action of α-amylase, starch is degraded and the viscosity decreases, that is, liquefaction is completed. The importance of α-amylase is reflected in its wide application in many fields, such as: starch gelatinization and syrup production in the sugar industry, paper desizing in the textile industry, agricultural waste production as animal feed or biofuel in the field of resource recycling, and analysis and detection in the pharmaceutical and chemical industries, urban sewage purification, etc. At present, α-amylase is mainly produced in industry by microbial fermentation. Microbial-derived α-amylase mainly comes from Bacillus amyloliquefaciens and Bacillus licheniformis, and the optimal pH of the α-amylase produced by them is 5.0-6.0. When the enzyme solution catalyzes starch hydrolysis under conditions outside this pH range, the enzyme activity is low or even inactivated. Therefore, artificial modification of α-amylase to improve its stability under extreme conditions has become an important research direction for α-amylase.

[0003] Acid α-amylase refers to a type of α-amylase that can maintain high activity under low pH conditions, and its optimal pH value is usually between 4.0 and 5.0. This characteristic makes acid-resistant α-amylase outperform ordinary α-amylase in specific application scenarios such as food processing, medicine, and energy, showing its unique advantages. For example, in the fields of silage, fermented beverages, drug production, and processing of industrial by-products, acid-resistant α-amylase can simplify the processing of starch, allowing processes such as liquefaction and saccharification to be carried out under the same pH conditions, thereby avoiding the complex process of adjusting the pH value in traditional processes, which helps to improve production efficiency and product quality. For example, in the brewing of liquor, acid-resistant α-amylase can make full use of residual starch, thereby improving the utilization rate of raw materials and the yield of liquor, and reducing production costs.

[0004] At present, the methods for obtaining acid α-amylase include genetic modification of acid α-amylase, breeding of strains with high acid α-amylase production, and optimization of fermentation conditions for producing acid α-amylase. Chinese invention patent application CN114457058A discloses a mutation improvement method and application of feed α-amylase, which uses Bacillus velezensis α-amylase as a template to construct a series of new α-amylase mutants, including mutations at positions 546, 572, 614, and 622, respectively, from proline to glutamic acid, histidine to aspartic acid, alanine to glutamic acid, and lysine to glutamic acid. The α-amylase variant has a higher catalytic activity under acidic conditions of pH 2.5-5.5 and high temperature conditions above 80°C. Developing more acid-resistant α-amylases is conducive to meeting the industry demand for efficient and high-quality hydrolysis of starch. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an acid-resistant α-amylase mutant, which has higher enzyme activity under acidic conditions, and provides a nucleic acid molecule encoding the mutant, a vector or recombinant cell or product containing the mutant, and a preparation method and application of the mutant.

[0006] Technical solution: The first aspect of the present invention provides an acid-resistant α-amylase mutant, wherein the amino acid sequence of the α-amylase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is at least one of S242E, N569E, and N605D.

[0007] The present invention uses alpha-amylase from Bacillus velezensis as the original enzyme, selects the loop structure located on the surface of the protein in the secondary structure of the protein for transformation, and mutates it into acidic amino acids. After screening, it is found that mutating the amino acid at position 242, position 569 or position 605 of the alpha-amylase into acidic amino acids increases the surface negative charge and improves the acid resistance of the enzyme mutant.

[0008] The present invention uses standard single letters and standard substitution notation for amino acids: S242E means that the serine (S) at position 242 of the N-terminus is mutated to glutamic acid (E); N605D / S242E means that the asparagine (N) at position 605 of the N-terminus is mutated to aspartic acid (D), and the serine (S) at position 242 of the N-terminus is mutated to glutamic acid (E).

[0009] In a second aspect, the present invention provides a nucleic acid molecule encoding the α-amylase mutant described in the first aspect. The nucleic acid molecule can express the acid-resistant α-amylase mutant.

[0010] Furthermore, the nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO.2.

[0011] In a third aspect, the present invention provides a vector comprising the nucleotide sequence described in the second aspect. The vector is capable of amplifying or expressing the nucleotide sequence.

[0012] Furthermore, the vector includes a cloning vector or an expression vector. The vector can be a plasmid or a virus.

[0013] In a fourth aspect, the present invention provides a recombinant cell, wherein the recombinant cell comprises the vector described in the third aspect.

[0014] In a fifth aspect, the present invention provides a method for preparing the α-amylase mutant according to the first aspect, comprising the following steps:

[0015] (1) Using the α-amylase gene as a template and using point mutation primers to perform PCR reaction to obtain the α-amylase mutant gene;

[0016] (2) inserting the α-amylase mutant gene into an expression vector and then transferring it into a host cell to obtain a recombinant cell;

[0017] (3) Collect the recombinant cells expressing the α-amylase mutant, resuspend the cells and then break the cells, and centrifuge to obtain the supernatant to obtain the crude enzyme solution containing the α-amylase mutant.

[0018] The alpha-amylase mutant obtained by the preparation method has good acid stability.

[0019] Furthermore, in (2), the α-amylase mutant gene is inserted into the expression vector using a DNA homologous recombination method.

[0020] Preferably, the 3D model of the original α-amylase is predicted by computer modeling, and primers for the relevant mutation sites are designed. The point mutation primers are shown in Table 1:

[0021] Table 1 Primers for point mutation

[0022] Primer name Sequence (5'-3') S242E-F CAACACGGAAGCGGAATTTCAGTATGGCGAAATTC S242E-R GAAATTCCCGCTTCCGTGTTGGTAATGTTCGGCCAAAAC N569E-F TCAGGAACCGGATCATTGGGGCCAAGTGAACGC N569E-R CAATGATCCGGTTCCTGATAGCCAATAATGTTGG N605D-F CGCGGATGGCATGTATACCCTGACCCTGCCGGC N605D-R GTATACATGCCATCCGCGTTTTTGGTCATCGCTTTG

[0023] The underlined sites in the primers are mutation sites

[0024] The system of the PCR reaction is shown in Table 2:

[0025] Table 2 PCR reaction system

[0026]

[0027] The conditions of PCR reaction are shown in Table 3:

[0028] Table 3 PCR reaction conditions

[0029]

[0030] In a sixth aspect, the present invention provides a product, comprising the α-amylase mutant described in the first aspect, or the nucleic acid molecule described in the second aspect, or the vector described in the third aspect, or the recombinant cell described in the fourth aspect.

[0031] In a seventh aspect, the present invention provides a use of the product described in the sixth aspect in catalyzing starch hydrolysis.

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The α-amylase mutant provided by the present invention has good acid stability, and the ability of the enzyme mutant to catalyze starch hydrolysis is significantly improved between pH 1.9 and 4.0; when the pH is 1.9, the specific enzyme activity of the enzyme mutant is increased by 217.8% compared with the original enzyme; 2. The present invention increases the availability of α-amylase under a wider pH condition, has a significant effect on improving the raw material utilization rate and product quality in the starch processing industry and reducing production costs, meets the demand for acid-resistant α-amylase in the fields of energy, food and feed, has important social and economic benefits, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The diagram is a schematic diagram of the protein structure of the original α-amylase and the amino acid position No. 242;

[0034] Figure 2 The diagram is a schematic diagram of the protein structure of the original α-amylase and the amino acid position No. 569;

[0035] Figure 3 The schematic diagram of the protein structure of the original α-amylase and the amino acid position No. 605;

[0036] Figure 4 Standard curve for colorimetric determination of enzyme activity;

[0037] Figure 5 Schematic diagram of the relative enzyme activity of the original enzyme and enzyme mutants under different pH conditions. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0039] The acquisition methods of the materials used in the examples are as follows:

[0040] 1. Strains and plasmids

[0041] The strain E. coli DH5α was used for plasmid construction, and the strain E. coli BL21 (DE3) was used for exogenous protein expression, both of which were obtained from commercial sources. Completed by Jin Weizhi (Suzhou): synthesis of pET-22b (+) plasmid with the original Bacillus velezensis α-amylase gene, synthesis of mutation primers and plasmid construction primers, and sequencing of gene sequences in the plasmid. The pET-22b (+) plasmid expressing the α-amylase mutant was constructed by the applicant.

[0042] 2. Experimental reagents and culture medium

[0043] The main experimental reagents include: the enzymes and buffer components used in PCR are from MutUFO Fast Mutagenesis Kit (Nanjing Jujiang Biotechnology), plasmid extraction kit (Shanghai Bioengineering), DNAMarker (Shanghai Bioengineering), DNS reagent (Phygene), endonuclease DpnI (Adamas), and other conventional reagents are domestic analytical grade. The LB medium used is composed of: yeast powder 5g / L, tryptone 10g / L, NaCl 5g / L, if solid medium is used, add 15g / L agar powder. TB liquid medium: yeast powder 12g / L, tryptone 12g / L, glycerol 4ml / L, dipotassium hydrogen phosphate 12.5g / L, potassium dihydrogen phosphate 2.3g / L.

[0044] Example 1 Acid-resistant α-amylase mutant N605D

[0045] In this example, the α-amylase of Bacillus velezensis was used as the original enzyme, and the asparagine (N) at position 605 of the N-terminal amino acid sequence shown in SEQ ID No. 1 was mutated to aspartic acid (D). The model structure of the mutation site is shown in Figure 3 As shown, the nucleotide sequence is shown as SEQ ID No.2.

[0046] The preparation method of mutant N605D is as follows: 1. constructing a recombinant plasmid; 2. expressing the enzyme mutant; 3. preparing a crude enzyme solution. The details are as follows:

[0047] 1. Construction of recombinant plasmid

[0048] The primers for the N605D mutation site are shown in Table 4. PCR was performed using the pET-22b(+) plasmid carrying the original α-amylase gene as a template. The PCR system is shown in Table 5, and the PCR reaction conditions are shown in Table 6.

[0049] Table 4 Point mutation primers and plasmid construction primers

[0050] Primer name Sequence (5'-3') N605D-F CGCGGATGGCATGTATACCCTGACCCTGCCGGC N605D-R GTATACATGCCATCCGCGTTTTTGGTCATCGCTTTG

[0051] Note: The underlined part in the primers indicates the mutation site, “F” represents the upstream primer and “R” represents the downstream primer.

[0052] Table 5 PCR reaction system

[0053]

[0054] Table 6 PCR reaction conditions

[0055]

[0056] After the PCR product was verified by nucleic acid electrophoresis, the template was digested with endonuclease DpnI. The reaction system was prepared as shown in Table 7 and digested at 37°C for 1-2h.

[0057] Table 7 Template digestion system

[0058] Composition content DpI 1μl PCR products 0.06pmol

[0059] After template digestion, the product was subjected to DNA homologous recombination. The reaction system was prepared as shown in Table 8, and the reaction was carried out at 37°C for 30 minutes for one-step cloning to construct the expression plasmid of the mutant enzyme.

[0060] Table 8 Homologous recombination system

[0061] Composition content DpnI digest 0.06pmol 5×UFOBuffer 4μl UvsXase 2μl ddH2O to20μl

[0062] The obtained plasmid was transformed into the engineering bacterium E. coli DH5α for amplification, and the recombinant plasmid was extracted and sequenced for verification.

[0063] 2. Expression of enzyme mutants

[0064] Transfer the recombinant plasmid into the expression host E.coli BL21 (DE3), and spread it on an LB plate containing 100 ng / mL ampicillin for screening. Inoculate the transformant into 5 mL of LB liquid medium containing 100 ng / mL ampicillin, and culture it overnight at 37°C and 140 rpm in a shaker. Take 2.5 mL of the bacterial solution and inoculate it into 50 mL of TB liquid medium containing 100 ng / mL ampicillin, and culture it at 37°C and 140 rpm in a shaker for 6 hours. Add the filtered and sterilized IPTG to the fermentation broth to a final concentration of 0.4 mM, and continue to culture it at 22°C and 140 rpm for 22 hours.

[0065] 3. Preparation of crude enzyme solution

[0066] Transfer the fermentation broth of the recombinant bacteria to a centrifuge tube and collect the cells by centrifugation at 11,000 rpm. Resuspend the cells with 20 mL of the corresponding buffer, break the cells by ultrasonication for 10 min, and centrifuge again at 11,000 rpm to remove cell debris. The resulting supernatant is the crude enzyme solution containing the enzyme mutant.

[0067] Example 2 Acid-resistant α-amylase mutant N605D / S242E

[0068] In this example, the plasmid of the enzyme mutant N605D constructed in Example 1 was used as a template to mutate the serine (S) at position 242 of the N-terminal amino acid sequence to glutamic acid (E). The rest of the preparation method was the same as that in Example 1.

[0069] The model structure of the mutation site is as follows Figure 1 As shown, its point mutation primers and plasmid construction primers are shown in Table 9:

[0070] Table 9 Point mutation primers and plasmid construction primers

[0071] Primer name Sequence (5'-3') S242E-F CAACACGGAAGCGGAATTTCAGTATGGCGAAATTC S242E-R GAAATTCCCGCTTCCGTGTTGGTAATGTTCGGCCAAAAC

[0072] Example 3 Acid-resistant α-amylase mutant N605D / S242E / N569E

[0073] In this example, the plasmid of the enzyme mutant N605D / S242E constructed in Example 2 was used as a template to mutate the asparagine (N) at position 569 of the N-terminal amino acid sequence to glutamic acid (E). The rest of the preparation method was the same as that in Example 1.

[0074] The model structure of the mutation site is as follows Figure 2 As shown, its point mutation primers and plasmid construction primers are shown in Table 10:

[0075] Table 10 Point mutation primers and plasmid construction primers

[0076] Primer name Sequence (5'-3') N569E-F TCAGGAACCGGATCATTGGGGCCAAGTGAACGC N569E-R CAATGATCCGGTTCCTGATAGCCAATAATGTTGG

[0077] Example 4 Comparison of specific enzyme activities of the original α-amylase and its mutants under different pH conditions

[0078] The original α-amylase and the crude enzyme solution prepared in Examples 1-3 were treated with glycine-hydrochloric acid buffer at pH 4.0, 3.0, 2.0, and 1.9, respectively, and the residual enzyme activity was determined by the DNS method. The DNS method is one of the commonly used methods for determining enzyme activity, which is based on the color reaction between the reducing sugar produced by the enzyme-catalyzed reaction and 3,5-dinitrosalicylic acid (DNS) under alkaline conditions. The specific method is as follows:

[0079] Take 30 μL of crude enzyme solution and add it to 120 μL of 1% starch solution and blow it evenly. After reacting at 65℃ for 5 minutes, add 150 μL of DNS solution. Boil the mixed solution in a boiling water bath for 10 minutes, immediately cool it to room temperature in an ice bath, and measure its absorbance at 540 nm. In the negative control experiment, the crude enzyme solution was replaced with buffer solution, and the rest of the operations were the same.

[0080] Draw a standard curve: prepare 1.0000, 0.8000, 0.6000, 0.4000, 0.2000, 0.1000, 0.0000 mg / mL glucose standard solutions respectively, treat them using the above method and measure the absorbance values ​​to obtain the glucose-540nm standard curve (y=3.8975x+0.0432, R2=0.9994), as shown in Figure 4 shown.

[0081] Definition of crude enzyme activity: Under enzymatic reaction conditions, the amount of enzyme required to catalyze starch hydrolysis to produce 1 nmol of glucose per 1 min is one enzyme activity unit (U). Specific enzyme activity is the catalytic ability of the enzyme per unit volume of crude enzyme solution (U / mL); the specific enzyme activity of crude enzyme solution is calculated based on the absorbance value at 540nm and the standard curve.

[0082] The results are as follows Figure 5 As shown: after high temperature reaction at 65℃, compared with the original enzyme, the mutants N605D, N605D / S242E, and N605D / S242E / N569E still have higher enzyme activity. Among them, in the buffer with pH 2.0, the specific enzyme activity of the mutant enzyme N605D is 39.2% higher than that of the original enzyme; the specific enzyme activity of the mutant enzyme N605D / S242E is 82.5% higher than that of the original enzyme; the specific enzyme activity of the mutant enzyme N605D / S242E / N569E is 185.9% higher than that of the original enzyme. In the buffer with pH 1.9, the specific enzyme activity of the mutant enzyme N605D is 42.5% higher than that of the original enzyme; the specific enzyme activity of the mutant enzyme N605D / S242E is 80.9% higher than that of the original enzyme; the specific enzyme activity of the mutant enzyme N605D / S242E / N569E is 217.8% higher than that of the original enzyme.

Claims

1. An acid-resistant α-amylase mutant, characterized in that: The amino acid sequence of the α-amylase mutant is obtained by mutation of the sequence shown in SEQ ID NO.1, and the mutation is at least one of S242E, N569E, and N605D.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the α-amylase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleic acid molecule is obtained by base mutation of the nucleotide sequence shown in SEQ ID NO.

2.

4. A carrier, characterized in that Comprising the nucleotide sequence of claim 3.

5. The carrier according to claim 4, characterized in that The vector includes a cloning vector or an expression vector.

6. A recombinant cell, characterized in that The recombinant cell comprises the vector of claim 4.

7. A method for preparing the α-amylase mutant according to claim 1, characterized in that: The steps include: (1) Using the α-amylase gene as a template, a PCR reaction was performed using point mutation primers to obtain the α-amylase mutant gene; (2) Inserting the α-amylase mutant gene into an expression vector and then transferring it into a host cell to obtain a recombinant cell; (3) Collect the recombinant cells expressing the α-amylase mutant, resuspend the cells and then break the cells, and then centrifuge and take the supernatant to obtain the crude enzyme solution containing the α-amylase mutant.

8. The preparation method according to claim 7, characterized in that: In (2), the α-amylase mutant gene is inserted into the expression vector using the DNA homologous recombination method.

9. A product, characterized in that The product comprises the endoglucanase mutant according to claim 1 or the nucleic acid molecule according to any one of claims 2 to 3 or the vector according to claim 4 or the recombinant cell according to claim 6.

10. Use of the product according to claim 9 in catalyzing starch hydrolysis.

Images