Engineering bacterium for fermentation production of vitamin B5 and application thereof

Abstract

The invention provides an engineering bacterium capable of optimizing and weakening ilvE gene expression and used for producing vitamin B, and a method for producing vitamin B5 through fermentation by using the engineering bacterium.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to an engineered bacterium for optimizing and weakening ilvE gene expression and a method for producing vitamin B5 by fermentation. Background Art

[0002] Vitamin B5 (VB5), also known as D-pantothenic acid, is a water-soluble vitamin and a component of coenzyme A and acyl carrier protein. As a cofactor for over 70 enzymes, it participates in the metabolism of sugars, fats, proteins, and energy, playing a crucial role in regulating physiological metabolism. VB5 is primarily used as an animal feed additive, food additive, and pharmaceutical API. With the discovery of new functions and the expansion of its application areas, market demand for VB5 is expected to continue to grow steadily.

[0003] China is the world's largest producer and exporter of VB5. Industrial production of VB5 is based on chemical synthesis. Companies typically use the isobutyraldehyde-formaldehyde-hydrocyanic acid method to synthesize DL-pantolactone. DL-pantolactone is then chemically or enzymatically resolved to produce L-pantolactone, which is then synthesized into VB5 with β-alanine, produced from acrylonitrile. The main raw materials used in chemical VB5 synthesis are flammable, explosive, and highly toxic. The production process generates cyanide-containing wastewater, which is difficult to treat, making VB5 a highly polluting industry.

[0004] The impact of environmental protection on the VB5 industry has gradually become apparent. Under large-scale, high-intensity environmental regulations, highly polluting VB5 companies have been forced to limit or even cease production, resulting in market supply shortages and skyrocketing prices, hindering the healthy development of downstream feed, food, and pharmaceutical industries. Without significant improvements in highly polluting VB5 production technology, this supply and demand situation is likely to persist for a long time. Therefore, innovation in green VB5 manufacturing technology is urgently needed!

[0005] Microbial fermentation to produce VB5 not only uses renewable glucose as raw material, but also the waste residue, wastewater and waste gas generated during the production process are easy to treat and recycle, which can effectively solve the high pollution problem of the VB5 industry. The regulatory mechanism of the metabolic pathway of microorganisms synthesizing VB5 from glucose is complex, and the fermentation yield is extremely low. The use of microbial fermentation to produce VB5 has been reported. For example, Reference 1

[0006] (CN109868254B) reports a method for producing engineered VB5 from Escherichia coli W1330, and the engineered strain ZJB18003, which was modified using this method. The strain reportedly produced 1.54 g / L of VB5, with a low feedstock conversion rate. Reference 1 also reports other deficiencies of this strain that are detrimental to industrial fermentation production of VB5. For example, its growth is inhibited by the modification, hindering rapid biomass growth during fermentation; and, for another example, its reliance on exogenous addition of expensive β-alanine (2.5 g / L) during VB5 synthesis.

[0007] L-valine, as an upstream branch metabolic pathway for VB5 biosynthesis, is highly susceptible to accumulation. Shake flask fermentation results show that the production of the byproduct valine is comparable to that of VB5, reaching over 10g / L. This results in low VB5 conversion rates and high production costs, which are key factors limiting its industrial application. However, blocking valine metabolism by knocking out the ilvE gene simultaneously blocks isoleucine and leucine synthesis, leading to nutritional deficiencies in all three branched-chain amino acids. The need for additional branched-chain amino acids during the fermentation process also significantly increases fermentation costs, limiting industrial application.

[0008] Therefore, the present invention provides a method for weakening ilvE gene expression, which enables the engineered bacteria to be in an optimal state of minimum valine production while maintaining normal growth without affecting VB5 production, thereby reducing by-product accumulation, improving VB5 conversion rate, and reducing VB5 fermentation production costs, which has important industrial application value. Summary of the Invention

[0009] In light of this, the inventors designed five RBS mutant sequences with different translational strengths based on the original RBS sequence of the ilvE gene. The translational strength of the RBS sequence can be calculated using online software (https: / / www.denovodna.com) (Nature biotechnology, 2009, 27, 946–950).

[0010] The endogenous RBS of the ilvE gene was mutated on the Escherichia coli chromosome through gene editing. At the same time, using VB5 fermentation yield and valine yield as indicators, the optimized RBS sequence of the ilvE gene was screened out, which significantly reduced the valine fermentation yield and significantly increased the VB5 yield.

[0011] The optimized RBS sequence includes the nucleotide sequence set forth in SEQ ID NO: 64. In a preferred embodiment, the nucleotide sequence set forth in SEQ ID NO: 64 is located within the range of positions -1 to -17 before the start codon of the ilvE gene. In a more preferred embodiment, the nucleotide sequence set forth in SEQ ID NO: 64 is located within the range of positions -1 to -16 before the start codon of the ilvE gene.

[0012] The present invention discloses the use of an optimized RBS sequence of the ilvE gene for vitamin B5 production. Those skilled in the art can draw upon the information herein to appropriately improve the translational activity of the RBS of the ilvE gene. It is particularly important to note that all similar substitutions and modifications readily apparent to those skilled in the art are considered encompassed by the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is readily apparent that those skilled in the art will be able to modify, adapt, and combine the methods and applications described herein to implement and apply the technology of the present invention without departing from the content, spirit, and scope of the present invention.

[0013] A first aspect of the present invention provides an optimized RBS sequence of the ilvE gene, wherein the optimized RBS sequence comprises the nucleotide sequence shown in SEQ ID NO: 64.

[0014] In some possible embodiments, the RBS optimized sequence has a nucleotide sequence as shown in SEQ ID NO: 8.

[0015] In some possible embodiments, the present invention also provides a vector or host containing the optimized RBS sequence of the ilvE gene.

[0016] The present invention also provides the use of the optimized RBS sequence of the ilvE gene in preparing an engineered bacterium for producing vitamin B5.

[0017] Another aspect of the present invention provides an engineered bacterium comprising the optimized RBS sequence disclosed herein, characterized in that the ilvE gene in the engineered bacterium is operably linked to the optimized RBS sequence disclosed herein. In an optimized embodiment, the optimized RBS sequence comprises the nucleotide sequence set forth in SEQ ID NO: 64. In a further optimized embodiment, the optimized RBS sequence is located within positions -1 to -17 before the start codon of the ilvE gene. In an even more preferred embodiment, the optimized RBS sequence is located within positions -1 to -16 before the start codon of the ilvE gene.

[0018] In some possible embodiments, the engineered bacteria provided by the present invention contain a nucleotide sequence as shown in SEQ ID NO: 64 or SEQ ID NO: 8.

[0019] In some possible embodiments, the engineered bacteria of the present invention are engineered bacteria for producing VB5. The engineered bacteria may contain, for example, an ilvE gene comprising the sequence set forth in SEQ ID NO:7. In some embodiments, the engineered bacteria disclosed herein can be obtained by operably linking the ilvE gene to an optimized RBS sequence comprising the nucleotide sequence set forth in SEQ ID NO:64 or the nucleotide sequence set forth in SEQ ID NO:8. In a preferred embodiment, the engineered bacteria disclosed herein contain the nucleotide sequence set forth in SEQ ID NO:64 upstream of the ilvE gene. In a more preferred embodiment, the engineered bacteria disclosed herein contain the nucleotide sequence set forth in SEQ ID NO:64 within positions -1 to -17 of the RBS sequence upstream of the ilvE gene. In a further preferred embodiment, the engineered bacteria disclosed herein contain the nucleotide sequence set forth in SEQ ID NO:64 within positions -1 to -16 of the RBS sequence upstream of the ilvE gene. In a most preferred embodiment, the engineered bacteria disclosed herein contain the nucleotide sequence set forth in SEQ ID NO:8 operably linked to the ilvE gene. In some possible embodiments, the obtained engineered bacteria contains the nucleotide sequence shown in SEQ ID NO: 43.

[0020] In some possible embodiments, the engineered bacteria disclosed herein also have the following characteristics: (1) expressing ilvG derived from Escherichia coli BL21 + M gene; and / or

[0021] (2) Expression of the L-aspartate α-decarboxylase gene panD from Bacillus licheniformis;

[0022] Preferably, the L-aspartate α-decarboxylase gene panD derived from Bacillus licheniformis has:

[0023] (a) the nucleotide sequence shown in SEQ ID NO: 1; or

[0024] (b) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (a), and having the same or similar functions as the nucleotide sequence shown in (a); or

[0025] (c) a nucleotide sequence that is at least 80% homologous to the nucleotide sequence shown in (a) or (b); and / or

[0026] (3) The copy number of the panB, panC and / or panE gene is increased, preferably by 1 to 20 copies.

[0027] In some possible embodiments, the plasmid contains any one or more of the panB, panC, and panE genes, and the panB, panC, and panE genes can be operably linked to the same or different promoters. In some possible embodiments, the promoter is the PJ23119 promoter and / or the trc promoter. In some possible embodiments, the plasmid contains the panB, panC, and panE genes, the panB and panC genes are panBC and are operably linked to the trc promoter, and the panE gene is operably linked to the PJ23119 promoter. In some possible embodiments, the engineered bacteria of the present disclosure include a plasmid containing any one or more of the panB, panC, and / or panE genes. In some possible embodiments, the panB gene encodes a ketopantoate hydroxymethyltransferase that catalyzes the addition of a methyl group to the substrate α-ketoisovalerate to form ketopantoate. Non-limiting examples of the panB gene include the nucleotide sequence shown in SEQ ID NO: 68. In some possible embodiments, the panE gene encodes a ketopantoate reductase that reduces ketopantoate to pantoate. Non-limiting examples of panE genes include the nucleotide sequence set forth in SEQ ID NO: 70. In some possible embodiments, the panC gene encodes a pantothenate synthase that further catalyzes the condensation of pantoate and β-alanine to form VB5. Non-limiting examples of panC genes include the nucleotide sequence set forth in SEQ ID NO: 69. In some possible embodiments, the copy number of the panB, panC, and / or panE genes is increased by 2-5, 3-8, 6-18, or 7-15.

[0028] In some specific embodiments of the present invention, the engineered bacteria further comprises an ilvG operably linked to a strong promoter and / or a strong RBS. + M and panD genes. In a preferred embodiment, the strong promoter is PL promoter and / or trc promoter, and the strong RBS is BCD2. In a more preferred embodiment, the BCD2 has:

[0029] (A) the nucleotide sequence shown in SEQ ID NO: 2; or

[0030] (B) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (A), and having the same or similar functions as the nucleotide sequence shown in (A); or

[0031] (C) A nucleotide sequence having at least 80% homology to the nucleotide sequence shown in (A) or (B).

[0032] In some possible embodiments, the ilvG + Both the ilvG and panD genes are operably linked to the trc promoter and / or the PL promoter. + The M gene is operably linked to the trc promoter, and the panD gene is operably linked to the PL promoter. + The M gene is operably linked to the PL promoter, and the panD gene is operably linked to the trc promoter. In some possible embodiments, the PL promoter comprises the nucleotide sequence shown in SEQ ID NO: 37. In some possible embodiments, the trc promoter comprises the nucleotide sequence shown in SEQ ID NO: 39.

[0033] In a preferred embodiment, the engineered bacteria disclosed herein are derived from Escherichia coli, preferably Escherichia coli K12, more preferably Escherichia coli K12 MG1655 strain.

[0034] The present invention also provides the use of the engineered bacteria disclosed herein in the production of vitamin B5. In some embodiments, vitamin B5 also includes a derivative of vitamin B5, such as panthenol.

[0035] The present invention also provides a method for producing vitamin B5, characterized in that vitamin B5 is produced by fermentation using the engineered bacteria disclosed herein as a fermentation strain.

[0036] Compared with the highly polluting chemical method for producing vitamin B5, the biological method for producing vitamin B5 of the present invention has the advantages of renewable raw materials, easy treatment and resource utilization of waste residues, wastewater and waste gas, and can be used for industrial production of vitamin B5 in practice, and has important application value.

[0037] The E. coli used in the present invention is the K12 MG1655 strain, whose ilvG gene is mutated and inactivated. Therefore, the present invention introduces the active ilvG of E. coli BL21. + The M gene improves the synthesis and supply of acetolactate, the precursor of VB5. The present invention inserts the ilvG gene from Escherichia coli BL21 into the chromosome of Escherichia coli K12 MG1655. + M gene, and the strong trc promoter regulates ilvG + The transcription of M is initiated and the terminator Ter is used to regulate ilvG + Transcription termination of M. ilvG +The insertion site of the M gene in the chromosome is the coding sequence of the avtA gene, which leads to the inactivation of avtA, weakening the synthesis of valine, thereby weakening the competitive pathway of VB5 and facilitating the biosynthesis of VB5.

[0038] The panD gene from Bacillus licheniformis was also integrated into the engineered bacteria avtA gene. The strong promoters PL and BCD2 were used to regulate transcription and translation initiation, respectively.

[0039] The fermentation method for producing VB5 comprises a culture medium containing a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutritional factors. Carbon sources include sugars such as glucose, lactose, and galactose. Inorganic nitrogen sources include ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride. Organic nitrogen sources include corn steep liquor, soybean meal hydrolyzate, hair powder, yeast extract, and peptone. Inorganic ions include one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, and potassium. No additional β-alanine is required for the culture medium. DETAILED DESCRIPTION

[0040] definition

[0041] Unless otherwise defined herein, the scientific and technical terms used in association with the present disclosure will have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the presence of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definition. It should be understood that the terms used herein are only for the purpose of describing a specific embodiment and are not intended to be limiting. Unless otherwise stated, the operating methods specifically adopted in this application (including: preparation technology, experimental steps, detection means, etc.) adopt conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (for example, recombinant DNA technology), and related art conventional techniques in the art. These technologies have been fully described in the existing literature, and specifically can be, for example, referring to Sam brook et al. Molecular Cloning: a Laboratory Manual 4th edition, Cold Spring Harbor Laboratory Press, 2012; Ausubel et al., Current Protocols in Molecular Biology, Wiley Online Press, updated from time to time.

[0042] As used herein, the terms "comprising," "including," and "having" are used interchangeably to mean that sequences, compositions, and methods include the recited components or steps, but do not exclude other components or steps. "Consisting essentially of," when used to define compositions and methods, should be construed to exclude any other components or steps that are clearly important for the technical effect to be achieved. "Consisting of" should be construed to exclude other components and steps not mentioned.

[0043] As used herein, the term "or" is to be understood as inclusive unless explicitly stated or obvious from the context.

[0044] Unless expressly provided or obvious from the context, otherwise as used herein, the term "about" should be understood to be within the normal tolerance range in the field, for example, within 2 standard deviations of the mean. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02% or 0.01% of the value. Unless otherwise obvious from the context, all numerical values ​​provided herein are modified by the term "about".

[0045] As used herein, the term "ribosome binding site (RBS)" refers to a non-translated region upstream of the start codon. The RBS contains a G- and A-rich SD (Shine-Dalg-arno) sequence, which is generally 5 nucleotides long. This sequence complements the 3' end of the ribosomal 16S rRNA, promoting the binding of the ribosome to the mRNA, which is conducive to the initiation of translation. There are generally 4-10 nucleotides between the SD sequence and the start codon AUG. See, for example, Barrick, D., et al., Nucleic Acids Res. 22(7):1287–1295 (1994); Wilson, BS, et al., Biotechniques 17:944-953 (1994). The RBS can control the accuracy and efficiency of mRNA translation initiation and is a decisive factor affecting downstream gene expression. When describing the position of an RBS, for example, "position -1," the numbering convention for gene coding sequences and their regulatory sequences in the art is followed. Specifically, "position -1" refers to the position corresponding to the non-coding nucleotide residue immediately adjacent to the first nucleotide residue (i.e., position +1) in the start codon (generally ATG or GTG). For example, in the sequence "5'-ATAAAAatg-3'," when the lowercase letters "atg" represent the start codon, the uppercase letters 5' upstream are all non-coding nucleotides, where "a" represents the +1 position, and the uppercase letter "A" immediately adjacent to the "a" at position +1 corresponds to position -1.

[0046] As used herein, the term "modified" when describing a sequence refers to a sequence that is derived from another sequence (also referred to as a parent sequence) and contains changes in one or more sequence structural units compared to the parent sequence. As non-limiting examples, a modified sequence can have, for example, a deletion, substitution, or addition of one or more amino acid or nucleotide residues, or a chemical modification of a functional group in one or more residues, such as methylation, methoxylation, ethylation, glycosylation, etc.

[0047] As used herein, the term "expression level" primarily refers to the amount of the translation product of the gene.

[0048] As used herein, the term "genome" generally refers to the entire genetic information of an organism encoded in DNA (or RNA). It may be present in chromosomes, on plasmids or vectors, or both.

[0049] As used herein, the term "endogenous" is intended to include those molecules and sequences (particularly endogenous genes or proteins) that are present in wild-type (natural) host cells prior to being modified to reduce expression of the corresponding endogenous genes and / or reduce production of endogenous proteins. In particular, endogenous nucleic acid molecules (such as genes) or proteins that do exist in (and can be obtained from) a particular host cell found in nature are understood to be "endogenous to the host cell" or "endogenous to the host cell." Furthermore, a cell that "endogenously expresses" a nucleic acid or protein expresses the nucleic acid or protein as if it were expressed in the same particular type of host found in nature. Thus, even if the host cell no longer produces an endogenous protein, such as in a knockout mutant in which the protein-coding gene is inactivated or deleted, the protein is still referred to as "endogenous" herein.

[0050] Accordingly, the term "exogenous" refers to a compound (such as a nucleotide sequence, expression cassette, construct, amino acid sequence or protein) that is foreign to a given host cell, e.g., not naturally found in the host cell; or, although naturally found in a given host cell, any recombinant or artificial nucleotide sequence is understood to be heterologous.

[0051] The term "ilvE" when describing a gene refers to a branched-chain amino acid aminotransferase gene. This enzyme catalyzes the transfer of the amino group of a branched-chain amino acid to an α-keto acid, resulting in the formation of an α-carboxylic acid and the corresponding branched-chain amino acid keto acid. For example, α-ketohexanoate is converted to L-leucine, α-ketoisovalerate is converted to L-valine, and α-keto-β-methylvaleric acid is converted to L-isoleucine. ilvE genes are known in various host bacteria that can be used to produce pantothenic acid, such as Escherichia coli, Corynebacterium glutamicum, and Bacillus licheniformis. The ilvE gene is generally located between the ilvM and ilvD genes. In a preferred embodiment, ilvE has the nucleotide sequence set forth in SEQ ID NO:7. The host bacteria may also harbor modified ilvE genes containing insertions, deletions, or substitutions in the wild-type ilvE gene due to natural mutation, artificial mutagenesis, or genetic recombination techniques. These modified ilvE genes also fall within the scope of the ilvE genes disclosed herein. Thus, in some embodiments, ilvE has a sequence that is at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 7. In some embodiments, ilvE has a sequence in which one or more nucleotide residues are inserted, deleted, or substituted in the nucleotide sequence set forth in SEQ ID NO: 7.

[0052] Example

[0053] The experimental technique in the following examples, if not otherwise specified, is conventional method. The test material used in the following examples, if not otherwise specified, is purchased from conventional biochemical reagent stores. The quantitative test in the following examples is repeated three times, and the results are averaged. In the following examples, if not otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art and commercially available common instruments, reagents, and can be found in " Molecular Cloning Experiment Guide (3rd Edition) " (Science Press), " Microbiology Experiment (4th Edition) " (Higher Education Press) and references such as the manufacturer's instructions of corresponding instruments and reagents.

[0054] In the following examples, unless otherwise specified, the nucleotide sequences in the sequence listing are written from left to right in the order from the 5' to the 3' end, and the amino acid sequences are written from left to right in the order from the amino terminus to the carboxyl terminus. In the event of any discrepancy between the sequence described in the specification and the sequence listing, the sequence described in the specification shall prevail.

[0055] Escherichia coli K12 MG1655: ATCC number 700926. pACYC184 plasmid: NEB, product catalog number E4152S. Plasmid pCas9 was purchased from Addgene, catalog number 62225; plasmid pTargetF was purchased from Addgene, catalog number 62226; gene mutation kit ( Site-Directed Mutagenesis Kit) was purchased from NEB, catalog number E0552S; pET28a(+) plasmid was purchased from Shanghai Biotechnology Co., Ltd., catalog number B540183.

[0056] The present invention will be further described below in conjunction with the embodiments:

[0057] Example 1 Detection method

[0058] The HPLC method was used to quantitatively determine the yield of VB5 in the fermentation broth. The specific method is as follows: Take the fermentation broth supernatant, add purified water to dilute to an appropriate concentration, and filter with a 0.22μm filter membrane. The chromatographic column used was Agilent ZORBAX SB-Aq, 4.6ⅹ250mm, the column temperature was 30℃, the detection wavelength was 210nm, and the mobile phase flow rate was 1mL / min. The mobile phase was 3.12g / L NaH2PO4·2H2O, and the pH was adjusted to 2.2 using phosphoric acid. Using calcium pantothenate (VB5) purchased from Sigma as the standard, a standard curve of 0.1-0.5g / L calcium pantothenate concentration and light absorbance value was determined.

[0059] Valine production was determined by HPLC. Mobile phase A: pure acetonitrile. Mobile phase B: 50 mM sodium acetate buffer, a mixture of pure water, acetonitrile, and triethylamine (82.8:17:0.2), adjusted to pH 4.9 with acetic acid. Derivatization Reagent I: 0.2700 g CNBF (3,5-dinitro-4-chloro-trifluoromethylbenzene) / 10 ml acetonitrile; Buffer II: pH 9.0 H₃BO₃-Na₂B₄Oₐ buffer: 0.2 mol / L boric acid and 0.05 mol / L borax solution. Store in the dark. Derivatization Method: Dilute the sample to 0.1-2 g / L. Take 100 μL of sample, add 300 μL of Derivatization Reagent I and 500 μL of Buffer II, and incubate in a homogenizer at 60°C, 400 rpm, and in the dark for 1 hour. After the reaction, filter through a 0.22 μm syringe filter and store for analysis. Detection conditions: Chromatographic column: J&KC18-H Column (4.6×250mm, 5μm); flow rate: 0.80mL / min; column temperature: 30℃; injection volume: 10.0μL; detection wavelength: 260nm.

[0060] Example 2 Construction of recombinant plasmid pACYC184-panBCE

[0061] Using P1 and P2 as primers and genomic DNA of wild-type Escherichia coli K12 MG1655 strain as template, the high-fidelity polymerase KAPA HiFi was used. TM HotStar, PCR amplified nucleotide sequence P trc -panBC is shown in SEQ ID NO: 3, where 10nt-45nt is the promoter trc, 74nt-868nt is the coding sequence of the panB gene, and 880nt-1731nt is the coding sequence of the panC gene. Primer P1 was designed to introduce the strong promoter trc, and the 5' ends of primers P1 and P2 were designed with BamHI and SphI restriction endonuclease sites, respectively. The PCR program was as follows: denaturation at 98°C for 30 seconds, annealing at 65°C for 15 seconds, and extension at 72°C for 90 seconds, for 26 cycles, to obtain a P fragment of approximately 1810 bp. trc -panBC gene fragment.

[0062] P1: 5'-CGC GGATCC GCACAACATCAATTTATCAGGA

[0063] (As shown in SEQ ID NO: 10, the underlined sequence is the BamHI enzyme recognition site, and the sequence in italics is the promoter trc)

[0064] P2:5'-ACAT GCATGC CCTGTGTTATGACAGATGAC-3'

[0065] (As shown in SEQ ID NO: 11, the underlined sequence is the SphI enzyme recognition site)

[0066] PCR amplified P trc -panBC product was identified and recovered by gel electrophoresis, and then double-digested with BamHI and SphI, and the pACYC184 plasmid was also double-digested. trc -panBC and pACYC184 plasmids were ligated using T4 ligase, and the ligation product was chemically transformed into Escherichia coli EC135 competent cells (Zhang et al. PLoS Genetics. 2012, 8(9):e1002987). After 1 hour of recovery, the cells were plated on LB plates containing chloramphenicol (10 μg / mL). The plate was placed in a 37°C incubator for 12 hours, and a single colony was picked for passage. The recombinant plasmid was extracted and sequenced to obtain the correct recombinant plasmid pACYC184-panBC.

[0067] Using the genome of Escherichia coli K12 MG1655 as a template and primers P3 and P4, PCR amplified the resulting PJ23119-panE sequence as shown in SEQ ID NO:4. The sequence 11-45 nt represents the PJ23119 promoter, 66-977 nt represents the panE gene coding sequence, and 988-1731 nt represents the terminator sequence. Primer P3 contained the promoter PJ23119, and primer P4 contained the terminator L3S2P56 sequence. SphI and BsaBI restriction endonuclease sites were designed at the 5' ends of primers P3 and P4, respectively. The PJ23119-panE product was amplified using the aforementioned PCR reaction conditions, identified by gel electrophoresis, and then double-digested with SphI and BsaBI, simultaneously digesting the pACYC184-panBC plasmid. The double-digested pJ23119-panE and pACYC184-panBC plasmids were recovered by gel electrophoresis and ligated using T4 ligase. The ligation product was then chemically transformed into competent E. coli DH5α cells and, after 1 hour of recovery, plated onto LB plates containing chloramphenicol (10 μg / mL). The plated plates were incubated at 37°C for 12 hours. Single colonies were picked and passaged, and the recombinant plasmids were extracted and sequenced. The correct recombinant plasmid, pACYC184-panBCE, was obtained, thus obtaining a recombinant plasmid that overexpresses genes in the terminal vitamin B5 biosynthesis pathway.

[0068]

[0069] (As shown in SEQ ID NO: 12, the underlined sequence is the SphI enzyme recognition site, and the sequence in italics is the promoter J23119)

[0070]

[0071] (As shown in SEQ ID NO: 13, the underlined sequence is the BsaBI enzyme recognition site, and the italicized sequence is the terminator L3S2P56 sequence)

[0072] Example 3 Engineering bacteria E. coli MG1655 avtA:panDB1-ilvG + Construction of M

[0073] The reported CRISPR-Cas9 gene editing system containing pCas9 and pTargetF vectors was applied (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015) Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System, Appl Environ Microb 81, 2506-2514.).

[0074] The gene mutation kit ( A Site-Directed Mutagenesis Kit (Cat. No. E0552S) was used to design primers P5 and P6 to mutate the pTargetF vector according to the kit instructions. The mutated N20 sequence was CTTTCCAAGC TGGGTCTACC (SEQ ID NO: 36), targeting the avtA gene (SEQ ID NO: 9). The mutated pTargetF vector was named pTargetFavtA.

[0075] P5:TGGGTCTACCGTTTTAGAGCTAGAAATAGC (as shown in SEQ ID NO: 14);

[0076] P6: GCTTGGAAAGGACTAGTATTATACCTAGG (as shown in SEQ ID NO: 15);

[0077] P7: CGGACTGGAAGAAGATCTG (as shown in SEQ ID NO: 16);

[0078] P8: TTTCTTAGACGTCGGAATTGAGACTCATGCACAGCACGA (shown in SEQ ID NO: 17);

[0079] P9:TCGTGCTGTGCATGAGT CT CAATTCCGACGTCTAAGAAAC (as shown in SEQ ID NO: 18);

[0080] P10: GATCTCCTTTTTAAGTGAACTTGGGGTCAGTGCGTCCTGCTGAT (shown in SEQ ID NO: 19);

[0081] P11: ATCAGCAGGACGCACTGACCCCAAGTTCACTTAAAAAGGAGATC (shown in SEQ ID NO: 20);

[0082] P12: TGCCGTTCATATTGGTGATGCAAAAAACCCCTCAAGACC (as shown in SEQ ID NO: 21);

[0083] P13: GGTCTTGAGGGGTTTTTTGCATCACCAATATGAACGGCA (as shown in SEQ ID NO: 22);

[0084] P14: GCTGATAGAGCTGCTTGGT (shown in SEQ ID NO: 23);

[0085] P15: GGAGCTACTCACACTGCTTG (as shown in SEQ ID NO: 24);

[0086] P16: CGCATACATTGATGCGTATG (shown in SEQ ID NO: 25).

[0087] The aspartate α-decarboxylase gene panD (shown in SEQ ID NO: 1) from Bacillus licheniformis was synthesized at a gene synthesis company. During the custom synthesis of the panD gene sequence, the XbaI and HindIII restriction endonuclease sequences were removed through synonymous codon replacement. During the custom synthesis of the panD gene sequence, the BCD2 sequence (shown in SEQ ID NO: 2) was also synthesized before the panD sequence, and XbaI and HindIII restriction enzyme sites were added to both ends of the BCD2-panD sequence. The synthesized sequence was ligated into a vector. The BCD2-panD synthetic vector and pET28a(+) plasmid were double-digested with restriction endonucleases XbaI and HindIII. The digested BCD2-panD gene fragment and the linearized vector segment were recovered by gel electrophoresis. The two fragments were then ligated using T4 ligase. The ligated product was transformed into competent E. coli DH5α cells and screened on LB plates containing 50 mg / L kanamycin to obtain transformants containing the recombinant plasmid. After expansion of the transformants, the plasmid was extracted and sequenced to verify the correct plasmid, pET28a-BCD2-panDB1.

[0088] Primers P7 and P8 were used to amplify the upstream sequence of the avtA gene of E. coli K12 MG1655. Primers P9 and P10 were used to amplify the synthetic PL promoter (SEQ ID NO: 37). Primers P11 and P12 were used to amplify the BCD2-panDB1-Ter gene fragment using pET28a-BCD2-panDB1 as a template. Primers P13 and P14 were used to amplify the downstream sequence of the avtA gene of E. coli K12 MG1655. These four fragments were connected by overlapping PCR to obtain a four-fragment assembly, DonorB1 (shown in SEQ ID NO: 5), which served as a template for gene editing. Among them, 1nt-312nt of SEQ ID NO: 5 is the upstream sequence of the target gene avtA gene, 325nt-474nt is the PL promoter, 475nt-555nt is the BCD2 sequence, 556nt-939nt is the panDB1 sequence, 944nt-991nt is the Ter terminator sequence, and 992nt-1257nt is the downstream sequence of the avtA gene.

[0089] The pCas9 plasmid was transformed into Escherichia coli K12 MG1655, plated onto LB plates containing 50 mg / L kanamycin, and cultured at 30°C to obtain strain MG1655 / pCas9. A lawn of MG1655 / pCas9 was placed in a 500 mL shake flask containing 50 mL of LB medium containing kanamycin and cultured at 30°C, 220 rpm. Arabinose was added to a final concentration of 10 mM for induction when the OD600 of the culture reached 0.2, and competent cells were prepared at an OD600 of 0.45. Two microliters of the pTargetFavtA plasmid and 10 microliters of the DonorBl template DNA were electroporated into MG1655 / pCas9 competent cells, plated onto dual-resistance LB plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C. Using primers P15 and P16, single colonies harboring PL-BCD2-panDB1-Ter integration within the avtA gene were identified and sequenced to confirm the correct PCR product size. Single colonies containing the correct sequence were selected and cultured in 0.2 mM IPTG to eliminate the pTargetFavtA plasmid, generating engineered E. coli MG1655 avtA:panDB1 / pCas strains. Competent cultures were then prepared using the same method described above.

[0090] The engineered strain E. coli MG1655 avtA:panDB1 / pCas was inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The diluted strain was then plated onto LB plates to obtain the pCas plasmid-free strain E. coli MG1655 avtA:panDB1. The panD gene was inserted into the coding sequence of the avtA gene on the chromosome, inactivating avtA and weakening the competitive metabolic pathway for valine.

[0091] The wild-type Escherichia coli K12 MG1655 ilvG gene is mutated, and the acetolactate synthase encoded by it is inactive. The present invention introduces the active ilvG gene of Escherichia coli BL21 into the chromosome of Escherichia coli K12 MG1655. + The M gene improves the synthesis of acetolactate, the precursor of VB5. The present invention inserts the ilvG gene from Escherichia coli BL21 into the chromosome of Escherichia coli K12 MG1655. + M gene, and the strong trc promoter regulates ilvG + The transcription of M is initiated and the terminator Ter is used to regulate ilv G + Transcription termination of M. ilvG + The M gene was integrated into another N20 target sequence of the avtA gene, TGTAACTACGACGGTCCACA (SEQ ID NO: 38). The pTargetF vector was mutated using the mutagenesis kit and primers P17 and P18. The mutated pTargetF was named pTargetFavtA1.

[0092] P17: ACGGTCCACAGTTTTAGAGCTAGAAATAGC (shown in SEQ ID NO: 26);

[0093] P18: CGTAGTTACAGACTAGTATTATACCTAGG (as shown in SEQ ID NO: 27);

[0094] P19: GGCAGAAAATCAGCCAGTTC (as shown in SEQ ID NO: 28);

[0095] P20: TCCACACATTACGAGCCGGATGATTAATTGTCAAGAACTCTGTAGCAAGGAAGG (as shown in SEQ IDNO: 29);

[0096] P21: TTGACAATTAATCATCCGGCTCGTATAATGTGTGGACAAGATTCAGGACGGGGAAC (as shown in SEQ IDNO: 30);

[0097] P22: CGAAAAAAGACGCTCTAAAAGCGTCTCTTTTCTGGTATATTCCTTTTGCGCTCAG (as shown in SEQ IDNO: 31);

[0098] P23: CAGAAAAGAGACGCT TTTAG AGCGTCTTTTTTCGTTTTGGAGCTACTCACACTGCTTG (as shown in SEQ ID NO: 32);

[0099] P24: GCCAATATGCAGATGCTCA (shown in SEQ ID NO: 33);

[0100] P25: CACGTTCGGATATGAACTG (as shown in SEQ ID NO: 34);

[0101] P26: CGTCAAGCTTCAGCAACTC (shown in SEQ ID NO: 35).

[0102] Primers P19 and P20 were used to amplify the upstream sequence of the avtA gene of E. coli K12 MG1655, and primers P21 and P22 were used to amplify the ilvG gene of E. coli BL21. +The M sequence was amplified using primers P23 and P24 to amplify the downstream sequence of the avtA gene of Escherichia coli K12 MG1655. The trc promoter TTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA (SEQ ID NO: 39) was introduced by primers P20 and P21, and the terminator sequence CCAGAAAAGAGACGCT was introduced by primers P22 and P23. TTTAG AGCGTCTTTTTTCGTTTT. Overlap PCR was used to connect the above three fragments to obtain the assembly DonorilvG + M (as shown in SEQ ID NO: 6) is used as a template for gene editing. SEQ ID NO: 6 1nt-305nt is the upstream sequence of the target gene avtA gene, 306nt-341nt is the trc promoter, 367nt-2013nt is the ilvG derived from E. coli BL21 + The coding sequence of the gene, 2010nt-2273nt is the coding sequence of the ilvM gene, 2274nt-2328nt is the terminator sequence, and 2329nt-2629nt is the downstream sequence of the avtA gene.

[0103] Take 2 μl of pTargetFavtA1 plasmid and 10 μl of DonorilvG + M template DNA was electroporated into E. coli MG1655 avtA:panDB1 / pCas competent cells, coated with double-resistance LB plates containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30°C. Primers P25 and P26 were used to identify the integration of Ptrc-ilvG in the avtA gene. + Single colonies of M-Ter were sequenced to verify the correct size of the PCR product. Single colonies with correct sequencing were selected and cultured with 0.2 mM IPTG to eliminate the pTargetFavtA1 plasmid. Competent cells were prepared as described above for later use. The cells were then inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The cells were diluted and plated on LB plates to obtain the engineered E. coli MG1655 avtA:panDBl-ilvG strain with the pCas plasmid eliminated. + M. by integrating active ilvG into the chromosome + M, increases the synthesis of VB5 precursor acetolactate.

[0104] Example 4 ilvE gene RBS sequence optimization

[0105] Using online translation efficiency prediction software (https: / / www.denovodna.com) (Nature Biotechnology, 2009, 27, 946–950), we calculated the translation efficiency of the ilvE gene, encompassing the ilvE coding sequence and the 119 bp upstream (as shown in the original sequence), to be 23144. Based on this, we mutated the AG-rich region of the RBS sequence 17 bp upstream of the start codon to generate a series of RBS sequences with varying translation efficiencies. The specific translation efficiencies are as follows:

[0106] Original sequence (SEQ ID NO: 40):

[0107] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAGCGCAAAAGGAATATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0108] Sequence with a translation efficiency of 1683 (SEQ ID NO: 41)

[0109] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAAAGTAGGTATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0110] Sequence with a translation efficiency of 2150 (SEQ ID NO: 42)

[0111] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAAAGAAAGATATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0112] Sequence with translation efficiency of 864 (SEQ ID NO: 43)

[0113] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAAAGAAAATATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0114] Sequence with a translation efficiency of 707 (SEQ ID NO: 44)

[0115] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTAAAATATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0116] Sequence with translation efficiency of 5813 (SEQ ID NO: 45)

[0117] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAAAAGGAATATAAAA atg ACCACGAAGAAAGCTGATTACATTTGGTTCAATGGGGAGATGGTTCGCTGGGAAGACGCGAAGGTGCATGTGATGTCGCACGCGCTGCACTATGGCACTTCGGTTTTTGAAGGCATCCGTTGCTACGACTCGCACAAAGGACCGGTTGTATTCCGCCATCGTGAGCATATGCAGCGTCTGCATGACTCCGCCAAAATCTATCGCTTCCCGGTTTCGCAGAGCATTGATGAGCTGATGGAAGCTTGTCGTGACGTGATCCGCAAAAACAATCTCACCAGCGCCTATATCCGTCCGCTGATCTTCGTCGGTGATGTTGGCATGGGAGTAAACCCGCCAGCGGGATACTCAACCGACGTGATTATCGCTGCTTTCCCGTGGGGAGCGTATCTGGGCGCAGAAGCGCTGGAGCAGGGGATCGATGCGATGGTTTCCTCCTGGAACCGCGCAGCACCAAACACCATCCCGACGGCGGCAAAAGCCGGTGGTAACTACCTCTCTTCCCTGCTGGTGGGTAGCGAAGCGCGCCGCCACGGTTATCAGGAAGGTATCGCGCTGGATGTGAACGGTTATATCTCTGAAGGCGCAGGCGAAAACCTGTTTGAAGTGAAAGATGGTGTGCTGTTCACCCCACCGTTCACCTCCTCCGCGCTGCCGGGTATTACCCGTGATGCCATCATCAAACTGGCGAAAGAGCTGGGAATTGAAGTACGTGAGCAGGTGCTGTCGCGCGAATCCCTGTACCTGGCGGATGAAGTGTTTATGTCCGGTACGGCGGCAGAAATCACGCCAGTGCGCAGCGTAGACGGTATTCAGGTTGGCGAAGGCCGTTGTGGCCCGGTTACCAAACGCATTCAGCAAGCCTTCTTCGGCCTCTTCACTGGCGAAACCGAAGATAAATGGGGCTGGTTAGATCAAGTTAATCAAtaa

[0118] Mutant engineered strain E. coli MG1655 avtA:panDBl-ilvG +The RBS of the ilvE gene of M.

[0119] The gene mutation kit ( A Site-Directed Mutagenesis Kit (Cat. No. E0552S) was used to mutate the pTargetF vector using primers E4641 and E4642 designed according to the kit instructions. The mutated N20 sequence (SEQ ID NO: 46) was AA TCCGCG CCTGAGC GCAAA. The mutated pTargetF vector was named pTargetFilvE.

[0120] E4641 (SEQ ID NO: 47): CCTGAGCGCAAA GTTTTAGAGCT AGAAA TAGC

[0121] E4642 (SEQ ID NO: 48): CGCGGATTGA CTAGTATTAT ACCTAGG

[0122] Primers E4683 and E4684 were used to amplify the upstream sequence of RBS, and primers E4685 and E4686 were used to amplify the downstream sequence of RBS. The two fragments were connected by overlapping PCR to obtain the assembly DonorR BS5813, which was used as a template for gene editing.

[0123] Take 2 μl of pTargetFilvE plasmid and 10 μl of DonorRBS5813 template DNA and electrotransform into E.coliMG1655 avtA:panDB1-ilvG + M / pCas competent cells were plated on a dual-resistance LB plate containing 50 mg / L kanamycin and 50 mg / L spectinomycin and cultured at 30°C. Primers E4689 and E4690 were used to amplify and sequence single colonies with the correct mutation in the RBS sequence of the ilvE gene. Single colonies with correct sequencing were selected and cultured with 0.2 mM IPTG to eliminate the pTargetF plasmid. The cells were further inoculated into non-resistant LB liquid medium and cultured at 37°C for 12 hours. The cells were diluted and plated on LB plates to obtain the engineered bacteria E. coli MG1655 avtA:panDBl-ilvG that had eliminated the pCas plasmid. + M RBSilvE5813, the RBS sequence before the ilvE start codon was mutated to GAAAG GAATATAAAA (SEQ ID NO: 63), which weakened the translation and expression strength of ilvE in the engineered bacteria.

[0124] Similarly, primers E4683 and E4687 were used to amplify the upstream sequence of RBS, and primers E4688 and E4686 were used to amplify the downstream sequence of RBS to construct a gene editing template to obtain the engineered bacteria E. coli MG1655 avtA:panDBl-ilvG + In MRBSilvE864, the RBS sequence before the ilvE start codon was mutated to GAAAG AAAATATAAAA (SEQ ID NO: 64).

[0125] Primers E4683 and E4691 were used to amplify the upstream sequence of RBS, and primers E4692 and E4686 were used to amplify the downstream sequence of RBS to construct a gene editing template to obtain the engineered strain E. coli MG1655 avtA:panDB1-ilvG + In MRBSilvE2150, the RBS sequence before the ilvE start codon was mutated to GA AAGAAAGATATAAAA (SEQ ID NO: 65).

[0126] Primers E4683 and E4693 were used to amplify the upstream sequence of RBS, and primers E4694 and E4686 were used to amplify the downstream sequence of RBS to construct a gene editing template to obtain the engineered strain E. coli MG1655 avtA:panDB1-ilvG + In MRBSilvE707, the RBS sequence before the ilvE start codon was mutated to AAA ATATAAAA (SEQ ID NO: 66).

[0127] Primers E4683 and E4695 were used to amplify the upstream sequence of RBS, and primers E4696 and E4686 were used to amplify the downstream sequence of RBS to construct a gene editing template to obtain the engineered strain E. coli MG1655 avtA:panDB1-ilvG + In MRBSilvE1683, the RBS sequence before the ilvE start codon was mutated to GA AAGTAGGTATAAAA (SEQ ID NO: 67).

[0128] E4683 (SEQ ID NO: 49): GCTTCAATCCAGAAACCTTAG

[0129] E4684 (SEQ ID NO: 50): CAGCTTTCTTCGTGGTCATTTTTATATTCCTTTTTCAGGCGCGGATTTGTTGTGA E4685 (SEQ ID NO: 51): CGCCTGAAAAGGAATATAAAAatgACCACGAAGAAAGCTG

[0130] E4686 (SEQ ID NO: 52): CATCAGCTCATCAATGCTCT

[0131] E4687 (SEQ ID NO: 53): CAGCTTTCTTCGTGGTCATTTTTATATTTTTCTTTCAGGCGCGGATTTGTTGTGA E4688 (SEQ ID NO: 54): CGCCTGAAAGAAAATATAAAAatgACCACGAAGAAAGCTG

[0132] E4689 (SEQ ID NO: 55): CATGATGCAACATCAGGTCA

[0133] E4690 (SEQ ID NO: 56): CAACATCACCGACGAAGATC

[0134] E4691 (SEQ ID NO: 57): CAGCTTTCTTCGTGGTCATTTTTATATCTT CTTTCAGGCG E4692 (SEQ ID NO: 58): CGCCTGAAAGAAAGATATAAAAatgACCAC GAAGAAAGCTG E4693 (SEQ ID NO: 59): CAGCTTTCTTCGTGGTCATTTTTATATTTTA GGCG E4694 (SEQ ID NO: 57) NO: 60): CGCCTAAAATATAAAAatgACCACGAAGAA AGCTG E4695 (SEQ ID NO: 61): CAGCTTTCTTCGTGGTCATTTTTATAACCTAC TTTCAGGCG E4696 (SEQ ID NO: 62): CGCCTGAAAGTAGGTATAAAAatgACCACGA AGAAAGCTG

[0135] The constructed vector pACYC184-panBCE was transformed into the engineered bacteria E. coli MG1655avtA:panDB1-ilvG + M. E.coli MG1655 avtA:panDBl-ilvG + M RBSilvE5813, E.coli MG1655 avtA:panDBl-ilvG + M RBSilvE2150, E.coli MG1655 avt A:panDBl-ilvG+ M RBSilvE1683, E.coliMG1655 avtA:panDBl-ilvG + M RBSil vE864, E.coli MG1655 avtA:panDBl-ilvG + In MRBSilvE707, the engineered bacteria E. coli MG1655 avtA:panDBl-ilvG were obtained. + M / pACYC184-panBCE, E.coli MG1655avtA:panDBl-ilvG + M RBSilvE5813 / pACYC184-panBCE, E.coliMG1655avtA:panDBl-ilvG + M RBSilvE2150 / pACYC184-panBCE, E.coli MG1655 avt A:panDBl-ilvG + M RBSilvE1683 / pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG + MRBSilvE864 / pACYC184-panBCE, E.coli MG1655 avtA:panDB l-ilvG + M RBSilvE707 / pACYC184-panBCE, used for fermentation production of VB5.

[0136] Example 5 Fermentation test of VB5 engineering bacteria

[0137] Take the test strain engineered bacteria E. coli MG1655 avtA:panDBl-ilvG + M / pACYC184-pan BCE, E.coli MG1655 avtA:panDBl-ilvG + M RBSilvE5813 / pACYC184-panBC E, E.coli MG1655avtA:panDBl-ilvG + M RBSilvE2150 / pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG + M RBSilvE1683 / pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG +M RBSilvE864 / pACYC184-panBCE, E.coli MG1655 avtA:panDBl-ilvG + Streak the M RBSilvE707 / pACYC184-panBCE onto a solid LB medium plate containing 34 mg / L chloramphenicol and incubate at 37°C for 12 hours. Pick the bacterial lawn from the plate and inoculate it onto a slant of LB medium. Incubate it at 37°C for 10-12 hours. Pick the bacterial lawn from the slant and inoculate it into liquid LB medium. Incubate it at 37°C at 220 rpm with shaking for 12 hours to obtain a seed solution. Inoculate the seed solution into the fermentation medium at a 3% inoculum size and incubate it at 37°C at 220 rpm with shaking.

[0138] Fermentation medium: MOPS 80 g / L, glucose 20 g / L, ammonium sulfate 10 g / L, potassium dihydrogen phosphate 2 g / L, magnesium sulfate heptahydrate 2 g / L, yeast extract 5 g / L, trace element mixture 5 mL / L, balance water. Trace element mixture: FeSO4·7H2O 10 g / L, CaCl2 1.35 g / L, ZnSO4·7H2O 2.25 g / L, MnSO4·4H2O 0.5 g / L, CuSO4·5H2O 1 g / L, (NH4)6Mo7O 24 ·4H2O 0.106g / L, Na2B4O7·10H2O 0.23g / L, CoCl2·6H2O 0.48g / L, 35% HCl 10mL / L, and the balance is water.

[0139] During the incubation period, samples were taken every 4 hours, and the pH of the reaction system was adjusted with ammonia to maintain a pH of 6.8-7.0. Glucose content was measured using an SBA-40D biosensor analyzer. When the glucose content in the system fell below 5 g / L, additional glucose was added to bring the glucose concentration to 20 g / L. After 36 hours of incubation, samples were collected and centrifuged at 12,000 g for 2 minutes. The supernatant was then collected and assayed for VB5 and valine content (see the table below).

[0140] Table 1

[0141]

[0142] *: Sugar consumption: refers to the ratio of the final production of VB5 to the total glucose consumption

[0143] By mutating the RBS sequence of the ilvE gene in Escherichia coli used for VB5 fermentation, the present invention constructed six engineered strains with varying translational expression activities of the ilvE gene. The strains with highly attenuated ilvE expression were found to significantly reduce valine production and significantly increase VB5 production. Specifically, valine production was below 0.1 g / L, glucose consumption was reduced by 30%, and VB5 conversion efficiency was significantly improved.

[0144] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

[0145] SEQ ID NO: 1 - panD - derived from Bacillus licheniformis

[0146] ATGTACCGTACGTTAATGAGCGCAAAACTTCACAGAGCGAGAGTGACGGAAGCCAATTTGAACTACGTCGGCAGCGTGACAATTGATGAAGATTTGCTGGATGCTGTCGGAATGATGGCAAATGAAAAAGTGCAAATTGTGAATAATAACGGGGCCCGGCTGGAAACGTACATTTATTCCCGGTGAAAGG GGCAGCGGCGTCGTTTGTTTAAACGGAGCTGCCGCCCGCCTTGTCCAGGTTGGAGATGTCGTCATCATCGTGTCTTATGCGATGATGTCTGAAGAGGAAGCAAAGACCCATAAGCCGAAGGTTGCCGTTTTGAACGAGAGAAACGAAATCGAGGAAATGCTGGGTCAGGAGCCAGCCCGTACCATTCTGTAA

[0147] SEQ ID NO: 2-BCD2

[0148] CCAAGTTCACTTAAAAAGGAGATCAACAATGAAAGCAATTTTCGTACTGAAACATCTTAATCATGCTAAGGAGGTTTCTAATG

[0149] SEQ ID NO: 3-P trc -panBC

[0150] CGC GGATCCTTGA CAATTAATCATCCGGCTCGTATAATGTGTGGA GCACAACATCAATTTATCAGGA TACGTTATGAAACCGACCACCATCTCCTTACTGCAGAAGTACAAACAGGAAAAAAAACGTTTCGCGACCATCACCGCTTATGACTATAGCTTCGCCAAACTCTTTGCTGATGAAGGGCTTAACGTCATGCTGGTGGGCGATTCGCTGGGCATGACGGTTCAGGGGCACGACTCCACCCTGCCAGTTACCGTTGCCGATATCGCCTACCACACTGCCGCCGTACGTCGCGGCGCACCAAACTGCCTGCTGCTGGCTGACCTGCCGTTTATGGCGTATGCCACGCCGGAACAAGCCTTCGAAAACGCCGCAACGGTTATGCGTGCCGGTGCTAACATGGTCAAAATTGAAGGCGGTGAGTGGCTGGTAGAAACCGTACAAATGCTGACCGAACGTGCCGTTCCTGTATGTGGTCACTTAGGTTTAACACCACAGTCAGTGAATATTTTCGGTGGCTACAAAGTTCAGGGGCGCGGCGATGAAGCGGGCGATCAACTGCTCAGCGATGCATTAGCCTTAGAAGCTGCTGGGGCACAGCTGCTGGTGCTGGAATGCGTGCCGGTTGAACTGGCAAAACGTATTACCGAAGCACTGGCGATCCCGGTTATTGGCATTGGCGCAGGCAACGTCACTGACGGGCAGATCCTCGTGATGCACGACGCCTTTGGTATTACCGGCGGTCACATTCCTAAATTCGCTAAAAATTTCCTCGCCGAAACGGGCGACATCCGCGCGGCTGTGCGGCAGTATATGGCTGAAGTGGAGTCCGGCGTTTATCCGGGCGAAGAACACAGT TTCCATTAAGGAGTCACGTTGTGTTAATTATCGAAACCC TGCCGCTGCTGCGTCAGCAAATTCGCCGCCTGCGTATGGAAGGCAAGCGCGTGGCGCTGGTGCCTACCATGGGTAACCTGCACGATGGCCATATGAAGCTGGTCGACGAAGCCAAAGCCCGCGCCGATGTGGTCGTCGTCAGTATTTTCGTTAACCCGATGCAGTTCGACCGCCCGGAAGATCTGGCTCGTTATCCACGGACCTTGCAGGAGGACTGCGAGAAGCTAAACAAACGTAAAGTGGATTTAGTTTTCGCCCCTTCGGTAAAAGAGATCTACCCGAACGGTACTGAAACCCACACTTACGTTGACGTTCCTGGCCTTTCGACCATGCTGGAAGGTGCCAGCCGTCCGGGACATTTTCGCGGCGTTTCGACTATTGTCAGCAAGCTGTTCAACCTGGTCCAGCCGGACATCGCCTGCTTCGGTGAAAAAGATTTTCAGCAACTGGCGCTGATCCGCAAAATGGTTGCCGATATGGGCTTCGATATTGAGATTGTCGGTGTGCCAATTATGCGCGCCAAAGACGGTCTGGCGCTAAGTTCC CGTAACGGTTAT CTGACG GCGGAACAACGCAAAATTGCGCCTGGTCTGTACAAAGTTTTAAGTT CGATTGCTGACAAATTGCAG GCTGGGGAACGGGATCTCGATGAAATTATTACCATTGCGGGGCAAGAACTGAATGAAAAAGGCTTCCGCGCCGATGATATTCAGATTCGCGATGCCGACACATTGCTGGAAGTTTCTGAAACCAGCAAACGGGCAGTAATTCTGGTAGCCGCCTGGCTTGGCGATGCTCGCCTGATCGACAACAAAATGGTCGAGCTGGCGTAATACTTAACTGGCGCTACGGCTGATGGCGCCAGTTATTAATTTACCCCAC GTCATCTGTCATAACACAGGGCATGCATGT

[0151] SEQ ID NO:4-PJ23119-panE

[0152]

[0153] SEQ ID NO: 5-donorBl

[0154]

[0155] SEQ ID NO: 6-DonorilvG+M donor BL21 source

[0156]

[0157] SEQ ID NO:7-ilvE gene sequence

[0158] atgaccacgaagaaagctgattacatttggttcaatggggagatggttcgctgggaagacgcgaaggtgcatgtgatgtcgcacgcgctgcactatggcacttcggtttttgaaggcatccgttgctacgactcgcacaaaggaccggttgtattccgccatcgtgagcatatgcagcgtctgcatgactccgccaaaatctatcgcttcccggtttcgcagagcattgatgagctgatggaagcttgtcgtgacgtgatccgcaaaaacaatctcaccagcgcctatatccgtccgctgatcttcgtcggtgatgttggcatgggagtaaacccgccagcgggatactcaaccgacgtgattatcgctgctttcccgtggggagcgtatctgggcgcagaagcgctggagcaggggatcgatgcgatggtttcctcctggaaccgcgcagcaccaaacaccatcccgacggcggcaaaagccggtggtaactacctctcttccctgctggtgggtagcgaagcgcgccgccacggttatcaggaaggtatcgcgctggatgtgaacggttatatctctgaaggcgcaggcgaaaacctgtttgaagtgaaagatggtgtgctgttcaccccaccgttcacctcctccgcgctgccgggtattacccgtgatgccatcatcaaactggcgaaagagctgggaattgaagtacgtgagcaggtgctgtcgcgcgaatccctgtacctggcggatgaagtgtttatgtccggtacggcggcagaaatcacgccagtgcgcagcgtagacggtattcaggttggcgaaggccgttgtggcccggttaccaaacgcattcagcaagccttcttcggcctcttcactggcgaaaccgaagataaatggggctggttagatcaagttaatcaataa

[0159] SEQ ID NO:8 - RBS optimized mutant sequence - all

[0160] GTCGGTCGACTTACTGTTTAGTCAGTTAAATAAACTGGTGGACGTCGCACACGTTGCCATCTGCCAGAGCACAACCACATCACAACAAATCCGCGCCTGAAAGAAAATATAAAA

[0161] SEQ ID NO:9 - avtA from Escherichia coli K12 MG1655

[0162]

[0163] SEQ ID NO: 68 - from Escherichia coli K12 MG1655, panB

[0164] Atgaaaccgaccaccatctccttactgcagaagtacaaacaggaaaaaaaacgtttcgcgaccatcaccgcttatgactatagcttcgccaaactctttgctgatgaagggcttaacgtcatgctggtgggcgattcgctgggcatgacggttcaggggcacgactccaccctgccagttaccgttgccgatatcgcctaccacactgccgccgtacgtcgcggcgcaccaaactgcctgctgctggctgacctgccgtttatggcgtatgccacgccggaacaagccttcgaaaacgccgcaacggttatgcgtgccggtgctaacatggtcaaaattgaaggcggtgagtggctggtagaaaccgtacaaatgctgaccgaacgtgccgttcctgtatgtggtcacttaggtttaacaccacagtcagtgaatattttcggtggctacaaagttcaggggcgcggcgatgaagcgggcgatcaactgctcagcgatgcattagccttagaagctgctggggcacagctgctggtgctggaatgcgtgccggttgaactggcaaaacgtattaccgaagcactggcgatcccggttattggcattggcgcaggcaacgtcactgacgggcagatcctcgtgatgcacgacgcctttggtattaccggcggtcacattcctaaattcgctaaaaatttcctcgccgaaacgggcgacatccgcgcggctgtgcggcagtatatggctgaagtggagtccggcgtttatccgggcgaagaacacagtttccattaa

[0165] SEQ ID NO: 69 - from Escherichia coli K12 MG1655, panC

[0166] Gtgttaattatcgaaaccctgccgctgctgcgtcagcaaattcgccgcctgcgtatggaaggcaagcgcgtggcgctggtgcctaccatgggtaacctgcacgatggccatatgaagctggtcgacgaagccaaagcccgcgccgatgtggtcgtcgtcagtattttcgttaacccgatgcagttcgaccgcccggaagatctggctcgttatccacggaccttgcaggaggactgcgagaagctaaacaaacgtaaagtggatttagttttcgccccttcggtaaaagagatctacccgaacggtactgaaacccacacttacgttgacgttcctggcctttcgaccatgctggaaggtgccagccgtccgggacattttcgcggcgtttcgactattgtcagcaagctgttcaacctggtccagccggacatcgcctgcttcggtgaaaaagattttcagcaactggcgctgatccgcaaaatggttgccgatatgggcttcgatattgagattgtcggtgtgccaattatgcgcgccaaagacggtctggcgctaagttcccgtaacggttatctgacggcggaacaacgcaaaattgcgcctggtctgtacaaagttttaagttcgattgctgacaaattgcaggctggggaacgggatctcgatgaaattattaccattgcggggcaagaactgaatgaaaaaggcttccgcgccgatgatattcagattcgcgatgccgacacattgctggaagtttctgaaaccagcaaacgggcagtaattctggtagccgcctggcttggcgatgctcgcctgatcgacaacaaaatggtcgagctggcgtaa

[0167] SEQ ID NO:70 - panE from Escherichia coli K12 MG1655

[0168] Atgaaaattaccgtattgggatgcggtgccttagggcaattatggcttacagcactttgcaaacagggtcatgaagttcagggctggctgcgcgtaccgcaaccttattgtagcgtgaatctggttgagacagatggttcgatatttaacgaatcgctgaccgccaacgatcccgattttctcgccaccagcgatctgctcctggtgacgctgaaagcatggcaggtttccgatgccgtcaaaagcctcgcgtccacactgcctgtaactacgccaatactgttaattcacaacggcatgggcaccatcgaagagttgcaaaacattcagcagccattactgatgggcaccaccacccatgcagcccgccgcgacggcaatgtcattattcatgtggcaaacggtatcacgcatattggcccggcacggcaacaggacggggattacagttatctggcggatattttgcaaaccgtgttgcctgacgttgcctggcataacaatattcgcgccgagctgtggcgcaagctggcagtcaactgcgtgattaatccactgactgccatctggaattgcccgaacggtgaattacgtcatcatccgcaagaaattatgcagatatgcgaagaagtcgcggcggtgatcgaacgcgaagggcatcatacttcagcagaagatttgcgtgattacgtgatgcaggtgattgatgccacagcggaaaatatctcgtcgatgttgcaggatatccgcgcgctgcgccacactgaaatcgactatatcaatggttttctcttacgccgcgcccgcgcgcatgggattgccgtaccggaaaacacccgcctgtttgaaatggtaaaaagaaaggagagtgaatatgagcgcatcggcactggtttgcctcgcccctggtag

Claims

1. An optimized RBS sequence of the ilvE gene, characterized in that: The RBS optimized sequence includes the nucleotide sequence shown in SEQ ID NO:

64.

2. Use of the optimized RBS sequence of the ilvE gene according to claim 1 in the preparation of an engineered bacterium for producing vitamin B5.

3. An engineered bacterium, characterized in that: The ilvE gene in the engineered bacteria is operably linked to an RBS optimized sequence comprising a nucleotide sequence as shown in SEQ ID NO: 64, wherein the RBS optimized sequence is located before the start codon of the ilvE gene, preferably within the range of -1 to -17 positions before the start codon relative to the ilvE gene.

4. The engineered bacterium according to claim 3, further expressing ilvG derived from Escherichia coli BL21 + M gene; and / or Expression of the L-aspartate α-decarboxylase gene panD from Bacillus licheniformis; and / or The increased copy number of the panB, panC and / or panE gene is preferably increased by 1 to 20 copies.

5. The engineered bacterium according to claim 3 or 4, which is derived from Escherichia coli, preferably Escherichia coli K12, more preferably Escherichia coli K12 MG1655 strain.

6. Use of the engineered bacteria according to any one of claims 3 to 5 in the production of vitamin B5.

7. A method for producing vitamin B5, characterized in that Vitamin B5 is prepared by fermentation using the engineered bacteria described in any one of claims 3 to 5 as a fermentation strain.

Images