ShRNA inhibitor expressed by CD36 molecule, RNAi exosome as well as preparation method and application of shRNA inhibitor and RNAi exosome

Abstract

The invention relates to the technical field of biological medicine, in particular to a shRNA inhibitor expressed by CD36 molecules, an RNAi exosome and a preparation method and application of the shRNA inhibitor and the RNAi exosome. According to the shRNA inhibitor expressed by the CD36 molecule, a nucleotide sequence as shown in SEQ ID NO.1 is selected as a target sequence, the shRNA designed according to the target sequence is high in specificity, and expression of the CD36 molecule can be remarkably inhibited. Meanwhile, through the shRNA inhibitor provided by the invention, by utilizing an RNAi technology and taking the amniotic stem cell exosome as a carrier, accurate and remarkable inhibition of CD36 molecules can be realized, the problems of poor curative effect and high cost of a traditional scar repair technology are avoided, and scar formation caused by the CD36 molecules is expected to be relieved or cured.

Description

Technical Field

[0001] The present application belongs to the field of biomedical technology, and in particular relates to a shRNA inhibitor of CD36 molecule expression, RNAi exosomes, and preparation methods and applications thereof. Background Art

[0002] Scars formed after skin damage are also called scars. Common scalds, burns, scratches, surgical sutures, etc. in daily life can cause scars on the skin. The essence of scar formation is that the original normal tissue structure of the skin is destroyed by external forces, and the body undergoes a disordered and abnormal repair process during the damage repair process. Normal skin and scars have the following different characteristics, including: (1) Compared with normal skin, the skin area where scars are formed often lacks sebaceous glands, hair follicles and other dermal appendages; (2) Compared with the regular woven structure of normal skin, scarred skin exhibits dense extracellular matrix fibers; (3) Scarred skin loses the elasticity and strength of normal skin due to changes in tissue structure. In addition to causing external damage and affecting beauty, scars may also cause deformity and functional disorders of damaged tissues. In the repair process after severe trauma, if scars are not properly handled or treated, fibrotic scar tissue with abnormal morphology and function will be produced, which will further evolve into hypertrophic scars (HTS) and keloids, which may cause disfigurement and permanent loss of skin tissue function. Although there are many options for scar repair, including radiotherapy, drug injection therapy, laser repair, external application of traditional Chinese medicine and surgical excision, there is currently no effective molecular therapy to prevent or reverse scars.

[0003] Studies have shown that the JUN-CD36 signaling axis plays a key role in scar formation. JUN transcription factors are highly expressed in extensive scars and drive scar formation by regulating the fibrosis of fibroblast subsets within the wound. JUN transcription factors rely on their downstream target CD36 molecules to function, leading to increased fibrosis at the site of injury.

[0004] Therefore, blocking CD36 molecules is expected to offset the fibrosis and scar formation caused by JUN, and the development of inhibitors of CD36 molecule expression will be of great significance for promoting wound healing and scar repair. Summary of the invention

[0005] The purpose of the present application is to provide a shRNA inhibitor of CD36 molecule expression, RNAi exosomes, and preparation methods and applications thereof, aiming to solve the problem that the prior art cannot effectively promote wound healing and scar repair.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In a first aspect, the present application provides a shRNA targeting a CD36 molecule mRNA sequence, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO.1.

[0008] In a second aspect, the present application provides a shRNA inhibitor for inhibiting the expression of CD36 molecules, and the nucleotide sequence of the shRNA inhibitor is shown in SEQ ID NO.2.

[0009] In a third aspect, the present application provides a recombinant vector, which comprises shRNA targeting the mRNA sequence of CD36 molecules or shRNA inhibitors that inhibit the expression of CD36 molecules.

[0010] In a fourth aspect, the present application provides a pseudovirus particle, wherein the pseudovirus particle comprises a recombinant vector.

[0011] Furthermore, the pseudoviral particles include psPAX2 plasmid and pVSVG plasmid.

[0012] In a fifth aspect, the present application provides a genetically engineered stem cell, which contains pseudovirus particles.

[0013] In a sixth aspect, the present application provides an RNAi exosome, wherein the RNAi exosome comprises shRNA targeting the CD36 molecule mRNA sequence and an exosome vector.

[0014] In a seventh aspect, the present application provides a method for preparing RNAi exosomes, the preparation method comprising the following steps:

[0015] Amniotic stem cells are cultivated, pseudovirus particles that inhibit CD36 molecules are co-cultured with the amniotic stem cells, and RNAi exosomes are then isolated to obtain RNAi exosomes.

[0016] In an eighth aspect, the present application provides the use of shRNA targeting CD36 molecule mRNA sequence, shRNA inhibitors that inhibit CD36 molecule expression, recombinant vectors, pseudovirus particles, genetically engineered stem cells or RNAi exosomes in the preparation of products that inhibit CD36 molecule expression, promote wound healing and inhibit scar formation, and promote wound healing and inhibit scar formation.

[0017] Further, the product includes a repair agent, which includes a repair composition and water, wherein the repair composition includes the following components in percentage by mass: 1-10w / v% RNAi exosomes, 1-10w / v% butylene glycol, 1-10w / v% glycerol, 1-10w / v% 1,2-hexanediol, 1-10w / v% methyl gluceth-20, 1-10w / v% glycereth-26, 1-10w / v% propylene glycol, 1-10w / v% maltooligosaccharide glucoside, 1-10w / v% Hydroxypropyl tetrahydrofurantriol, 1-10w / v% allantoin, 1-10w / v% oat kernel extract, 1-10w / v% PEG-40 hydrogenated castor oil, 0.1-1w / v% fullerene, 0.1-1w / v% p-hydroxyacetophenone, 0.1-1w / v% oligopeptide-1, 0.1-1w / v% tripeptide-1 copper, 0.1-1w / v% arginine / lysine polypeptide, 0.1-1w / v% ethylhexylglycerin, 0.1-1w / v% sodium hyaluronate, 0.1-1w / v% Disodium hydrogen phosphate, 0.01-0.1w / v% ammonium acryloyldimethyltaurate, 0.01-0.1w / v% hydroxyethylcellulose, 0.01-0.1w / v% hydrogenated starch hydrolysate, 0.01-0.1w / v% oligopeptide-5, 0.01-0.1w / v% oligopeptide-2, 0.01-0.1w / v% stoloniferum extract, 0.01-0.1w / v% xanthan gum, 0.01-0.1w / v% collagen, 0.01-0.1w / v% capryloylhydroxyguanidine, 0. 01-0.1w / v% disodium edetate, 0.01-0.1w / v% glyceryl caprylate, 0.01-0.1w / v% Chondrus crispus extract, 0.01-0.1w / v% Hookthornia oleracea extract, 0.01-0.1w / v% Sargassum argyi extract, 0.01-0.1w / v% Scutellaria baicalensis root extract, 0.01-0.1w / v% Licorice extract, 0.01-0.1w / v% Sophora flavescens extract, 0.001-0.01w / v% Gelidium japonicum extract.

[0018] In the first aspect of the present application, a shRNA targeting the mRNA sequence of the CD36 molecule is provided, and the nucleotide sequence of the shRNA is shown in SEQ ID NO.1. The provided shRNA can specifically target the mRNA sequence of the CD36 molecule and degrade it, thereby significantly inhibiting the expression of the CD36 molecule, thereby alleviating or curing scar formation caused by the CD36 molecule.

[0019] The second aspect of the present application provides a shRNA inhibitor for inhibiting the expression of CD36 molecules. The nucleotide sequence of the shRNA inhibitor is shown in SEQ ID NO.2. By selecting the nucleotide sequence shown in SEQ ID NO.1 as the target sequence, the shRNA inhibitor designed based on the target sequence has high specificity, can accurately interfere with the expression of CD36 molecules, and significantly inhibit the expression of CD36 molecules.

[0020] The recombinant vector provided in the third aspect of the present application comprises shRNA targeting the mRNA sequence of the CD36 molecule or an shRNA inhibitor inhibiting the expression of the CD36 molecule. The recombinant vector plasmid comprises two auxiliary plasmids, namely psPAX2 and pVSVG. The recombinant vector obtained by construction can be advantageously used to prepare pseudovirus particles for use.

[0021] The pseudovirus particles provided in the fourth aspect of the present application have better cellular uptake and more direct, stable and lasting interference with target cell gene expression than traditional small molecule inhibitors.

[0022] A fifth aspect of the present application provides a genetically engineered stem cell, which contains pseudovirus particles. The provided genetically engineered stem cell can effectively prepare various products.

[0023] The sixth aspect of the present application provides an RNAi exosome, which utilizes RNAi technology and uses amniotic stem cell exosomes containing a large amount of tissue repair cytokines as a carrier, thereby achieving accurate and significant inhibition of CD36 molecules and solving the problems of poor efficacy and high cost of traditional scar repair technology. It not only effectively promotes wound healing, but also reduces scar formation, which is of great significance and has great application prospects for inhibiting scar formation.

[0024] In a seventh aspect, the present application provides a method for preparing RNAi exosomes. The preparation method provided is to co-culture pseudovirus particles that inhibit CD36 molecules with amniotic stem cells and then separate them to obtain RNAi exosomes. The preparation method is simple and easy to operate, and is conducive to wide application.

[0025] In an eighth aspect, the present application provides the use of shRNA targeting CD36 molecule mRNA sequence, shRNA inhibitors that inhibit CD36 molecule expression, recombinant vectors, pseudovirus particles, genetically engineered stem cells or RNAi exosomes in the preparation of products that inhibit CD36 molecule expression, promote wound healing and inhibit scar formation, and promote wound healing and inhibit scar formation. The products have a wide range of applications and are conducive to the preparation of various products for use. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0027] Figure 1 This is the shRNA pseudovirus recombinant plasmid map of Example 1 of the present application;

[0028] Figure 2 It is the immunoblotting detection result and data statistics diagram of CD36 molecule of fibroblasts after intervention in Experimental Example 1 of the present invention;

[0029] Figure 3 It is the flow cytometry detection result and data statistical graph of the fibroblast CD36 molecule after intervention in Experimental Example 1 of the present invention. DETAILED DESCRIPTION

[0030] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0031] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0032] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0033] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0034] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0035] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass in the embodiment description of the present application can be μg, mg, g, kg and other mass units known in the chemical industry.

[0036] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0037] In a first aspect, an embodiment of the present application provides a shRNA targeting a CD36 molecule mRNA sequence, wherein the nucleotide sequence of the shRNA is shown in SEQ ID NO.1.

[0038] The first aspect of the embodiment of the present application provides a shRNA targeting the CD36 molecule mRNA sequence, the nucleotide sequence of the shRNA is shown in SEQ ID NO.1, and the provided shRNA can specifically target the CD36 molecule mRNA sequence and degrade it, thereby significantly inhibiting the expression of the CD36 molecule, thereby alleviating or curing scar formation caused by the CD36 molecule.

[0039] In some embodiments, the nucleotide sequence of the shRNA is as shown in SEQ ID NO.1, wherein SEQ ID NO.1 is specifically 5'-TCCAGGCAAACCGCTACATCA-3'.

[0040] A second aspect of the embodiments of the present application provides a shRNA inhibitor for inhibiting the expression of CD36 molecules. The nucleotide sequence of the shRNA inhibitor is shown in SEQ ID NO.2.

[0041] The second aspect of the embodiment of the present application provides a shRNA inhibitor for inhibiting the expression of CD36 molecules. The nucleotide sequence of the shRNA inhibitor is shown in SEQ ID NO.2. By selecting the nucleotide sequence shown in SEQ ID NO.1 as the target sequence, the shRNA inhibitor designed based on the target sequence has high specificity, can accurately interfere with the expression of CD36 molecules, and significantly inhibit the expression of CD36 molecules.

[0042] In some embodiments, the nucleotide sequence of the shRNA inhibitor is as shown in SEQ ID NO.2, wherein SEQ ID NO.2 is specifically:

[0043] 5'-TCCAGGCAAACCGCTACATCATTCAAGAGATGAAGGACACAGATCTGGTGCTT-3'.

[0044] Among them, the shRNA inhibitor is obtained by amplifying the shRNA as the target sequence by designing an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3. Specifically, SEQ ID NO.3 is:

[0045] 5'-GATCCCTCCAGGCAAACCGCTACATCATTCAAGAGATGAAGGACACAGATCTGGTGCTTTTTTG-3';

[0046] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.4. Specifically, SEQ ID NO.4 is:

[0047] 5'-AATTCAAAAAAGCACCAGATCTGTGTCCTTCATCTCTTGAATGATGTAGCGGTT TGCCTGGAG-3'.

[0048] A third aspect of an embodiment of the present application provides a recombinant vector, which comprises shRNA targeting the mRNA sequence of the CD36 molecule or an shRNA inhibitor that inhibits the expression of the CD36 molecule.

[0049] The recombinant vector provided in the third aspect of the embodiment of the present application comprises shRNA targeting the mRNA sequence of the CD36 molecule or shRNA inhibitor inhibiting the expression of the CD36 molecule, and the recombinant vector plasmid comprises two auxiliary plasmids, namely psPAX2 and pVSVG. The recombinant vector obtained by construction can be beneficial for preparing pseudovirus particles for use.

[0050] In some embodiments, upstream and downstream primers are provided to amplify the target gene, restriction endonucleases are used for digestion, and then the digested fragments are connected to the plasmid to obtain a recombinant vector.

[0051] A fourth aspect of the embodiments of the present application provides a pseudovirus particle, wherein the pseudovirus particle comprises a recombinant vector.

[0052] The pseudovirus particles provided in the fourth aspect of the embodiment of the present application use a three-plasmid system, in which two auxiliary plasmids not only provide the trans-acting factors and envelope proteins required for virus packaging, but also use "self-inactivation" modification to block the replication and transfer of progeny viruses, and have no tumorigenic activity, thereby ensuring their safety. Compared with traditional small molecule inhibitors, they have better cellular uptake and more direct, stable and lasting interference with target cell gene expression.

[0053] Furthermore, the pseudovirus particles include psPAX2 plasmid and pVSVG plasmid. The pseudovirus particles are packaged with the assistance of psPAX2 and pVSVG pseudovirus auxiliary packaging plasmids.

[0054] In some embodiments, the method for preparing pseudoviral particles comprises the following steps:

[0055] The provided recombinant vector and pseudovirus auxiliary packaging plasmid were co-transfected into packaging cells HEK293T, cultured, and the viral supernatant was collected.

[0056] A fifth aspect of an embodiment of the present application provides a genetically engineered stem cell, which contains pseudovirus particles.

[0057] A fifth aspect of an embodiment of the present application provides a genetically engineered stem cell, which contains pseudovirus particles. The provided genetically engineered stem cell can effectively prepare various products.

[0058] A sixth aspect of an embodiment of the present application provides an RNAi exosome, wherein the RNAi exosome comprises shRNA targeting the mRNA sequence of the CD36 molecule and an exosome vector.

[0059] The sixth aspect of the embodiment of the present application provides an RNAi exosome, which utilizes RNAi technology and uses amniotic stem cell exosomes containing a large amount of tissue repair cytokines as a carrier, thereby achieving accurate and significant inhibition of CD36 molecules and solving the problems of poor efficacy and high cost of traditional scar repair technology. It not only effectively promotes wound healing, but also reduces scar formation, which is of great significance and has great application prospects for inhibiting scar formation.

[0060] A seventh aspect of the present application provides a method for preparing RNAi exosomes, the preparation method comprising the following steps:

[0061] Amniotic stem cells are cultivated, pseudovirus particles that inhibit CD36 molecules are co-cultured with the amniotic stem cells, and RNAi exosomes are then isolated to obtain RNAi exosomes.

[0062] A seventh aspect of an embodiment of the present application provides a method for preparing RNAi exosomes. The preparation method provided is to co-culture pseudovirus particles that inhibit CD36 molecules with amniotic stem cells and then separate them to obtain RNAi exosomes. The preparation method is simple and easy to operate, and is conducive to wide application.

[0063] In an eighth aspect of the embodiments of the present application, there is provided the use of shRNA targeting CD36 molecule mRNA sequence, shRNA inhibitors that inhibit CD36 molecule expression, recombinant vectors, pseudovirus particles, genetically engineered stem cells or RNAi exosomes in the preparation of products that inhibit CD36 molecule expression, promote wound healing and inhibit scar formation, and promote wound healing and inhibit scar formation.

[0064] In an eighth aspect of the embodiments of the present application, there is provided an application of shRNA targeting CD36 molecule mRNA sequence, shRNA inhibitors inhibiting CD36 molecule expression, recombinant vectors, pseudovirus particles, genetically engineered stem cells or RNAi exosomes in the preparation of products that inhibit CD36 molecule expression, promote wound healing and inhibit scar formation, and promote wound healing and inhibit scar formation. The application is wide and is conducive to the preparation of various products for use.

[0065] Further, the product includes a repair agent, which includes a repair composition and water, wherein the repair composition includes the following components in percentage by mass: 1-10w / v% RNAi exosomes, 1-10w / v% butylene glycol, 1-10w / v% glycerol, 1-10w / v% 1,2-hexanediol, 1-10w / v% methyl gluceth-20, 1-10w / v% glycereth-26, 1-10w / v% propylene glycol, 1-10w / v% maltooligosaccharide glucoside, 1-10w / v% Hydroxypropyl tetrahydrofurantriol, 1-10w / v% allantoin, 1-10w / v% oat kernel extract, 1-10w / v% PEG-40 hydrogenated castor oil, 0.1-1w / v% fullerene, 0.1-1w / v% p-hydroxyacetophenone, 0.1-1w / v% oligopeptide-1, 0.1-1w / v% tripeptide-1 copper, 0.1-1w / v% arginine / lysine polypeptide, 0.1-1w / v% ethylhexylglycerin, 0.1-1w / v% sodium hyaluronate, 0.1-1w / v% Disodium hydrogen phosphate, 0.01-0.1w / v% ammonium acryloyldimethyltaurate, 0.01-0.1w / v% hydroxyethylcellulose, 0.01-0.1w / v% hydrogenated starch hydrolysate, 0.01-0.1w / v% oligopeptide-5, 0.01-0.1w / v% oligopeptide-2, 0.01-0.1w / v% stoloniferum extract, 0.01-0.1w / v% xanthan gum, 0.01-0.1w / v% collagen, 0.01-0.1w / v% capryloylhydroxyguanidine, 0. 01-0.1w / v% disodium edetate, 0.01-0.1w / v% glyceryl caprylate, 0.01-0.1w / v% Chondrus crispus extract, 0.01-0.1w / v% Hookthornia oleracea extract, 0.01-0.1w / v% Sargassum argyi extract, 0.01-0.1w / v% Scutellaria baicalensis root extract, 0.01-0.1w / v% Licorice extract, 0.01-0.1w / v% Sophora flavescens extract, 0.001-0.01w / v% Gelidium japonicum extract.

[0066] In some embodiments, the repair composition and sterile water are mixed in proportion, and the repair agent is obtained after disinfection and sterilization.

[0067] The following describes the invention in conjunction with specific embodiments.

[0068] Example 1

[0069] This embodiment provides a method for preparing pseudoviral particles, comprising the following steps:

[0070] (1) Construction of recombinant plasmid

[0071] According to the target sequence fragment shown in SEQ ID NO.1, the nucleotide sequence of the constructed shRNA is shown in SEQ ID NO.2 (numbered as CD36-shRNA#1): Then the primer sequence is designed according to the shRNA as shown in the following table:

[0072] Table 1

[0073]

[0074] Table 2

[0075]

[0076] The pseudovirus recombinant plasmid was constructed using the Jima gene pseudovirus interference vector LV-3 (pGLVH1 / GFP+Puro). The plasmid map is shown in Figure 1 The specific construction steps are as follows:

[0077] 1) shRNA DNA oligo using BLOCK-iT TM RNAi Designer was designed (as shown in the table above), the synthetic primers were provided by Sangon Biotechnology, the DNA oligo concentration was 100μM, and the corresponding sense and antisense DNA oligo solutions were used to prepare the annealing reaction system (20μL): including sense chain (100μM), antisense chain (100μM), 10× annealing buffer (Bao Ri Yi Shi Biology) 2μL each, and the rest was made up with sterile double distilled water (ddH2O). The annealing conditions were 95℃ for 5min, 85℃ for 5min, and 75℃ for 5min, and a 10μM shRNA DNA template was obtained, which was diluted to 100nM for subsequent ligation reactions.

[0078] 2) Construction of recombinant vector: Prepare enzyme digestion reaction system (50 μL) as shown in the following table. Perform electrophoresis 2 h after digestion. Use gel recovery kit (Quanshijin Biotechnology) to recover and dilute to 100 ng / μL for later use.

[0079] Table 3

[0080] Product Name volume 10× enzyme digestion buffer (Fermentas) 5.0μL BamHI (Fermentas) 2.5μL EcoRI (Fermentas) 2.5μL LV-3 vector (Gima gene) 5.0μL(5.0μg) <![CDATA[ddH2O]]> 35.0μL

[0081] Prepare the ligation reaction system (20 μL) as shown in the table below. Mix well and place at 25°C for 1 hour. After completion, transfer to competent cells for screening.

[0082] Table 4

[0083] Product Name volume 10× Ligation Buffer (Thermo Fisher Scientific) 2.0μL shRNA DNA template (100nM) 1.0μL T4 DNA ligase (Thermo Fisher Scientific) 1.0μL Enzyme digestion of LV-3 vector 0.5μL <![CDATA[ddH2O]]> 15.5μL

[0084] 3) Transformation of ligation products: 10 μL of ligation products were added to TOP10 competent cells (Weidi Biotechnology), incubated on ice for 30 min, heat-shocked at 42°C for 90 s, and incubated on ice for 5 min before adding blank LB medium. The cells were cultured on a shaking table at 37°C for 45 min for recovery, and then plated and screened on plates containing 100 μg / mL of ampicillin. Positive clones were identified by bacterial liquid PCR and then plasmids were extracted by shaking. Enzyme digestion and sequencing were performed for verification.

[0085] 4) Sequencing the recombinant vector plasmid. Extract and purify the correct recombinant plasmid verified by sequencing to obtain high-quality, high-concentration endotoxin-free shRNA pseudovirus recombinant plasmid. The recombinant plasmid map is as follows: Figure 1 shown.

[0086] (2) Pseudovirus packaging

[0087] The pseudovirus packaging cells are HEK293T. The pseudovirus recombinant plasmid and the auxiliary plasmid are co-transfected into the packaging cells according to the proportion. The pseudovirus supernatant is cultured and collected, and then concentrated and purified. The packaging process is as follows:

[0088] 1) 5×10 6 HEK293T cells were seeded into 10 cm culture dishes and cultured overnight (the complete culture medium was DMEM medium containing 10% FBS);

[0089] 2) Add the above-constructed shRNA pseudovirus recombinant plasmid and packaging plasmids (psPAX2 and pVSVG) to a 1.5 mL EP tube filled with 1 mL transfection buffer; at the same time, add 20 μL jetPRIME transfection reagent to the EP tube, mix well and place at room temperature for 10 minutes;

[0090] 3) Discard the culture medium in the culture dish, add 5 mL of fresh complete culture medium, then drop the mixture in 2) into the culture dish and mix well, and continue to culture in the incubator for 6 hours;

[0091] 4) Remove the transfection solution, add 10 mL of fresh complete culture medium, and continue culturing for 48 h;

[0092] 5) The virus supernatant was collected, filtered with a 0.45 μm filter to remove impurities, and then concentrated and purified using a virus concentration kit (Biyuntian) to obtain a pseudovirus concentrate.

[0093] Comparative Example 1

[0094] The difference between this comparative example and Example 1 is that the shRNA and the corresponding target sequence are shown in the following table, and the designed primer sequences are shown in the following table.

[0095] Table 5

[0096]

[0097] Table 6

[0098]

[0099] Comparative Example 2

[0100] The difference between this comparative example and Example 1 is that the shRNA and the corresponding target sequence are shown in the following table, and the designed primer sequences are shown in the following table.

[0101] Table 7

[0102]

[0103]

[0104] Table 8

[0105]

[0106] Example 2

[0107] This embodiment provides a method for preparing RNAi exosomes, comprising the following steps:

[0108] (1) Isolation, culture, infection, and collection of culture supernatant of amniotic membrane stem cells

[0109] 1) Isolation and culture of placental amniotic stem cells;

[0110] 2) Digest amniotic membrane stem cells with trypsin and count 10 6 The number of cells was plated in a 10 cm culture dish and cultured overnight. On the next day, the titer of the pseudovirus particles inhibiting CD36 molecules obtained in Example 1, Comparative Example 1, and Comparative Example 2 was adjusted to 1×10 8 TU / mL, and set up empty lentiviral particles NC (implemented according to Example 1, only the pseudovirus recombinant plasmid was replaced with the pseudovirus interference vector LV-3) as a negative control. The pseudovirus particles inhibiting CD36 molecules obtained in Example 1, Comparative Example 1, and Comparative Example 2 were added to a culture dish paved with amniotic stem cells, and protamine sulfate was added at a final concentration of 10 μg / mL, and the cells were infected and cultured overnight in a cell culture incubator;

[0111] 3) The next day, remove the cells, discard the infected culture supernatant, wash twice with DPBS, replace with fresh stem cell complete culture medium, and continue to culture overnight;

[0112] 4) 48 hours after cell infection, the culture supernatant was collected for the first time and replaced with fresh stem cell complete medium for continued culture;

[0113] 5) 72 hours after cell infection, collect the culture supernatant for the second time and replace with fresh stem cell complete medium to continue culture;

[0114] 6) 96 hours after cell infection, the culture supernatant was collected for the third time, and the supernatants collected for the first and second times were mixed together for RNAi exosome isolation.

[0115] (2) Isolation of RNAi exosomes and uptake into fibroblasts

[0116] 1) Isolate RNAi exosomes, the steps are as follows:

[0117] a. Centrifuge the collected supernatant at 4000×g at 4°C for 1 h, and transfer the supernatant to a new centrifuge tube;

[0118] b. Centrifuge the supernatant at 25,000 × g at 4°C for 30 min and transfer the supernatant to a new centrifuge tube;

[0119] c. Centrifuge the supernatant at 150,000 × g at 4 °C for 1 h;

[0120] d. After centrifugation, remove the supernatant, resuspend the precipitate with sterile saline, divide into aliquots, and freeze at -80℃ for later use.

[0121] 2) Fibroblasts take up RNAi exosomes, the steps are as follows:

[0122] When the coverage of fibroblasts reached 80%, trypsin digestion and cell counting were performed to obtain 5×10 5 Cell number, resuspend the cells in 1.5 mL of serum-free medium, add 500 μL of RNAi exosomes, pipette to mix, and then inoculate into a 6-well plate;

[0123] b. Centrifuge the plate at 2500 rpm at 25°C for 30 min, then return it to the incubator for overnight culture;

[0124] c. After culturing fibroblasts for 24 hours, replace with fresh serum-free medium containing RNAi exosomes and continue culturing;

[0125] d. After culturing fibroblasts for 48 h, the cells were collected for western blot and flow cytometry to detect the expression of CD36 molecules.

[0126] (3) Detection of CD36 molecule expression level

[0127] 1) Detection of CD36 molecule expression by western blot

[0128] a. Collect the cells by centrifugation into a 1.5 mL EP tube, tap the bottom of the tube to disperse the cells, add 150 μL of RIPA lysis buffer (Biyuntian) into the EP tube and pipette to mix until the cells are fully lysed;

[0129] b. Centrifuge the cell lysate at 15000rpm and 4℃ for 5min, take 48μL of the supernatant into a new 1.5mL EP tube, add 12μL of 5×SDS-PAGE protein loading buffer and mix well by pipetting, and heat in a boiling water bath for 5min to fully denature the protein;

[0130] c. Protein electrophoresis: Prepare SDS-PAGE gel using SDS-PAGE gel preparation kit (Biyuntian), cool the above heat-denatured protein sample to room temperature, and then load it into the SDS-PAGE gel loading well for protein electrophoresis;

[0131] d. Transfer to membrane after electrophoresis;

[0132] e. After the transfer is completed, immediately place the protein membrane in a membrane washing box pre-added with Western washing solution (Biyuntian) and rinse for 5 minutes to wash away the transfer solution on the membrane;

[0133] f. Dilute the CD36 molecule primary antibody (catalog number ab#80080, Abcam) with Western primary antibody diluent (Biyuntian), add the primary antibody diluent to the protein membrane, and incubate slowly on a side-to-side shaker at 4°C overnight;

[0134] g. Add Western washing solution and wash for 5 minutes by slowly shaking on a side-swing shaker. After the washing solution is completely absorbed, add washing solution again and wash for 5 minutes. Wash 3 times in total;

[0135] h. Dilute the HRP-labeled secondary antibody with Western secondary antibody diluent, add it to the washed protein membrane, and incubate it on a side-swinging shaker at room temperature for 1 hour;

[0136] i. Add Western washing solution and wash for 5 minutes by slowly shaking on a side-swing shaker. After the washing solution is completely absorbed, add washing solution again and wash for 5 minutes. Wash 3 times in total;

[0137] j. Protein detection: Use BeyoECL Plus (Biyuntian) ECL chemiluminescence kit to detect protein.

[0138] The results are as follows Figure 1As shown in the results, it can be seen that the three shRNA sequences targeting CD36 can reduce the expression of CD36 molecules, but the degree of reduction varies. Among them, the inhibitory effect of CD36-shRNA#1 is significantly different from that of the control group, CD36-shRNA#2 and CD36-shRNA#3, and the effect of inhibiting the expression of CD36 molecules is the best.

[0139] 2) Detection of CD36 molecule expression by flow cytometry

[0140] a. Collect the cells by centrifugation into a 1.5 mL EP tube, tap the bottom of the tube to disperse the cells, add 200 μL of fixation transmembrane solution (Biolegend) into the EP tube and mix well by pipetting, and incubate at 4°C in the dark for 15 min;

[0141] b. Add 500 μL of 1× Wash buffer (Biolegend), centrifuge at 1200×g, 25°C for 8 min, discard the supernatant, and add 1× Wash buffer again, washing twice in total;

[0142] c. Add 100 μL of 1× Wash buffer to resuspend the cells, add 5 μL of fluorescein-labeled CD36 antibody (Cat. No. 336207, Biolegend), and incubate at room temperature in the dark for 30 minutes;

[0143] d. Add 1 mL of 1× Wash buffer to resuspend the cells, centrifuge at 1200×g at 25℃ for 8 min, discard the supernatant and add 1× Wash buffer again, wash twice in total, resuspend the cells with 300 μL of 1× Wash buffer and detect on the instrument.

[0144] The results are as follows Figure 2 As shown in the results, it can be seen that the three shRNA sequences targeting CD36 can reduce the expression of CD36 molecules, but the degree of reduction varies. Among them, the inhibitory effect of CD36-shRNA#1 is significantly different from that of the control group, CD36-shRNA#2 and CD36-shRNA#3, and the effect of inhibiting the expression of CD36 molecules is the best, which is consistent with the results of the above-mentioned protein immunoblotting.

[0145] Example 3

[0146] This embodiment provides a method for preparing an RNAi exosome repair agent that promotes wound healing and inhibits scar formation, comprising the following steps:

[0147] (1) Mix the following proportions: 72.235% sterile water, 5% butylene glycol, 3% glycerol, 3% 1,2-hexanediol, 1% methyl gluceth-20, 1% glycereth-26, 1% propylene glycol, 1% maltooligosaccharide glucoside, 1% hydroxypropyl tetrahydrofurantriol, 1% allantoin, 1% oat kernel extract, 1% PEG-40 hydrogenated castor oil, 0.5% fullerene, 0.3% p-hydroxyacetophenone, 0.3% oligopeptide-1, 0.3% tripeptide-1 copper, 0.3% arginine / lysine polypeptide, 0.3% ethylhexylglycerin, 0.3% sodium hyaluronate, 0.3% disodium hydrogen phosphate, 0.1% Ammonium acryloyldimethyltaurate, 0.1% hydroxyethylcellulose, 0.1% hydrogenated starch hydrolyzate, 0.1% oligopeptide-5, 0.1% oligopeptide-2, 0.1% Fucus vesiculosus extract, 0.1% xanthan gum, 0.1% collagen, 0.1% capryloylhydroxyguanidine acid, 0.1% disodium edetate, 0.1% glyceryl caprylate, 0.01% Chondrus crispus extract, 0.01% Salvia officinalis extract, 0.01% Sargassum obtusifolia extract, 0.01% Scutellaria baicalensis root extract, 0.01% Licorice extract, 0.01% Sophora flavescens extract, 0.005% Gelidium pseudoamansifolia extract, stir well and heat until completely dissolved;

[0148] (2) sterilizing the mixed solution prepared in step (1) in an autoclave, and cooling naturally to room temperature after sterilization;

[0149] (3) Add the separated RNAi exosomes to the mixed solution obtained in step 2 at a ratio of 5%, stir while adding, and after mixing evenly, store in a cool place away from light after filling.

[0150] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A shRNA targeting CD36 molecule mRNA sequence, characterized in that: The nucleotide sequence of the shRNA is shown in SEQ ID NO.

1.

2. A shRNA inhibitor for inhibiting the expression of CD36 molecules, characterized in that: The nucleotide sequence of the shRNA inhibitor is shown in SEQ ID NO.

2.

3. A recombinant vector, characterized in that: The recombinant vector comprises the shRNA targeting the CD36 molecule mRNA sequence according to claim 1 or the shRNA inhibitor inhibiting the expression of the CD36 molecule according to claim 2.

4. A pseudoviral particle, characterized in that The pseudoviral particle comprises the recombinant vector according to claim 3.

5. The pseudovirion according to claim 4, characterized in that The pseudoviral particles include psPAX2 plasmid and pVSVG plasmid.

6. A genetically engineered stem cell, characterized in that: The genetically engineered stem cells contain the pseudoviral particles according to claim 4 or 5.

7. An RNAi exosome, characterized in that: The RNAi exosomes include the shRNA targeting the CD36 molecule mRNA sequence according to claim 1 and an exosome vector.

8. A method for preparing RNAi exosomes, characterized in that: The preparation method comprises the following steps: Cultivate amniotic stem cells, co-culture pseudovirus particles that inhibit CD36 molecules with the amniotic stem cells, and then separate RNAi exosomes to obtain RNAi exosomes.

9. Use of the shRNA targeting the CD36 molecule mRNA sequence according to claim 1, the shRNA inhibitor for inhibiting the expression of CD36 molecules according to claim 2, the recombinant vector according to claim 3, the pseudovirus particle according to claim 4, the genetically engineered stem cell according to claim 6 or the RNAi exosome according to claim 7 in the preparation of a product that inhibits the expression of CD36 molecules, promotes wound healing and inhibits scar formation, and promotes wound healing and inhibits scar formation.

10. The use according to claim 9, characterized in that: The product comprises a repair agent, which comprises a repair composition and water, wherein the repair composition comprises the following components in percentage by weight: 1-10 w / v% RNAi exosomes, 1-10 w / v% butylene glycol, 1-10 w / v% glycerol, 1-10 w / v% 1,2-hexanediol, 1-10 w / v% methyl gluceth-20, 1-10 w / v% glycereth-26, 1-10 w / v% propylene glycol, 1-10 w / v% maltooligosaccharide glucoside, 1-10 w / v% v%Hydroxypropyltetrahydrofurantriol, 1-10w / v%Allantoin, 1-10w / v%Oat Kernel Extract, 1-10w / v%PEG-40 Hydrogenated Castor Oil, 0.1-1w / v%Fullerene, 0.1-1w / v%Para-Hydroxyacetophenone, 0.1-1w / v%Oligopeptide-1, 0.1-1w / v%Tripeptide-1 Copper, 0.1-1w / v%Arginine / Lysine Polypeptide, 0.1-1w / v%Ethylhexylglycerin, 0.1-1w / v%Sodium Hyaluronate, 0.1-1w / v% % disodium hydrogen phosphate, 0.01-0.1w / v% ammonium acryloyldimethyltaurate, 0.01-0.1w / v% hydroxyethylcellulose, 0.01-0.1w / v% hydrogenated starch hydrolyzate, 0.01-0.1w / v% oligopeptide-5, 0.01-0.1w / v% oligopeptide-2, 0.01-0.1w / v% stoloniferum extract, 0.01-0.1w / v% xanthan gum, 0.01-0.1w / v% collagen, 0.01-0.1w / v% capryloylhydroxyguanidine, 0. .01-0.1w / v% disodium ethylenediaminetetraacetic acid, 0.01-0.1w / v% glyceryl caprylate, 0.01-0.1w / v% Chondrus crispus extract, 0.01-0.1w / v% Hookthornia extract, 0.01-0.1w / v% Sargassum extract, 0.01-0.1w / v% Scutellaria baicalensis root extract, 0.01-0.1w / v% Licorice extract, 0.01-0.1w / v% Sophora flavescens extract, 0.001-0.01w / v% Gelidium aegypsum extract.

Images